ID: 1102026036

View in Genome Browser
Species Human (GRCh38)
Location 12:109714704-109714726
Sequence GCCTGCGCCGTCCGAAGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102026036_1102026046 21 Left 1102026036 12:109714704-109714726 CCCCGACTTCGGACGGCGCAGGC 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1102026046 12:109714748-109714770 CGACAGCGCCCCTTCCCACCCGG 0: 1
1: 0
2: 1
3: 7
4: 148
1102026036_1102026047 28 Left 1102026036 12:109714704-109714726 CCCCGACTTCGGACGGCGCAGGC 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1102026047 12:109714755-109714777 GCCCCTTCCCACCCGGAGAGAGG 0: 1
1: 0
2: 1
3: 18
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102026036 Original CRISPR GCCTGCGCCGTCCGAAGTCG GGG (reversed) Exonic
907210300 1:52815383-52815405 GCCTTGGCCTTCCGAAGTGGTGG - Intronic
909897212 1:81087126-81087148 GCCTCCGCCGCCCAAAGTCCTGG - Intergenic
917383468 1:174440805-174440827 GCCTGGGCCTTCCAAAGTCCTGG + Intronic
918488614 1:185055668-185055690 GCCTTGGCCTTCCGAAGTCTGGG + Intronic
922518260 1:226223897-226223919 GCCTGCGCCCCCCAAAGGCGCGG + Exonic
923389108 1:233496220-233496242 GCCTCCGCCTTCCGAAGTGCTGG + Intergenic
923591945 1:235327649-235327671 CCCTGCGGCGCCCGAATTCGGGG - Intronic
1066479973 10:35786248-35786270 GCTTGCGCCTTCTGAAGCCGTGG + Intergenic
1070426939 10:76297969-76297991 GCATGTGCCGACTGAAGTCGAGG + Intronic
1072105988 10:92274589-92274611 GCCTGGGCCTCCCGAAGTCCTGG - Intronic
1084011062 11:66348588-66348610 GCCCTCCCCGTCCGAAGTAGTGG + Intronic
1088500385 11:110477093-110477115 GCCTGCACTGTCCTAAGACGTGG - Intergenic
1102026036 12:109714704-109714726 GCCTGCGCCGTCCGAAGTCGGGG - Exonic
1123721614 15:23066070-23066092 CCCTCGGCCGTCCGAAGTCCTGG - Intergenic
1126100958 15:45117933-45117955 GCCTGCGATGTCCCAAGGCGGGG - Exonic
1127185846 15:56479977-56479999 GCCTGGGCCTTCCGAAGTGCTGG + Intergenic
1141912331 16:87068499-87068521 GCCCCAGCCGTCCGAGGTCGGGG + Intergenic
1145912885 17:28552598-28552620 GCCTGCGCCGGCTGGAGCCGGGG + Exonic
1155053103 18:22165149-22165171 GTCTGCGGCCGCCGAAGTCGGGG + Intergenic
1155206599 18:23563661-23563683 GCCTTGGCCGTCCGAAGTGCTGG + Intronic
1165268087 19:34678185-34678207 GCCTCCGCCTTCCGAAGTGCTGG + Intronic
1166410024 19:42550520-42550542 GCGTGCGCCCTCTGAAGTCATGG - Intronic
1167625879 19:50588851-50588873 GCCTCGGCCTTCCGAAGTGGTGG - Intergenic
936271243 2:111050789-111050811 GGCTGCGGCATCCCAAGTCGGGG - Intronic
940265196 2:151828600-151828622 TCCTGCGCCTTCCGCAGTCTTGG - Intergenic
941669635 2:168278470-168278492 GCCTGGGCCTTCCGAAGTGCTGG + Intergenic
947699930 2:232224587-232224609 GCCTGCACCTTCCAAAGTGGTGG - Intronic
1170573286 20:17644669-17644691 TCCTGCGCCGTCCGATGTGCTGG + Intronic
1179911990 21:44455497-44455519 GCCCGCGCAGGCCGGAGTCGCGG + Exonic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
954404789 3:50339616-50339638 GCCTCCGCCTTCCGAAGTGCTGG + Intronic
954617167 3:51975047-51975069 GCCTGCGCACTCCGCAGCCGCGG - Exonic
956691961 3:71886926-71886948 GCCTGAGCCTCCCGAAGTCCTGG - Intergenic
972521357 4:39860212-39860234 GCCTGGGCCTTCCGAAGTGCTGG - Intronic
991693325 5:69246382-69246404 GCCTCCGCCTTCCAAAGTCCTGG + Intronic
995775849 5:115724286-115724308 GCCTCCGCCTTCCAAAGTGGTGG + Intergenic
1002487514 5:179549816-179549838 GCCTGGGCCTTCCGAAGTGCTGG + Intergenic
1002511444 5:179721337-179721359 GCCTTCGCCTTTCGAAGTCCTGG + Intronic
1004425530 6:15504571-15504593 GCCTGCCCCAGCCGAAATCGAGG + Exonic
1017683965 6:156893273-156893295 GCCTCGGCCGTCCGAAGTGCTGG + Intronic
1026739978 7:72973030-72973052 GCCTCCGCCTTCCGAAGTGCTGG - Intergenic
1026797243 7:73374183-73374205 GCCTCCGCCTTCCGAAGTGCTGG - Intergenic
1026805027 7:73424102-73424124 GCCTGCGCCGTCTGAGGCCCAGG + Intergenic
1027103755 7:75392040-75392062 GCCTCCGCCTTCCGAAGTGCTGG + Intergenic
1029047463 7:97645301-97645323 GCTTGCACCGTCTGAAGTCATGG - Intergenic
1035615691 8:999726-999748 GCCTGGGCCTTCCGAAGTGCTGG + Intergenic
1036565444 8:9934196-9934218 GCCTCCGCCTTCCAAAGTAGAGG - Intergenic
1045367944 8:101493650-101493672 GCCTGCCGCGTCCGAGGTGGCGG - Intronic
1049838621 8:144755671-144755693 GCCTGCGCCGTCTATGGTCGGGG + Intronic
1055611965 9:78032217-78032239 GCCGCCCCCGGCCGAAGTCGGGG + Intergenic
1062468436 9:136691738-136691760 GCCTGGGCCGTCCCAAGCCTCGG - Intergenic
1185628091 X:1496613-1496635 GACTGCTCCGTCTGAAGCCGCGG - Intronic