ID: 1102027018

View in Genome Browser
Species Human (GRCh38)
Location 12:109719453-109719475
Sequence CCCTGTCGCCCGTGTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102027013_1102027018 21 Left 1102027013 12:109719409-109719431 CCATTCGGTAAAACCAGGCTTTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104
1102027015_1102027018 8 Left 1102027015 12:109719422-109719444 CCAGGCTTTAGGTAAAGACTGAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102027018 Original CRISPR CCCTGTCGCCCGTGTCCCAG TGG Intronic