ID: 1102025283

View in Genome Browser
Species Human (GRCh38)
Location 12:109711150-109711172
Sequence CAGGGGTCCGACAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 250}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102025283_1102025291 -2 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025291 12:109711171-109711193 TGGCCAGAGCCAGTGTTCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 152
1102025283_1102025296 14 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025296 12:109711187-109711209 TCCGGGGCTGGCCTGCCTGGTGG 0: 1
1: 0
2: 2
3: 32
4: 294
1102025283_1102025293 2 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025293 12:109711175-109711197 CAGAGCCAGTGTTCCGGGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 204
1102025283_1102025301 29 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025301 12:109711202-109711224 CCTGGTGGTTTTATGGACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 68
1102025283_1102025298 22 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025298 12:109711195-109711217 TGGCCTGCCTGGTGGTTTTATGG 0: 1
1: 0
2: 1
3: 12
4: 184
1102025283_1102025289 -4 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025289 12:109711169-109711191 CCTGGCCAGAGCCAGTGTTCCGG 0: 1
1: 0
2: 2
3: 21
4: 267
1102025283_1102025295 11 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025295 12:109711184-109711206 TGTTCCGGGGCTGGCCTGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 206
1102025283_1102025290 -3 Left 1102025283 12:109711150-109711172 CCTCAGGGCCTGTCGGACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 250
Right 1102025290 12:109711170-109711192 CTGGCCAGAGCCAGTGTTCCGGG 0: 1
1: 1
2: 3
3: 71
4: 1420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102025283 Original CRISPR CAGGGGTCCGACAGGCCCTG AGG (reversed) Intergenic
900246443 1:1638342-1638364 CAGAGGTCAGCCTGGCCCTGGGG - Intronic
900257672 1:1705484-1705506 CAGAGGTCAGCCTGGCCCTGGGG - Intronic
900529313 1:3144940-3144962 CAGGGGTTCCTGAGGCCCTGGGG - Intronic
900674627 1:3877086-3877108 CAGGGCTCACACAGGCCATGAGG - Intronic
900803311 1:4751089-4751111 CAGGGGAGCGAGAGGCACTGGGG - Intronic
901678055 1:10898335-10898357 CTGGGGTCTGACAGCCCTTGAGG - Intergenic
902289166 1:15425647-15425669 CAGGAGGCTGCCAGGCCCTGTGG + Intronic
902292196 1:15442641-15442663 ATGGGGTGCGACAGGCTCTGCGG - Intronic
902549220 1:17209395-17209417 CAGGGCCCTGACAGGCCCGGGGG + Intronic
902777477 1:18684079-18684101 CAGGGGTTCACCAGGCCATGAGG + Intronic
903331080 1:22597574-22597596 CAGGGGTCTGGCAAGCCCAGGGG + Intronic
903371877 1:22841730-22841752 CATGGGGCCGACAGGGCATGGGG - Intronic
903462831 1:23531094-23531116 CTGGGGTCCGGCCGGCTCTGGGG + Exonic
905682922 1:39887211-39887233 CAGGGATCCTACAGACCATGGGG + Intergenic
907237659 1:53062817-53062839 CCGGCGTCCGACGCGCCCTGGGG - Intronic
907427323 1:54388647-54388669 CAGGGGTCCCATATTCCCTGCGG - Intronic
915633462 1:157170268-157170290 CAGGTGTCCAACAGGCCTTATGG - Intergenic
917448479 1:175126785-175126807 CAAAGGTCAGAAAGGCCCTGTGG + Intronic
917526127 1:175789960-175789982 CAGGGATCCAACAAGCCCCGTGG + Intergenic
917576540 1:176327395-176327417 TAGGGGTCAGCCAGGCGCTGTGG - Intergenic
918051561 1:180977356-180977378 AAGGGCCCAGACAGGCCCTGGGG + Intronic
919789994 1:201284614-201284636 CAAGGGACCCACTGGCCCTGGGG - Intronic
920533113 1:206719287-206719309 GAGGGGGCCGACAGGCACAGTGG + Intronic
920884456 1:209913036-209913058 CAGGGGTCAGACCTGCACTGCGG + Intergenic
922041798 1:221904287-221904309 CAGGGGTCCCACCTGCTCTGTGG + Intergenic
923445749 1:234069695-234069717 CAGGGGTCCCAAAGTCCCTGAGG + Intronic
1062835264 10:631354-631376 CAGGCTTCCGTCAGCCCCTGGGG + Intronic
1065626749 10:27637734-27637756 CAGGAGTCCCTCAGGCCCTCGGG - Intergenic
1067051147 10:43021991-43022013 CAGGGAGCACACAGGCCCTGAGG - Intergenic
1067721616 10:48731851-48731873 CAGGGGTCTGACAGCTCCTCAGG + Intronic
1073294777 10:102432409-102432431 TGGGGGTCCGACGGGCCCCGGGG + Intronic
1073669861 10:105575667-105575689 CTGGGGCCCGTCAGGCCATGGGG - Intergenic
1074119028 10:110479596-110479618 CAGGGGACTCACTGGCCCTGTGG - Intergenic
1076342006 10:129755676-129755698 CAGGGCTCCGACAAGCACTGAGG - Intronic
1076362061 10:129896521-129896543 TGGGGGTGCGACAGGCCCTTGGG + Intronic
1076469683 10:130709856-130709878 CAGGAGGCAGACAGGCCTTGGGG + Intergenic
1077301047 11:1847143-1847165 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
1077600745 11:3572696-3572718 CAGGGCTCTCAGAGGCCCTGGGG + Intergenic
1080556350 11:33420946-33420968 CAAGGGTCCCTCCGGCCCTGAGG + Intergenic
1083256153 11:61496567-61496589 GAGGGGTCTGGCAGGGCCTGTGG + Intergenic
1083590284 11:63889597-63889619 AAGGGGCCTGACAGGCCCAGTGG + Intronic
1083609227 11:63997284-63997306 CAGTGGGCCCACAGGGCCTGGGG + Intronic
1084256661 11:67947281-67947303 CAGGGCTCTCAGAGGCCCTGGGG + Intergenic
1084949377 11:72656336-72656358 CAGGGCTCCTTCTGGCCCTGGGG - Intronic
1085462346 11:76701825-76701847 CAGGGGAGGGCCAGGCCCTGAGG - Intergenic
1087282680 11:96229406-96229428 CAGGGGTGTGAAAGGCCTTGGGG - Intronic
1089242696 11:117096554-117096576 CAGGGCTCCCTCAGACCCTGAGG - Intronic
1089497790 11:118916460-118916482 CAGGGCTCCTATAGGCCCTGGGG - Intronic
1090047884 11:123351694-123351716 CAGGGATCAGAGAGGCTCTGAGG - Intergenic
1091292651 11:134450501-134450523 CAGGGTACAGAGAGGCCCTGAGG - Intergenic
1091663622 12:2402746-2402768 CAGGGCTCCCACTGGCACTGGGG - Intronic
1091750354 12:3018348-3018370 CAGGGGGCTCTCAGGCCCTGTGG - Intronic
1092932111 12:13325898-13325920 CAGGGGACTGACAGAACCTGAGG + Intergenic
1093909142 12:24726002-24726024 CAGGGGGCCCACAGGCCTGGAGG + Intergenic
1096977338 12:55707158-55707180 CAGGGGAGCCAGAGGCCCTGGGG + Intronic
1097492007 12:60282553-60282575 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1102025283 12:109711150-109711172 CAGGGGTCCGACAGGCCCTGAGG - Intergenic
1102858088 12:116312214-116312236 CAGGGAGTCCACAGGCCCTGAGG + Intergenic
1104402050 12:128484378-128484400 CAGGTGTCCAGCAGGCACTGTGG + Intronic
1104955869 12:132465549-132465571 CAGGTGGCCGAGAGGCCCTGGGG - Intergenic
1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG + Intronic
1105026638 12:132853465-132853487 CAGGAGCCCCACAGGCCCTGGGG - Exonic
1106413079 13:29524538-29524560 CAGGGGTCCAACAGGAAATGGGG + Intronic
1108583720 13:51849634-51849656 CAGCGGTCGCAGAGGCCCTGTGG + Intergenic
1112494874 13:99896445-99896467 CTGGGGTCCCGCCGGCCCTGGGG + Exonic
1114063331 14:19038798-19038820 CAGGGGTCCTCCAGTGCCTGAGG + Intergenic
1114098925 14:19361198-19361220 CAGGGGTCCTCCAGTGCCTGAGG - Intergenic
1120876904 14:89383529-89383551 CAAGGAGCCGACAGGACCTGGGG + Intronic
1121277293 14:92677097-92677119 CAAGGGGCCGAGAGTCCCTGGGG - Intronic
1125431030 15:39593607-39593629 CAGGTGCTCGCCAGGCCCTGTGG - Exonic
1125609096 15:40958832-40958854 CAGGGCCCGGCCAGGCCCTGAGG + Intergenic
1125763411 15:42115292-42115314 CAGTGTTCCCACAGACCCTGTGG + Intergenic
1129052941 15:72797411-72797433 CAGGGGTCAGAGTGGCTCTGGGG - Intergenic
1129784375 15:78299426-78299448 CAGGGATGCTCCAGGCCCTGGGG - Intronic
1132552015 16:557399-557421 CAGGGTGGCCACAGGCCCTGGGG + Intergenic
1133367899 16:5225580-5225602 CAGGAGTCACAAAGGCCCTGGGG + Intergenic
1133371390 16:5248410-5248432 CAGGGCTCTCAGAGGCCCTGGGG - Intergenic
1134378784 16:13704477-13704499 CAGGTGTCAGACAGGCCAAGGGG + Intergenic
1135328407 16:21542507-21542529 CAGGTGTACGACAGGCAGTGTGG + Intergenic
1136338754 16:29628480-29628502 CAGGTGTACGACAGGCAGTGTGG + Intergenic
1136749007 16:32616174-32616196 CAGGGGTCCTTCAGCCTCTGTGG + Intergenic
1136775380 16:32868972-32868994 CAAGGGTCACACAGGGCCTGGGG - Intergenic
1136895236 16:33992540-33992562 CAAGGGTCACACAGGGCCTGGGG + Intergenic
1137609478 16:49809302-49809324 CAGGGGCCGGCCCGGCCCTGGGG + Intronic
1138451428 16:57095296-57095318 TAGGGGTCCCACAGTGCCTGAGG + Intronic
1138531690 16:57637923-57637945 CAGGGGTGCAAAAGGTCCTGGGG - Intronic
1141724120 16:85775117-85775139 CAGAGCTGCGACAGCCCCTGCGG - Intronic
1141945985 16:87310582-87310604 CAGGGGAGCGAGAGGCCCAGGGG + Intronic
1142041437 16:87897045-87897067 CAGGTGTACGACAGGCAGTGTGG + Intronic
1142140449 16:88470421-88470443 CAGGGGTCTGACGTGCTCTGTGG + Intronic
1203051140 16_KI270728v1_random:875388-875410 CAGGGGTCCTTCAGCCTCTGTGG + Intergenic
1203077797 16_KI270728v1_random:1131081-1131103 CAAGGGTCACACAGGGCCTGGGG - Intergenic
1142998265 17:3774174-3774196 CAGGGTTCAAACAGGCACTGGGG - Intronic
1145090259 17:19980153-19980175 CAGGGATCCGAGATGCCCTCGGG + Intergenic
1147538234 17:41334770-41334792 CAGGGCTCCACAAGGCCCTGTGG - Intergenic
1148002547 17:44398281-44398303 CAGCAGTCAGCCAGGCCCTGTGG - Exonic
1151659116 17:75509357-75509379 CAGGGGTCCACCAGAGCCTGGGG - Intronic
1151697611 17:75725851-75725873 CAGAGGACAGACAGGCCATGTGG + Intronic
1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG + Exonic
1152923220 17:83076226-83076248 CCGGGTGCCTACAGGCCCTGTGG - Intergenic
1152929556 17:83102913-83102935 CATGGGGCCGACAGGCCACGGGG - Intergenic
1152944614 17:83192152-83192174 CTGGGGTCCCCCTGGCCCTGGGG - Intergenic
1157042922 18:44061239-44061261 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1157248465 18:46073009-46073031 GAGGGGTCTGACCTGCCCTGGGG - Intergenic
1159595321 18:70377584-70377606 CAGGGGTTCTTCCGGCCCTGAGG - Intergenic
1160193995 18:76737941-76737963 AAGGGGACCCCCAGGCCCTGGGG + Intergenic
1160579376 18:79874945-79874967 CAGGTATGTGACAGGCCCTGAGG + Intronic
1160811466 19:1014735-1014757 CCCGGCTCTGACAGGCCCTGGGG + Intronic
1161126462 19:2560633-2560655 CAGGGTCCCCCCAGGCCCTGTGG - Intronic
1161551752 19:4916831-4916853 CAGGGGCCTGACGGGACCTGGGG - Intronic
1161800593 19:6415171-6415193 CTGGGGGCCGCCAGGACCTGGGG + Exonic
1162087107 19:8255563-8255585 CAAGGGTCACAGAGGCCCTGTGG - Intronic
1162536884 19:11267941-11267963 CAGGGGACAGAGAGGCACTGAGG - Intergenic
1162917055 19:13880343-13880365 CAGAGGTCCAGCAGGCCCGGAGG + Intronic
1165562267 19:36689818-36689840 AAGGGGTCCCTCAGACCCTGAGG - Intronic
1166213953 19:41323845-41323867 CTGGGTTCCCACAGGCCCGGTGG - Exonic
1166340151 19:42132509-42132531 AAGGGGGCGGACCGGCCCTGTGG - Intronic
1166950172 19:46421956-46421978 CAGGGGTCCCACAGCACCAGAGG + Intergenic
1167077860 19:47260092-47260114 CACGGGTCCCACAGGCTGTGGGG + Intronic
1167618960 19:50550970-50550992 GTGGGCTCCCACAGGCCCTGCGG - Exonic
1168241551 19:55091542-55091564 CGGAGGTCAGACAGGGCCTGGGG + Exonic
925065190 2:924085-924107 CAGAGCTCAGAGAGGCCCTGAGG + Intergenic
925170141 2:1745069-1745091 CAGGTGGCTGACAGGCCCCGGGG - Intergenic
928712676 2:34024811-34024833 CAGGGGTGCACCAGACCCTGAGG + Intergenic
932438654 2:71717918-71717940 CTGGGGTGGGCCAGGCCCTGGGG + Intergenic
933891099 2:86770858-86770880 CAGGTCTCTGACAGGCACTGAGG + Intronic
934815577 2:97323468-97323490 CAGGGGAGGGAGAGGCCCTGGGG + Intergenic
934822118 2:97385015-97385037 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
938107803 2:128545194-128545216 CATGGGTCCCATAGGCCCAGCGG - Intergenic
938480673 2:131658964-131658986 CAGGGGTCCTCCAGTGCCTGAGG + Intergenic
948439380 2:237976929-237976951 CTGGGGTAGGACAGGCTCTGTGG + Intronic
1171977736 20:31606103-31606125 CTGGGGTCCGCCGGTCCCTGGGG - Exonic
1172143849 20:32743058-32743080 GAGGGGTCCGAAAGGCTTTGTGG - Intronic
1173403908 20:42748559-42748581 CAGGGATCCTACAGCCTCTGTGG - Intronic
1173413115 20:42832329-42832351 GAGGGGAACAACAGGCCCTGTGG + Intronic
1174163783 20:48570361-48570383 CAGGGCTCAGCCAGGCACTGGGG + Intergenic
1174401246 20:50277128-50277150 CAGAGATCCTGCAGGCCCTGTGG - Intergenic
1175268013 20:57714252-57714274 CAGGGGCACGGCTGGCCCTGAGG - Intergenic
1175325969 20:58128839-58128861 CAGGGGCCCCTGAGGCCCTGTGG - Intergenic
1175891804 20:62319022-62319044 CAGGGGTTCGTCAGAGCCTGGGG + Intronic
1176101731 20:63367589-63367611 CAGGGTCCAGACAGGCCCGGAGG + Intronic
1179885375 21:44312046-44312068 CAGGCGGCAGACAGCCCCTGGGG - Intronic
1180067921 21:45421843-45421865 GAGGGGTGCAACTGGCCCTGGGG - Intronic
1180073760 21:45451420-45451442 AAGGGGCCCCACAGGCTCTGGGG + Intronic
1180092952 21:45542157-45542179 CTGGGGTCCGCGGGGCCCTGGGG - Intronic
1180092977 21:45542218-45542240 CTGGGGTCCGCGGGGCCCTGGGG - Intronic
1180160723 21:45997713-45997735 AGGGGGTCCGGCAGGTCCTGGGG - Exonic
1180481827 22:15761432-15761454 CAGGGGTCCTCCAGTGCCTGAGG + Intergenic
1180935971 22:19625584-19625606 CAGGGGTGTGACAGGCCCCTGGG - Intergenic
1181472900 22:23151896-23151918 TAAGGGTCCGACAGGCCAAGGGG - Intronic
1181865057 22:25848271-25848293 CAGGGATACGGGAGGCCCTGAGG + Intronic
1183030410 22:35099724-35099746 CAGGAGACAGACTGGCCCTGTGG + Intergenic
1184059875 22:42075029-42075051 CAGGGCTCAGAGAGGCCCTCAGG - Intronic
1184723747 22:46331198-46331220 CAGGGGCCCGACAAGCTCAGTGG + Intronic
1184771365 22:46598677-46598699 CTGAGGTCAGACAGGGCCTGTGG + Intronic
950424868 3:12919713-12919735 CAGGGTTCCCACAGGGACTGAGG + Intronic
950431661 3:12954421-12954443 CAGGGCTGGGAGAGGCCCTGGGG + Intronic
950629838 3:14275055-14275077 AAGGGGTCTAAAAGGCCCTGGGG - Intergenic
952215981 3:31278575-31278597 CAGGGCTCCCACATCCCCTGAGG - Intergenic
952900590 3:38109392-38109414 CAGGGGTCAGACCAGGCCTGGGG - Intronic
953034710 3:39201714-39201736 CAGGAGTCCCAGAGGCCATGTGG + Intergenic
953923449 3:46967717-46967739 CAGCTGTATGACAGGCCCTGGGG - Intronic
954705945 3:52480550-52480572 AGGGTGTCTGACAGGCCCTGAGG + Intronic
956759346 3:72425092-72425114 CAGGGGGCCACCAGGCCCAGTGG + Intronic
957071572 3:75571648-75571670 CAGGGCTCTCAGAGGCCCTGGGG + Intergenic
960989271 3:123300324-123300346 CCGGGGTCGGGCAGGGCCTGGGG - Intronic
961057997 3:123805046-123805068 CAGGGGTCCAGCAGGAGCTGTGG - Intronic
961359263 3:126357047-126357069 CAGGGGTCGGACTGGCCCGGGGG - Intronic
964509891 3:157438501-157438523 CAGGGGTCCCCCAGCCCCCGGGG + Intronic
967384936 3:188901942-188901964 CAGGGAGCTGAAAGGCCCTGTGG - Intergenic
968460344 4:721643-721665 TAAGGGTCCTACAGGCCCTGGGG - Intronic
968512778 4:1002821-1002843 CAGGCGTCGGCCGGGCCCTGGGG - Exonic
968664693 4:1814733-1814755 AAGGGGTGCCACAGACCCTGGGG + Intronic
968737351 4:2304289-2304311 CTGGAGCCCGACAGGGCCTGAGG + Exonic
968820015 4:2843530-2843552 CTGGGCTCCGACAGCCCCTCCGG + Intergenic
969015162 4:4098960-4098982 CAGGGCTCTCAGAGGCCCTGGGG + Intergenic
969496595 4:7529888-7529910 CAGAGGCCAGACAGGTCCTGAGG + Intronic
969620984 4:8278699-8278721 CAGGGGTGCCCCAGGCTCTGGGG + Intronic
969674531 4:8607612-8607634 CAGGGGAGCGACGGCCCCTGAGG - Intronic
969738767 4:9009292-9009314 CAGGGCTCTCAGAGGCCCTGGGG - Intergenic
970112903 4:12658636-12658658 CAGGGGTCCAACACACACTGTGG + Intergenic
972475571 4:39446567-39446589 CGGTGAACCGACAGGCCCTGAGG + Exonic
980264077 4:130492875-130492897 CAGAGGTGCTACAGGCCCTATGG - Intergenic
980306315 4:131065229-131065251 CAGGAGTCAGACAGGCTCTTGGG - Intergenic
980450074 4:132958978-132959000 CTGGGTTGCGACAGGACCTGTGG - Intergenic
983583831 4:169335283-169335305 AAGGGGTCCTACAGATCCTGGGG + Intergenic
985284294 4:188319386-188319408 CATGCCCCCGACAGGCCCTGGGG - Intergenic
985660468 5:1154746-1154768 AAGGGCTCCGACGGGCCCTGGGG - Intergenic
986226391 5:5818781-5818803 CTGGGATCCCACAGGCCATGAGG - Intergenic
990185005 5:53202664-53202686 CAGGGGCCCTGCAGGCCATGGGG + Intergenic
991436911 5:66605685-66605707 CAGGGGTCTTACAGGCTCTTTGG - Intronic
995903252 5:117093949-117093971 CTGGGGTCCGACAGTGCCTGGGG - Intergenic
998031816 5:138876974-138876996 CAGGTGTCAGACCTGCCCTGTGG - Intronic
998407787 5:141883581-141883603 CAGCGGTCCGTCAGGACCCGAGG - Intergenic
999438208 5:151580908-151580930 CAAGGATCCAGCAGGCCCTGTGG + Intergenic
1001831401 5:174792291-174792313 CAGGGGACCAACAGACACTGGGG - Intergenic
1001896726 5:175388816-175388838 ATGGGGTCTGACAGGCTCTGTGG - Intergenic
1001990904 5:176114576-176114598 CAGGGGTCCTTCAGCCTCTGTGG + Exonic
1002225970 5:177723564-177723586 CAGGGGTCCTTCAGCCTCTGTGG - Exonic
1002267877 5:178047646-178047668 CAGGGGTCCTTCAGCCTCTGTGG + Exonic
1004424920 6:15500785-15500807 CAGGACTCTGACAGGCTCTGGGG - Intronic
1006164143 6:32054580-32054602 CAGGGGACAGCCAGGACCTGAGG - Intronic
1006164769 6:32057778-32057800 CAGGGGACAGCCAGGACCTGAGG - Intronic
1006802714 6:36769550-36769572 CCGAGGGCTGACAGGCCCTGAGG + Intronic
1007578112 6:42939011-42939033 CAGGGTTCAGGCAGGCCTTGTGG + Exonic
1007693882 6:43719563-43719585 CAGGGGTCCTCCAGGCCATTGGG - Intergenic
1010070527 6:71738951-71738973 CAGTGGTCCTATAGGTCCTGTGG - Intergenic
1017888723 6:158621989-158622011 CAGGGGTGCGGCTGGCTCTGAGG - Intronic
1018838084 6:167500091-167500113 CAAGGGGCCCAGAGGCCCTGAGG + Intergenic
1019145922 6:169975561-169975583 CAGGCGTCCGCCCTGCCCTGAGG - Intergenic
1019487005 7:1294045-1294067 CCGGGGTCCCACAGCCCCTCGGG - Intergenic
1019954719 7:4404612-4404634 CAGGTGCCAGCCAGGCCCTGGGG - Intergenic
1020081092 7:5286044-5286066 ATGGGGTCCCACAGGCCCAGAGG - Intronic
1020276689 7:6628798-6628820 CAGGGGTCTGAGTGGTCCTGTGG + Intergenic
1025197821 7:56946129-56946151 ATGGGGTCCCACAGGCCCAGAGG + Intergenic
1025674127 7:63630809-63630831 ATGGGGTCCCACAGGCCCAGAGG - Intergenic
1026157776 7:67842244-67842266 GAGGGGTACGACAGACACTGGGG + Intergenic
1026421464 7:70241580-70241602 CAGGGGTCCCACAGGGGCTAGGG - Intronic
1026900199 7:74032764-74032786 CAGGGTTCAGCCAGGCCCAGGGG + Intronic
1027050829 7:75020145-75020167 CAGAGGTGAGCCAGGCCCTGGGG + Exonic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028596104 7:92547389-92547411 CAGGAGGCAGACAGGCTCTGGGG + Intergenic
1029073840 7:97920620-97920642 CAGGGCTCTCAGAGGCCCTGGGG + Intergenic
1029803739 7:102975888-102975910 CAGGGGCCCTGCAGGCCATGGGG + Intronic
1030269934 7:107660538-107660560 CAGGGGCGGGCCAGGCCCTGTGG - Intergenic
1033245328 7:139712859-139712881 CAGGGCTCAGACAAGGCCTGAGG + Intronic
1034420428 7:150987647-150987669 CAGGGGTCTGCCAGCCTCTGGGG + Intergenic
1034970102 7:155413423-155413445 CAGGGAGTGGACAGGCCCTGGGG + Intergenic
1035621337 8:1037443-1037465 CAGGCCACCGCCAGGCCCTGGGG - Intergenic
1035989799 8:4477032-4477054 CTGGGGTCCCACCAGCCCTGCGG - Intronic
1036635830 8:10548917-10548939 CAGGGGTCCGACTGAGGCTGGGG + Intronic
1036640951 8:10583418-10583440 CAGGTGTCAGACAGGGCCTGGGG - Intergenic
1036890410 8:12592829-12592851 CAGGGCTCTCAGAGGCCCTGGGG + Intergenic
1037640396 8:20736885-20736907 CAGGAGTCCAATGGGCCCTGGGG - Intergenic
1039425107 8:37479164-37479186 CAGGTGTCCAAAAGGTCCTGGGG - Intergenic
1040471617 8:47738823-47738845 CCCGGGTCCGGCCGGCCCTGGGG + Exonic
1042979239 8:74506999-74507021 CAGGGATCTGACAGACCTTGTGG - Intergenic
1045380218 8:101616561-101616583 CAGGGGTCTGACAAGGACTGAGG - Intronic
1048600562 8:135915146-135915168 GAGGGGAACAACAGGCCCTGGGG + Intergenic
1048992400 8:139768413-139768435 CAGTGGTGGGCCAGGCCCTGCGG + Intronic
1048992579 8:139770015-139770037 CAGTGGTGGGCCAGGCCCTGTGG + Intronic
1049328699 8:142038397-142038419 CAGTGGTCCCAAAGGCCCTTTGG + Intergenic
1049621620 8:143600816-143600838 CCAGGGTTTGACAGGCCCTGGGG - Exonic
1055621329 9:78127824-78127846 CAGGGGGCAGACAGGCCACGGGG + Intergenic
1055761607 9:79614703-79614725 CATGTGGCCCACAGGCCCTGGGG - Intronic
1060229897 9:121818790-121818812 CAGGGGTCGGACAGGGGCTCAGG + Intergenic
1061177832 9:129008249-129008271 CAGGGCTCTGGCAGCCCCTGGGG - Exonic
1061245635 9:129400145-129400167 CACAGGACAGACAGGCCCTGCGG + Intergenic
1061811426 9:133164470-133164492 CTGGGGTCCCAGAGTCCCTGGGG - Intergenic
1062029511 9:134355921-134355943 CAGGTGTCAGACAAGCCCTGGGG + Intronic
1062048525 9:134435429-134435451 CAGGGATGGGCCAGGCCCTGAGG + Intronic
1062393955 9:136345150-136345172 GAGGGGTCCGGCAGGCACAGGGG + Intronic
1062462088 9:136666291-136666313 GAGGGGTCCGCCAGTGCCTGCGG + Intronic
1185454736 X:303206-303228 CAGGGCTCGGGCAGGCCCCGCGG + Exonic
1187948728 X:24451551-24451573 CTGGGGTCCCTCATGCCCTGAGG + Intergenic
1192215092 X:69152619-69152641 CAGGCATCAAACAGGCCCTGAGG + Intergenic
1192705542 X:73526075-73526097 CAGGGATCCTACAGGTCCCGGGG + Intergenic
1198271827 X:135062562-135062584 CAGAGGACTGACAGGGCCTGAGG + Intergenic
1199878888 X:151957057-151957079 CAGGGCTCATGCAGGCCCTGTGG + Intronic
1199979844 X:152914931-152914953 CAGAGCTCCGCCAGGCCATGTGG + Intronic
1200104538 X:153705085-153705107 CAAGGGTCACACAGGGCCTGGGG + Intronic
1200144391 X:153919021-153919043 CAGGGTTCCACCTGGCCCTGGGG - Exonic