ID: 1102026324

View in Genome Browser
Species Human (GRCh38)
Location 12:109715843-109715865
Sequence CAGGGTCCCCAGAGAGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 281}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102026308_1102026324 22 Left 1102026308 12:109715798-109715820 CCTCCCTGAACCCCACCATGTAC 0: 1
1: 0
2: 0
3: 15
4: 257
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026312_1102026324 12 Left 1102026312 12:109715808-109715830 CCCCACCATGTACCCAGCTGGCA 0: 1
1: 0
2: 4
3: 15
4: 166
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026316_1102026324 7 Left 1102026316 12:109715813-109715835 CCATGTACCCAGCTGGCAGGCTG 0: 1
1: 0
2: 3
3: 22
4: 261
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026310_1102026324 18 Left 1102026310 12:109715802-109715824 CCTGAACCCCACCATGTACCCAG 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026318_1102026324 -1 Left 1102026318 12:109715821-109715843 CCAGCTGGCAGGCTGAAGTTCCC 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026314_1102026324 10 Left 1102026314 12:109715810-109715832 CCACCATGTACCCAGCTGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026309_1102026324 19 Left 1102026309 12:109715801-109715823 CCCTGAACCCCACCATGTACCCA 0: 1
1: 0
2: 2
3: 23
4: 282
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026313_1102026324 11 Left 1102026313 12:109715809-109715831 CCCACCATGTACCCAGCTGGCAG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1102026317_1102026324 0 Left 1102026317 12:109715820-109715842 CCCAGCTGGCAGGCTGAAGTTCC 0: 1
1: 0
2: 0
3: 13
4: 226
Right 1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG 0: 1
1: 0
2: 1
3: 30
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102026324 Original CRISPR CAGGGTCCCCAGAGAGATGT GGG Intronic
900095609 1:938932-938954 AAGGGCCCCCTGAGAGATGGTGG + Intronic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900162819 1:1232386-1232408 CGGGGACCCCAGGGCGATGTCGG + Exonic
900345567 1:2208740-2208762 CAGGGGCCCCAGAGGGGTTTGGG + Intronic
900351017 1:2234598-2234620 CAGGGCCTCCAGAGAGAAGGCGG + Intronic
900546093 1:3230065-3230087 CAGGGATCCCAGAGAGCTGCAGG - Intronic
901790826 1:11653126-11653148 CTAGCTCCCCAGAGAGCTGTGGG - Intronic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902468055 1:16630343-16630365 CCGGGACCCCAGGGAGATGAGGG - Intergenic
902934920 1:19758198-19758220 CAGGGTCCCCAGAGTGAAACAGG + Intronic
903986786 1:27234641-27234663 CTGGGTCCCCAGACAGCTGGAGG + Exonic
904615455 1:31747029-31747051 CACGTTCAGCAGAGAGATGTGGG - Intronic
905481668 1:38266084-38266106 GAGAGTCCCTAGAGAGGTGTTGG - Intergenic
905733265 1:40310748-40310770 TAGGGTCCCAAGGGAGATGTGGG - Exonic
905873233 1:41416675-41416697 CGGGGGCACGAGAGAGATGTGGG - Intergenic
906073908 1:43037795-43037817 CAGGACCCCCTGAGAGATGGAGG - Intergenic
906775605 1:48526895-48526917 CAGGGTCCATGGAGAGATGAAGG - Intergenic
910163733 1:84300550-84300572 CAGGTTCCCCAGAAAGATCCTGG - Intronic
910210062 1:84783354-84783376 CAAGGTCCCCTGGGAGAGGTGGG - Intergenic
915245945 1:154556536-154556558 CAGGTTCCCAAGGGAGAGGTGGG - Intronic
915324793 1:155075842-155075864 CAGTGTCCCGGGAGAGATCTTGG + Intergenic
916202708 1:162287236-162287258 AAAGGTCCCCAGACAGGTGTGGG - Intronic
917978633 1:180255918-180255940 CGGGGTCCCCAGTGGGATCTGGG + Intronic
919552398 1:199007531-199007553 CAGGCTCCCAAGAGTGAGGTTGG - Intergenic
919730330 1:200909406-200909428 CAGCTTCCCCAGAGAGATGGGGG + Intronic
920097454 1:203495903-203495925 CAGGCTCTCCAGAGTGTTGTGGG - Intronic
923276532 1:232401524-232401546 CAGGGTCCAGACAGAGATGTTGG - Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
1064306771 10:14174331-14174353 CAGGGTACACAGAGAGCTGTAGG - Intronic
1065695250 10:28373692-28373714 CAGGGGACCCAGGGAGAGGTAGG - Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1066745315 10:38601423-38601445 CAGGGATCCCACAGACATGTAGG - Intergenic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1071511918 10:86267458-86267480 CTGGGTTGCCAGGGAGATGTAGG - Intronic
1072449716 10:95530275-95530297 CAGGGTCCTCTGGGAGAGGTAGG - Intronic
1072690804 10:97571233-97571255 CAGGGGCCCCACAGAGCTGCAGG - Intergenic
1074305990 10:112278905-112278927 CAGGGTCAGCTGAGAGATGGGGG + Intergenic
1075943517 10:126411313-126411335 CTGGGTCCACAGAGAGCTCTGGG - Intergenic
1076132016 10:128019783-128019805 CAGGGTCCTGCGAGAGGTGTTGG + Intronic
1076193364 10:128498345-128498367 CCCAGTCCCCAGAGACATGTGGG - Intergenic
1076789852 10:132771171-132771193 CACGCTCCCCTGAGAGATGAGGG + Intronic
1076880730 10:133238027-133238049 GAGGCTCCCCAGGGAGAAGTCGG - Exonic
1080962166 11:37173156-37173178 CAGGGACCCCAGAGAAACCTTGG - Intergenic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083170741 11:60922730-60922752 CAGGGTCCCCTGAGGCCTGTGGG + Exonic
1083297832 11:61724761-61724783 CAGGGTTCCCAGAGCACTGTGGG - Intronic
1083598581 11:63932248-63932270 CAGGGGCCTCGGAGAGATGAGGG + Intergenic
1083894638 11:65613882-65613904 CTGGCTCCCCAGAGAGGCGTGGG - Exonic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084842530 11:71867476-71867498 CAGGGTCCACAGGCAGATGGCGG - Intronic
1085641459 11:78195625-78195647 CAGGGTCACCAGGGAGGTCTGGG + Intronic
1085779875 11:79398385-79398407 CAGGGTCCTGAGAGAGAGCTGGG + Intronic
1086238457 11:84660361-84660383 CAGGGTACCCAGTGAAATATCGG - Intronic
1086961236 11:92981744-92981766 CAGGGACCCCACAAAGAAGTTGG - Exonic
1088977679 11:114830313-114830335 CAGGGTGTCAAGAGAGCTGTGGG + Intergenic
1089775924 11:120835732-120835754 GAGGGTCCCCAGAGAGAACGGGG + Intronic
1090401981 11:126454757-126454779 CAGGCTCCCCAGAATCATGTGGG - Intronic
1091537802 12:1429689-1429711 CCAGGTCTCCAGAGAGATTTAGG + Intronic
1095162417 12:38933687-38933709 CGTGGTCCCCAGGCAGATGTTGG + Intergenic
1096797143 12:54085061-54085083 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1097218914 12:57435354-57435376 GAGTGACCCCAGAGGGATGTGGG - Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102356504 12:112241294-112241316 CAGGGTGCCCAGAAAGAAATAGG - Intronic
1104815553 12:131643684-131643706 CAGGGTCCTCATGGAGTTGTGGG - Intergenic
1104975979 12:132552169-132552191 CACGGTCCCCAGAGAGCTGGAGG + Intronic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1108682876 13:52794364-52794386 CAGGGTCCCAACAGAAATGATGG - Intergenic
1110531406 13:76602867-76602889 CTGTGTCCCCTGACAGATGTGGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112656066 13:101453731-101453753 CTTGGACCCCAGAGAGATGTGGG + Intronic
1113109556 13:106807744-106807766 CAGGGTCCCCAGTCAGAACTGGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1115682017 14:35751189-35751211 CAAGGTTCCAAGAGATATGTTGG + Intronic
1118292885 14:64541778-64541800 CAGGGTCCCGCGAAAGAGGTCGG - Exonic
1119517363 14:75258835-75258857 CAGGCAGCGCAGAGAGATGTTGG + Intronic
1119757807 14:77131074-77131096 CAGGGTCCCCAGGGAGGAGCAGG + Intronic
1120954674 14:90071495-90071517 CAGGGAGCACAGAGAGATGTGGG - Intronic
1121629183 14:95410177-95410199 CAGGGTCCCCTGAGAGGAGGTGG + Intronic
1121854253 14:97252048-97252070 AAGGGACCACAGAGAGAGGTGGG + Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1125932181 15:43608188-43608210 CAGGGTGCCCAGAGCCCTGTGGG + Exonic
1125945279 15:43707662-43707684 CAGGGTGCCCAGAGCCCTGTGGG + Intergenic
1128856848 15:71025061-71025083 CAGGTTCCCCAGTCAGCTGTAGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1132457869 16:34022-34044 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1133023099 16:2975459-2975481 CCGGGGCCCCAGGAAGATGTTGG + Exonic
1133277294 16:4646702-4646724 CAGTCTGCCCAGAGACATGTCGG + Intronic
1135323886 16:21513798-21513820 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1136010949 16:27363193-27363215 CTGTGTCCCCAGAGAAATGTGGG + Exonic
1136335371 16:29607066-29607088 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1136737754 16:32478226-32478248 CAGGGAACCCACAGACATGTAGG + Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139446263 16:67000567-67000589 CAGGGTCCGCAGTGAGAAGACGG - Intronic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1141613621 16:85197861-85197883 CAGGGTCCCCACGGGGCTGTTGG + Intergenic
1203015319 16_KI270728v1_random:351351-351373 CAGGGAACCCACAGACATGTAGG - Intergenic
1203033654 16_KI270728v1_random:624509-624531 CAGGGAACCCACAGACATGTAGG - Intergenic
1143266806 17:5644133-5644155 CAGGGTCCTCAGAGAGGGCTGGG + Intergenic
1143328758 17:6119042-6119064 AAGAGTCACCAGAGAGCTGTTGG - Intronic
1144372485 17:14605427-14605449 CTGAGTCCCCAAAGAGAAGTGGG - Intergenic
1144967732 17:19088812-19088834 CAGGGTCCCGAGTGTGAGGTGGG + Intergenic
1144969302 17:19097561-19097583 AAGCGTCCCCAGAGAGATCCCGG + Intergenic
1144978614 17:19154504-19154526 AAGCGTCCCCAGAGAGATCCCGG - Intronic
1144980184 17:19163251-19163273 CAGGGTCCCGAGTGTGAGGTGGG - Intergenic
1144988038 17:19214981-19215003 CAGGGTCCCGAGTGTGAGGTGGG + Intergenic
1144989608 17:19223728-19223750 AAGCGTCCCCAGAGAGATCCCGG + Intronic
1146814529 17:35931854-35931876 AAGGGTCCCCGGAGAGATCCCGG + Intergenic
1146814990 17:35935580-35935602 AAAGGTCCCCAGAGAGATCCCGG + Intronic
1147132119 17:38415662-38415684 CAGGGCCCCGAGAGAGAAGTGGG - Intergenic
1147235660 17:39055620-39055642 AAGGGTCCCCAGAGAGCTCCCGG - Intergenic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1149446252 17:56715594-56715616 CAGGGTCCTGTGAGGGATGTGGG - Intergenic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1152322371 17:79614911-79614933 TAGGGCCCCCAGAGAGAAGGAGG + Intergenic
1152424453 17:80211352-80211374 GTGGGCCCCAAGAGAGATGTGGG + Intronic
1152961868 18:84725-84747 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1153535551 18:6098153-6098175 CAGGGCTCTCAGAGAGAAGTGGG - Intronic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154971195 18:21411492-21411514 CACGGTGCCCAGCCAGATGTTGG + Intronic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1158963546 18:62605335-62605357 CAGGGATGCCAGTGAGATGTGGG - Intergenic
1159982876 18:74807368-74807390 CAGGGTCCCGAGAGTCATGGAGG + Intronic
1160145075 18:76357042-76357064 CAGGTGACACAGAGAGATGTAGG + Intergenic
1160155763 18:76432729-76432751 CAGGCTTCCTAGAGAGAGGTTGG - Intronic
1160204989 18:76824137-76824159 CAGGTGCCCCAGAGAAAGGTCGG + Intronic
1162139191 19:8575691-8575713 CAGCATCCCCAGACAGAGGTGGG + Intronic
1162327689 19:10008500-10008522 CAGGGCCCCCACGGGGATGTTGG + Intronic
1162386920 19:10365388-10365410 CAGGTGCCCCAGAGCCATGTGGG + Intronic
1163626435 19:18392593-18392615 CAGCCTCCTCAGAGAGAGGTGGG - Intronic
1163817322 19:19474867-19474889 CTGGGTCCCCAGAGAGGTTGAGG + Intronic
1165429996 19:35767094-35767116 CTGGGTCCCCAGAGAACTGAGGG - Intronic
1166558933 19:43719304-43719326 CAAGGCCTCCAGCGAGATGTCGG - Exonic
1167108857 19:47447302-47447324 AAGAGTACCCAGGGAGATGTGGG - Intronic
1167774070 19:51543325-51543347 CAGGGACCAAGGAGAGATGTGGG - Intergenic
1167792517 19:51690588-51690610 CAGGGTCCGCAGAGAGGGGGAGG + Intergenic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
1168726608 19:58586338-58586360 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
924967803 2:94029-94051 AAGGGCAGCCAGAGAGATGTAGG + Intergenic
925723187 2:6847605-6847627 AAGGGTCCCCAGAGAGCCCTCGG - Intronic
926098569 2:10098590-10098612 CAGGGTCCCCAGAAGGCCGTGGG - Intergenic
926198359 2:10776857-10776879 CAGGGCCCCCAGGGTGGTGTGGG - Intronic
926222417 2:10944877-10944899 CTGGGTCCCCAGATCCATGTGGG - Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926606709 2:14905494-14905516 CAGGGGCACCAGAGAGAGTTGGG - Intergenic
927300508 2:21506794-21506816 CATAGTCCCAAGAGAGATGCAGG - Intergenic
927506908 2:23620743-23620765 CAGGGTCCCCATCCAGAGGTGGG + Intronic
927954949 2:27201559-27201581 CAGAGGCCCCAGGGAAATGTTGG - Intronic
929999383 2:46850644-46850666 CAGGGTCCCCAGAAAAGTGAGGG + Intronic
931324828 2:61209551-61209573 CAGCGTCATCAGAGACATGTGGG - Intronic
932575238 2:72959097-72959119 CAGGGCCCCAAGAGAGGTGGAGG - Intronic
933747160 2:85579665-85579687 CAGGGTCCCCTGCTAGATGAAGG + Intronic
935095006 2:99935864-99935886 CAGAGTCCCCAGCGACATGGAGG + Intronic
935211851 2:100945436-100945458 CAGGGTCCCAAGAGAGACAGGGG - Intronic
937087152 2:119179030-119179052 CTGAGGCTCCAGAGAGATGTTGG + Intergenic
937157229 2:119729897-119729919 AAGGGACCCAACAGAGATGTGGG - Intergenic
938017626 2:127880610-127880632 CAGCGTCCCCACAGAGAGGGAGG - Intronic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
948281457 2:236750489-236750511 CAGTGAGCACAGAGAGATGTAGG + Intergenic
948290606 2:236821447-236821469 CAGGGTCCAAAGAGAGATTGTGG + Intergenic
948687532 2:239678264-239678286 CAGGGTCTCCAGGAAGGTGTCGG - Intergenic
1168986771 20:2055930-2055952 CAGGGAGCCCAGGGAGCTGTGGG - Intergenic
1170521643 20:17192076-17192098 CAGTGACCCCTGAGAGATGAGGG + Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1171848995 20:30294918-30294940 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1173380154 20:42532752-42532774 CAGGGTCGTGGGAGAGATGTTGG - Intronic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1174714036 20:52737772-52737794 CAGGGGCTCCAGAGAGGTATGGG - Intergenic
1175528861 20:59660122-59660144 CAAGAACCCCAGAGATATGTGGG - Intronic
1175916760 20:62429595-62429617 CTGGGTCCCCAGGGAGAAGGTGG + Intergenic
1175948330 20:62569070-62569092 CAGGGTCCCGAGTGTGATGGCGG - Intronic
1176002579 20:62839674-62839696 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002597 20:62839722-62839744 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002615 20:62839770-62839792 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176130692 20:63495607-63495629 CAGAGTCCCCAGATAGATGGGGG - Intronic
1178438815 21:32582129-32582151 TAGCGTCCCCATAAAGATGTGGG - Intronic
1179594250 21:42431334-42431356 CAGGCTCCCCAGAAAGAGGGCGG + Intronic
1179672917 21:42962404-42962426 CAGGGTCCCCAGTGAGAACCTGG + Intergenic
1179979856 21:44890248-44890270 CAGGCTCCCCCCAGTGATGTGGG + Intronic
1180215206 21:46319113-46319135 CAGGGTCCCTACATGGATGTGGG - Intronic
1180534797 22:16387696-16387718 CAGGGAACCCACAGACATGTAGG - Intergenic
1180611663 22:17102154-17102176 CAGGGTCTCCACGGTGATGTTGG - Exonic
1180824465 22:18853157-18853179 CAGGCTCCCCAGTGAGCTGCGGG + Intronic
1181188269 22:21121391-21121413 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1181210929 22:21289102-21289124 CAGGCTCCCCAGTGAGCTGCGGG + Intergenic
1181228022 22:21403528-21403550 AAGGCTCCCCAGAGAAAAGTAGG + Intergenic
1181398576 22:22637786-22637808 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1181650840 22:24258274-24258296 CAGGCTCCCCAGTGAGCTGTAGG + Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1181706541 22:24652465-24652487 CAGGCTCCCCAGTGAGCTGTGGG - Intergenic
1182057674 22:27372650-27372672 CAGGGTCCTCAGAGTGAAGGTGG + Intergenic
1182260333 22:29069495-29069517 CTGGGCCTCCAGAAAGATGTTGG - Intergenic
1184128447 22:42503123-42503145 CAGGGTCCCCAGGGAAAGGCGGG + Intergenic
1184137239 22:42556438-42556460 CAGGGTCCCCAGGGAAAGGCGGG + Intronic
1184418493 22:44365599-44365621 CAGAATCCCAAGAAAGATGTGGG + Exonic
1184501724 22:44878733-44878755 CAGGGTCCCCTGGGTGCTGTGGG + Intergenic
1184654968 22:45936493-45936515 CAGAGTCCTCAGAGACATGTGGG + Intronic
1184857120 22:47152386-47152408 CAGGGTCCCCAGGCCGAAGTGGG + Intronic
1185031593 22:48446335-48446357 CAGCGGCCCCAGAGAGCTGGTGG + Intergenic
1185295565 22:50052047-50052069 CGGGGTTCCCAGAGAGGTGCTGG - Intronic
1203216018 22_KI270731v1_random:6328-6350 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1203274604 22_KI270734v1_random:79062-79084 CAGGCTCCCCAGTGAGCTGCGGG + Intergenic
949506925 3:4737337-4737359 CAGGCTCCCCAGAGAGATGCTGG - Intronic
950410624 3:12834082-12834104 CAGGGCCCCCAGTGAGATGGTGG - Exonic
953856150 3:46500491-46500513 CAGGGTCCTCAAACAGAGGTTGG - Exonic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954611767 3:51948116-51948138 CAAGTTTCCCAGAGAGAAGTCGG + Intronic
954704187 3:52470270-52470292 CAGGGTCCCAAGAAAGAAGCGGG - Intronic
958737911 3:98031221-98031243 CAGAGACCCAAGTGAGATGTGGG - Intronic
959439283 3:106357280-106357302 CAGGGACACCAGTGAGTTGTAGG + Intergenic
959965323 3:112347479-112347501 CAGTCTCCTCAGAGAGATGAAGG - Intronic
960484365 3:118233480-118233502 CAGGGTACCAAGAGAGATTTAGG - Intergenic
961816619 3:129554060-129554082 CACGGTTCCCAGAGAAATGTAGG - Intergenic
963993375 3:151679247-151679269 AAGGGTCCCTAGACACATGTGGG + Intergenic
966923264 3:184628417-184628439 CAGGGGCCACAGAGAGCTGATGG + Intronic
968506050 4:971997-972019 CAGGGTCCACCGAGAGAAGGGGG + Intronic
969783631 4:9433533-9433555 CAGGGTCCACAGGCAGATGGCGG - Intergenic
969883893 4:10198251-10198273 AAGGGTCCCCAGAGAGCCCTCGG - Intergenic
970580671 4:17471524-17471546 CAATGTCTCCAGAGAGCTGTTGG + Intronic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
984273306 4:177574775-177574797 CTGGGTCCCCAGATAAACGTGGG - Intergenic
986273460 5:6253768-6253790 CAGGGTCCCCAGGGAGGGATGGG - Intergenic
988866624 5:35342290-35342312 CTGGATTTCCAGAGAGATGTTGG + Intergenic
991032942 5:62101427-62101449 CAGGGTCCTGAGAGAGAAGTGGG + Intergenic
991074659 5:62521412-62521434 CAGGGTCCCCAGAGCAATTTTGG - Intronic
994240507 5:97414637-97414659 CAGGGTCTCCAGAGTCATGTGGG - Intergenic
998769258 5:145523577-145523599 TAGGGGCCACAGAGAGATGGTGG - Intronic
1000253842 5:159519609-159519631 CAGGCCCCACAGAGAGGTGTGGG - Intergenic
1000304879 5:159986039-159986061 CAGGGCCCCCAGAAATATCTAGG + Intergenic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001763383 5:174225475-174225497 CAGGGTCTCCAGGCAGAAGTGGG + Intronic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002467685 5:179415996-179416018 CAGGGTCTGCAAAGAGAGGTGGG + Intergenic
1002770077 6:282880-282902 CATGATGCTCAGAGAGATGTGGG + Intergenic
1004829867 6:19465165-19465187 CAGGATGCCCATTGAGATGTAGG + Intergenic
1006068281 6:31478131-31478153 CAGGGTCCACAGAGATATAAGGG + Intergenic
1006558608 6:34889658-34889680 TTGGGTCCCCAGAGAGATCGGGG + Intronic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1010010312 6:71041046-71041068 AAGGGTCCCCAGAGACAGGACGG - Intergenic
1013422110 6:109976776-109976798 AAGGGTCCACAGGGAGAAGTAGG + Intergenic
1013624791 6:111926418-111926440 CAGGTTCCCCATTGAGTTGTTGG - Intergenic
1014841307 6:126223782-126223804 CAGGGACTCCAAAGAGTTGTAGG + Intergenic
1015167628 6:130215879-130215901 CAGATTCTCCAGAGAAATGTGGG - Exonic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1015561747 6:134523508-134523530 CAGAGGCCCGAGTGAGATGTTGG + Intergenic
1019466769 7:1193965-1193987 CAGGGTGTCCTGAGAGAGGTAGG - Intergenic
1021611727 7:22464400-22464422 AAGAGTCCCCAGCCAGATGTAGG - Intronic
1024955067 7:54910131-54910153 CAGTGTCCTCAGCAAGATGTTGG + Intergenic
1026828235 7:73596853-73596875 CAGGGTCCCCGGTAAGATCTCGG - Exonic
1027771550 7:82413441-82413463 GGGGCTCCCCAGGGAGATGTGGG - Intronic
1028860307 7:95641648-95641670 CTGGCTCCACAGAGAGATGCTGG - Intergenic
1029403234 7:100358171-100358193 GAGGCTCCCCAGAGGGCTGTGGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029947600 7:104549716-104549738 CAAGGTCCCCAGATAGATATAGG - Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1034413874 7:150955090-150955112 ATGGGTGCCCAGAGAGATGGTGG - Intronic
1034688673 7:152996587-152996609 AAGGTGCCCCAGAGACATGTGGG + Intergenic
1035239386 7:157520048-157520070 CCTGGTCCCCAGGGAGATGACGG + Intergenic
1035788070 8:2278233-2278255 CAGGGTCCCCAGCGGGACATGGG + Intergenic
1035804737 8:2443480-2443502 CAGGGTCCCCAGCGGGACATGGG - Intergenic
1036656213 8:10679054-10679076 CCGGGTCCCCAGAAACATGTAGG - Intronic
1036835405 8:12060546-12060568 CAGGGTCCACAGGCAGATGGCGG + Intergenic
1036857247 8:12307109-12307131 CAGGGTCCACAGGCAGATGGCGG + Intergenic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1042302419 8:67299231-67299253 CAGGGCCCTCAGACAGATGAAGG - Exonic
1042874565 8:73429094-73429116 CAGGGTTATCAGTGAGATGTGGG - Intronic
1043280965 8:78465767-78465789 TGGGGACCCCAGAGAGATGCAGG - Intergenic
1044572522 8:93735265-93735287 CAGGGTCACTAGAGAGAGATAGG - Exonic
1048225089 8:132577481-132577503 CCTGGTTCCCAGGGAGATGTTGG - Intronic
1049265735 8:141666979-141667001 AGGGGTCCCCAGAGAGATCGGGG + Intergenic
1049303185 8:141882622-141882644 CAGGTCCCCCAGGGAGATGGAGG - Intergenic
1049796167 8:144498192-144498214 CATGGTCCACAGGGAGCTGTGGG + Intronic
1050293494 9:4180928-4180950 CAGGATGCCCAGGGAGATGGTGG - Intronic
1052788221 9:32849847-32849869 CTGGGTCCCAAGATAGATGGAGG + Intergenic
1054450400 9:65400859-65400881 AGGGGTCCCCAGAGAGTTGAGGG - Intergenic
1056895580 9:90545359-90545381 CAGGGAACCCGGAGAAATGTAGG + Intergenic
1057488183 9:95502358-95502380 AAAGCTCTCCAGAGAGATGTTGG - Intronic
1057718780 9:97516285-97516307 CTGGGAACACAGAGAGATGTGGG + Intronic
1058051239 9:100409063-100409085 CAGGGAGGCCAGGGAGATGTTGG + Intergenic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1059959877 9:119554733-119554755 CAGGCTCCTCAGAGAGATAATGG - Intergenic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1062736275 9:138139379-138139401 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
1185520415 X:734481-734503 CAGGGTCCCCAGAGAGAGTGGGG + Intergenic
1185621205 X:1452483-1452505 CTGGGTCCCCATAGGGATGGGGG - Intronic
1187226268 X:17377005-17377027 CAGGGGCCCCGGGGAGATGGAGG + Intronic
1187415553 X:19090224-19090246 CAGTGTCCCCAGAAACATCTTGG - Intronic
1193552592 X:82915230-82915252 AGGGGTGCCCAGAGAGATGGAGG - Intergenic
1195494163 X:105510391-105510413 CAGTGTGCTCAGTGAGATGTTGG - Intronic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1197572615 X:128167589-128167611 TAGAGTCCCCAGAGACAAGTTGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1199975562 X:152893230-152893252 CTGGGGCCCCAGAGAGGTCTGGG + Intergenic
1200110929 X:153740576-153740598 CAGGGAGCCCACAGACATGTAGG - Exonic
1200398509 X:156005461-156005483 CAGGCTCCCCAGAGACAAGGTGG + Exonic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic