ID: 1102027257

View in Genome Browser
Species Human (GRCh38)
Location 12:109720516-109720538
Sequence ACGGAGATCTGCAGATGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102027257_1102027258 -6 Left 1102027257 12:109720516-109720538 CCTCGGCATCTGCAGATCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1102027258 12:109720533-109720555 CTCCGTCTCTTCATCTGTGATGG 0: 1
1: 0
2: 5
3: 40
4: 354
1102027257_1102027267 27 Left 1102027257 12:109720516-109720538 CCTCGGCATCTGCAGATCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1102027267 12:109720566-109720588 CACCTTAGAGGGCAGCTGTGAGG 0: 1
1: 2
2: 6
3: 54
4: 388
1102027257_1102027264 16 Left 1102027257 12:109720516-109720538 CCTCGGCATCTGCAGATCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1102027264 12:109720555-109720577 GGCCAAGGGACCACCTTAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1102027257_1102027262 2 Left 1102027257 12:109720516-109720538 CCTCGGCATCTGCAGATCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1102027262 12:109720541-109720563 CTTCATCTGTGATGGGCCAAGGG 0: 1
1: 0
2: 0
3: 13
4: 169
1102027257_1102027263 15 Left 1102027257 12:109720516-109720538 CCTCGGCATCTGCAGATCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1102027263 12:109720554-109720576 GGGCCAAGGGACCACCTTAGAGG 0: 1
1: 0
2: 1
3: 7
4: 99
1102027257_1102027259 -5 Left 1102027257 12:109720516-109720538 CCTCGGCATCTGCAGATCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1102027259 12:109720534-109720556 TCCGTCTCTTCATCTGTGATGGG 0: 1
1: 0
2: 4
3: 55
4: 407
1102027257_1102027261 1 Left 1102027257 12:109720516-109720538 CCTCGGCATCTGCAGATCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1102027261 12:109720540-109720562 TCTTCATCTGTGATGGGCCAAGG 0: 1
1: 0
2: 0
3: 28
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102027257 Original CRISPR ACGGAGATCTGCAGATGCCG AGG (reversed) Intronic
901350540 1:8591853-8591875 ACAGAAATCTGCACATGCTGAGG + Intronic
921521068 1:216154666-216154688 AAGGAGATCAGCAGTTGCCTAGG - Intronic
1065916843 10:30359962-30359984 ACGGAGAACGGAAGATGCCTGGG + Intronic
1065985566 10:30948033-30948055 ACTGAGATCTCCAGCTGCGGAGG - Intronic
1067570550 10:47368262-47368284 AGGGGAATCTGCAGATGCCCTGG - Exonic
1068439197 10:57030320-57030342 ATGGAGCTCTGCAGTTGCCTGGG + Intergenic
1073009676 10:100349354-100349376 AGGGAGCTCTGCAGATCCAGGGG + Intronic
1076575131 10:131460828-131460850 ACTGAGCTATGCAGATGCAGGGG - Intergenic
1082765907 11:57167515-57167537 ACGGAGAGCTGCAGTGTCCGAGG - Intergenic
1083983755 11:66195847-66195869 AAGGAGATCTGCAGACCCTGAGG + Intronic
1084191362 11:67500414-67500436 ACGCAGACCTGCAGGTGCCCAGG + Exonic
1091079789 11:132655540-132655562 ACAGACATCTACAGATGCTGCGG - Intronic
1093907735 12:24712721-24712743 ACCAAGATCTGCAGATACAGGGG + Intergenic
1102027257 12:109720516-109720538 ACGGAGATCTGCAGATGCCGAGG - Intronic
1102988162 12:117295211-117295233 GCAGAGATCTGCAGACGGCGTGG + Intronic
1104699619 12:130892107-130892129 AGGGAGCGCTGCAGGTGCCGGGG - Intergenic
1108594550 13:51938152-51938174 ACGGCGGTTTGGAGATGCCGCGG - Intronic
1118924016 14:70175136-70175158 ACGGAGGCCTGCTGATGCCCTGG - Intronic
1121173425 14:91872913-91872935 AGGGAGATCTGCAGAGCCCAAGG + Intronic
1122315052 14:100821068-100821090 ACAGAGAACTGCAGAGGCCTGGG - Intergenic
1122702744 14:103601147-103601169 GCGGAGATGTGCAGATCACGAGG - Intronic
1124230907 15:27945467-27945489 GCAGAGCACTGCAGATGCCGGGG + Intronic
1125604514 15:40932377-40932399 AGGGAGTGCTGCAGGTGCCGTGG - Exonic
1126210037 15:46091872-46091894 ACGCAGATCTGCACATTCCTGGG - Intergenic
1129262036 15:74374051-74374073 ACGGGGATTTGCGGCTGCCGGGG - Intergenic
1132621780 16:871195-871217 ACCGAGTTCTGCAGATGCAGAGG - Exonic
1133148176 16:3806284-3806306 ACGTAGATCAGCAGCTGCCGTGG + Intronic
1137820854 16:51444318-51444340 ATGGAGATCTGCACATCCTGAGG + Intergenic
1140922232 16:79550129-79550151 ACTGGGCTCTGCAGATGCCCTGG - Intergenic
1141127225 16:81409246-81409268 ACGGAGCTCAGCAAATGTCGGGG - Intergenic
1141721770 16:85759894-85759916 TCGGAGACCTGCAGGTGCTGGGG + Intergenic
1142480352 17:215051-215073 ACGGAGATCAGCTGCTGCCCTGG + Intronic
1143766903 17:9143810-9143832 ACTGAGGTCTGCAGAGGCCAAGG + Intronic
1154160945 18:11980915-11980937 ACGGAGTTCTGCACGAGCCGGGG + Intergenic
1160018853 18:75165049-75165071 AGGGTGATCTGCAGAAGCCAGGG + Intergenic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
925926505 2:8675050-8675072 ACGGTGAACTGCACATGCCAGGG + Intergenic
926135116 2:10330995-10331017 ACAGAGAACTGGAGAGGCCGGGG - Intronic
931188786 2:59979659-59979681 AGGGAGGTCTGCAAATGCCATGG + Intergenic
936481262 2:112886924-112886946 AAGTAGATCTGCAGTTGCCTGGG - Intergenic
937439691 2:121905429-121905451 ACGGGGATCTGCAGGTGGCTGGG + Intergenic
946315558 2:218909163-218909185 ACGGAGACCTGCGGAGGGCGAGG + Intergenic
1170159836 20:13299647-13299669 AAGGAGCTCTGCAGATGGCGAGG - Exonic
1175623811 20:60473791-60473813 TAGGAGATCTGCAGGTGCCAGGG + Intergenic
1180037637 21:45257879-45257901 ACGAGGACCTGCAGAGGCCGAGG - Intergenic
1183485877 22:38087553-38087575 ACGGTGTGCTGCAGATGCCTTGG - Intronic
954976420 3:54699341-54699363 AAGGAGCTCAGCAGATGCCCGGG - Intronic
957170023 3:76726248-76726270 ACAGAGATCAGCACATGCCCTGG - Intronic
960996433 3:123343519-123343541 AGGGTGAGCTGCTGATGCCGAGG + Intronic
961167521 3:124773819-124773841 ACAGACATCAGCACATGCCGGGG - Exonic
961661197 3:128469633-128469655 ACGGGGCTCTGCAGTTTCCGGGG + Intergenic
967604199 3:191424917-191424939 AGGGAGAGCTGCATCTGCCGTGG + Intergenic
969596140 4:8150234-8150256 ACTGAGGTCTGCAGAAGCAGAGG + Intronic
970545238 4:17122686-17122708 ACCAAGCTCTGCAGTTGCCGAGG + Intergenic
974091046 4:57311835-57311857 ACGGTGAACTGCACATGCCAGGG - Intergenic
985612126 5:895632-895654 ACTGAGATCTGATAATGCCGTGG + Intronic
988722565 5:33892677-33892699 ACAGAGATCTGCAGACTCAGAGG - Intergenic
993749189 5:91645567-91645589 ACAGAGCTCTGCAGCAGCCGCGG - Intergenic
996314393 5:122145375-122145397 GCTGAGGTCTGCAGATGCCATGG + Intronic
1014014660 6:116516465-116516487 ACTGAGATCTTCAGATCCTGAGG - Exonic
1034959973 7:155358998-155359020 ACGGAGACCTGCAGTGGGCGGGG - Intronic
1035153272 7:156892787-156892809 AGGGAGAGCGGCAGAGGCCGGGG + Intronic
1038732676 8:30141218-30141240 ATGCAGATCTGCAGAGGCCTGGG + Intronic
1039368427 8:36958789-36958811 ACGTAGAACAGCAGATGCTGAGG + Intergenic
1041522490 8:58771289-58771311 AGGAGGATCTGCAGAGGCCGTGG + Intergenic
1041522502 8:58771340-58771362 AGGAGGATCTGCAGAGGCCGTGG + Intergenic
1044212083 8:89561911-89561933 ACGGAGATCTGAAGAAACTGAGG - Intergenic
1045836249 8:106524945-106524967 ACAGAGAAGTGCAGATGCCAGGG - Intronic
1048798599 8:138174703-138174725 ACGGAGCTCTCCAGATCCCTAGG - Intronic
1049920180 9:355814-355836 ATGTAGATCTGCAGATGCTTGGG - Intronic
1056475435 9:86947355-86947377 CCGGAGCTCTGCGGAGGCCGGGG - Intergenic
1060526864 9:124325833-124325855 ACTGAGATCTGCTGGTTCCGAGG + Intronic
1185738453 X:2511487-2511509 ACGGACAGATGCAGAAGCCGGGG + Intergenic
1189883323 X:45513908-45513930 ACGGAGAACTGGAAATGCCTGGG - Intergenic
1202050458 Y:20775391-20775413 ACAAAGATCTGCAGGTGCTGGGG - Intronic