ID: 1102027018

View in Genome Browser
Species Human (GRCh38)
Location 12:109719453-109719475
Sequence CCCTGTCGCCCGTGTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102027013_1102027018 21 Left 1102027013 12:109719409-109719431 CCATTCGGTAAAACCAGGCTTTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104
1102027015_1102027018 8 Left 1102027015 12:109719422-109719444 CCAGGCTTTAGGTAAAGACTGAG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102027018 Original CRISPR CCCTGTCGCCCGTGTCCCAG TGG Intronic
902892178 1:19452334-19452356 CCCTGGAGCCTATGTCCCAGTGG - Intronic
903349645 1:22710346-22710368 CCCTGCCACCCGGGTCCCTGCGG - Intergenic
905229816 1:36508048-36508070 CCCTATTGCCAGTGCCCCAGCGG + Intergenic
912369737 1:109164726-109164748 CCCTGTAGCCCCTTACCCAGTGG - Intronic
912955664 1:114153015-114153037 CCCTGTCCCCCGCCCCCCAGCGG + Intronic
914901409 1:151713141-151713163 CACTTTAGCCCTTGTCCCAGGGG - Intronic
924706481 1:246506900-246506922 CCCTGACGCGCGTGTGCCCGGGG - Intronic
1063458970 10:6203506-6203528 CGCTGTGGCCCTTGTCCCGGTGG + Intronic
1067469780 10:46528025-46528047 CCCTATCGCCCATCACCCAGTGG - Intergenic
1067730655 10:48808852-48808874 CCCTGTCCCCAGGGACCCAGAGG + Intronic
1074248162 10:111714648-111714670 CCCTGTACCCTGTGTCCCTGAGG - Intergenic
1076931306 10:133533657-133533679 CACTGTCTCCTGTGTCCCTGTGG + Intronic
1077068173 11:654099-654121 CTCTGTCCCCGGTGTCTCAGGGG - Intronic
1077855905 11:6124611-6124633 CCCTTTAGCCCTAGTCCCAGGGG - Intergenic
1083260239 11:61518645-61518667 CCCGGCAGCCCGTGGCCCAGTGG - Exonic
1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG + Intronic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1103856056 12:123972373-123972395 CCCCGTCCCCCGTCTCCCGGCGG + Intronic
1104928464 12:132325935-132325957 CACGGTCGCCCGCGTCGCAGCGG - Intronic
1104951805 12:132444479-132444501 CTCTGTCTCCCCTGTCCCAGGGG + Intergenic
1106130599 13:26936267-26936289 CCCAGTAGGCAGTGTCCCAGTGG - Intergenic
1111239694 13:85457874-85457896 CCCACTAGCCAGTGTCCCAGTGG - Intergenic
1119430723 14:74566741-74566763 CCCTCTCCCCCGTGTCCCCAAGG + Intronic
1122649878 14:103220539-103220561 CCCTGAGGCCTGGGTCCCAGGGG - Intergenic
1128519259 15:68364767-68364789 CCCTGTCCAACGTGTCCGAGCGG - Exonic
1132622500 16:874460-874482 CCCTGTCACCAGTGCCCTAGTGG + Intronic
1132882530 16:2168753-2168775 CCCTGTGGCCAGGGTCTCAGTGG + Intronic
1132934629 16:2474357-2474379 GGCTGTCGGCCCTGTCCCAGGGG + Intergenic
1138496100 16:57410307-57410329 ACCTGCCGCCCTTGCCCCAGGGG - Intronic
1140205537 16:72929616-72929638 CCCTGTGGCTCTTGCCCCAGAGG + Intronic
1141126252 16:81403178-81403200 CCCTGTCGCCCGGGCCGGAGTGG - Intergenic
1143790696 17:9293085-9293107 CCCTGGCTGCTGTGTCCCAGTGG - Intronic
1146086722 17:29837544-29837566 CCCTGTGGCCCATGTCCCCGAGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148149000 17:45385088-45385110 CTCTGTCCCCAGTATCCCAGGGG - Intergenic
1149412394 17:56421892-56421914 CCCCTTAGCTCGTGTCCCAGAGG - Intronic
1150294167 17:63998895-63998917 CCCTGACACCCCTGTCCCGGGGG - Intronic
1151399047 17:73843683-73843705 CCCTGAGGCCCGTGGCCCACAGG - Intergenic
1152262237 17:79273485-79273507 CCCTGTGCCCAGAGTCCCAGTGG + Intronic
1160864276 19:1250220-1250242 GCCTCTCGCCCCTGTCCCGGAGG + Exonic
1161046573 19:2138177-2138199 CCCTCTGGCCCGTTTCCCCGTGG - Intronic
1161202693 19:3024831-3024853 CCCTGCAGCCCCTGCCCCAGCGG + Intronic
1161342337 19:3750153-3750175 TCCTGTCGCCACTGTCCCTGGGG - Exonic
1161991331 19:7686010-7686032 CCCTCTCGCCAGGGTCTCAGAGG - Exonic
1166074346 19:40404991-40405013 CCCTGTCCCCCCAATCCCAGAGG - Intronic
1166523882 19:43499050-43499072 CCCTGTAACCCATCTCCCAGAGG - Intronic
1166980923 19:46631639-46631661 CCCTGTCCCCCGTCTCCCCCGGG + Intergenic
926196232 2:10765237-10765259 CCCTGTGACTCGAGTCCCAGGGG + Intronic
932336317 2:70933246-70933268 CCCAGTCTCCTGTGCCCCAGCGG + Exonic
941043407 2:160648234-160648256 CCCTGTACCCCGCGTCCCCGAGG + Intergenic
947461172 2:230306135-230306157 CCCTGTGCCCTGTGTCCCTGAGG + Intronic
948273148 2:236689007-236689029 CCCTGTCTCCTGAGTCCCTGCGG - Intergenic
948582272 2:238996531-238996553 CCCTGGCTCCCCTGTCCCTGGGG + Intergenic
1171459035 20:25288279-25288301 CACTGTCACCCGTGTCTCTGGGG + Intronic
1173137046 20:40447731-40447753 CCCTACTGCCAGTGTCCCAGGGG + Intergenic
1173800277 20:45890857-45890879 GCGTGTGGCCCGCGTCCCAGAGG + Exonic
1175869994 20:62204571-62204593 CCTCCTCGCCCGTGTCCAAGTGG - Intergenic
1175931832 20:62497205-62497227 CCCTGAGGCCCGGGTCCCTGGGG - Intergenic
1178467292 21:32859556-32859578 CCCTGTGCCCCATGTCCCTGAGG - Intergenic
1179490677 21:41739658-41739680 CACTGTCACCTGTGTCCCATAGG - Exonic
1180946443 22:19696286-19696308 CCCCTGCGCCCGTGTCTCAGAGG + Intergenic
1183147781 22:36010383-36010405 CTCTGTGGCCCGAGTCACAGAGG - Intronic
1183393149 22:37557134-37557156 CCCTTTCTCCCGTTTTCCAGAGG + Intergenic
1184188301 22:42878856-42878878 CTCTGTGGGCCGTGGCCCAGGGG - Intronic
1185270992 22:49929304-49929326 CCCCGTCCCCCGTGTCCCGCGGG - Intergenic
952316728 3:32238564-32238586 ACCTGTTGCCCGACTCCCAGCGG - Intergenic
952408348 3:33025789-33025811 CCCTGTGCCCCATGTCCCCGAGG + Intronic
953184415 3:40624918-40624940 CCCTATCCCCCATATCCCAGTGG - Intergenic
953766251 3:45746286-45746308 CCCTGTGCCCCGTGTCCCTGTGG + Intergenic
954121695 3:48503742-48503764 CCCTCCCGCCCATGTTCCAGGGG - Intronic
955239969 3:57169736-57169758 CCCTGACCCCAGTCTCCCAGAGG + Intronic
955407957 3:58637381-58637403 CCCTGTAGCCCTTGTCCTAGGGG + Intronic
964590988 3:158361454-158361476 CCCTGTGTCCCGTGTCCCCAAGG - Intronic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
968889999 4:3363799-3363821 CCCTGACCCCTGGGTCCCAGGGG - Intronic
969481733 4:7450002-7450024 CCCAGCCCCACGTGTCCCAGGGG - Intronic
970652508 4:18194080-18194102 CCCTCTTGCCCGTCTCACAGTGG - Intergenic
973635768 4:52861238-52861260 CCCTTTCAACCTTGTCCCAGAGG - Intergenic
976181781 4:82406074-82406096 CTCTGCCTCCCGGGTCCCAGCGG - Intergenic
980922776 4:139103397-139103419 CCCTGTTTCCCGAGGCCCAGAGG - Intronic
985048745 4:185969391-185969413 TCCTGTGGCCAGTGTCACAGAGG - Intergenic
985112032 4:186555639-186555661 CCCTGGGGACGGTGTCCCAGAGG + Intergenic
988093442 5:26570103-26570125 CCCTATGCCCCGTGTCCCTGAGG - Intergenic
989595180 5:43150064-43150086 CCCTGTCCCCCTAGTCCCACAGG + Intronic
1002985912 6:2190859-2190881 CCCTGTGCCCCGTGTCCCCAAGG + Intronic
1007480993 6:42149792-42149814 CCCTGTCTCCCGGATCTCAGTGG - Intergenic
1009017886 6:57924172-57924194 TCCTGTCACCCGTGCCCAAGTGG - Intergenic
1013188882 6:107785283-107785305 CCCTGTGTCCCTTGTCCTAGAGG + Intronic
1019191958 6:170256687-170256709 CCCCATCCCCCGGGTCCCAGGGG - Intergenic
1025852047 7:65251868-65251890 CCCTGTCACCCGTGTTCCCGTGG + Intergenic
1026866380 7:73826572-73826594 CCCTGTCCCCAGAGTTCCAGGGG - Intronic
1029309488 7:99649162-99649184 CCCTGTCCCAGGTGTGCCAGAGG + Intronic
1035546149 8:483706-483728 CCCTGGGGACCATGTCCCAGTGG + Intergenic
1037816727 8:22116477-22116499 CCCTGTCCCCCTGGTCCCTGAGG + Intronic
1042337248 8:67641021-67641043 CCCTGTACCCCATGTCCCTGAGG - Intronic
1042997896 8:74721169-74721191 CCCTGACACCTGTGTTCCAGTGG + Intronic
1049173817 8:141179163-141179185 CCCTCTCCCACGTGACCCAGAGG + Intronic
1049877284 8:145032954-145032976 CCCTGTCACCTTTCTCCCAGAGG + Intergenic
1055348138 9:75357792-75357814 CCCTGTCCCCTGTCCCCCAGAGG - Intergenic
1057336648 9:94160851-94160873 CCCTAAGGCCCGTGTCCCAGAGG - Intergenic
1060544815 9:124453603-124453625 CCAGGGCGCCCGGGTCCCAGCGG - Exonic
1060817903 9:126645024-126645046 CCCTGTCCCACCTGGCCCAGCGG + Intronic
1062116718 9:134813598-134813620 CCCTCTGGCCTGTGTCCCTGAGG + Intronic
1062332463 9:136050760-136050782 CCCTCTTGCCCGTCTGCCAGGGG - Intronic
1062570970 9:137185176-137185198 CCCTGTCGGCCGGGACCGAGGGG + Intronic
1185664514 X:1754786-1754808 CTCTGTGGCCGGTGTTCCAGTGG + Intergenic
1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG + Exonic
1190369292 X:49726457-49726479 CCCTGTGCCCCATGTCCCCGAGG + Intergenic
1191615904 X:63168932-63168954 CCCTGTCCCCCTTCTCTCAGGGG - Intergenic
1191620394 X:63209991-63210013 CCCTGTCCCCCTTCTCTCAGGGG + Intergenic
1193899713 X:87162294-87162316 GCCTGTCTCCAGAGTCCCAGGGG + Intergenic
1200085376 X:153601699-153601721 GCCTGTCCCCAGTGTCCCAAAGG + Intergenic