ID: 1102028601

View in Genome Browser
Species Human (GRCh38)
Location 12:109727307-109727329
Sequence GTGTGCCTCTCGGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102028587_1102028601 25 Left 1102028587 12:109727259-109727281 CCTGGCCGGCCAGGGACAAATGC 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1102028601 12:109727307-109727329 GTGTGCCTCTCGGAGGGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 192
1102028588_1102028601 20 Left 1102028588 12:109727264-109727286 CCGGCCAGGGACAAATGCTCAGA 0: 1
1: 0
2: 0
3: 34
4: 217
Right 1102028601 12:109727307-109727329 GTGTGCCTCTCGGAGGGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 192
1102028589_1102028601 16 Left 1102028589 12:109727268-109727290 CCAGGGACAAATGCTCAGAGCGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1102028601 12:109727307-109727329 GTGTGCCTCTCGGAGGGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102028601 Original CRISPR GTGTGCCTCTCGGAGGGGGA GGG Intronic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
902257004 1:15196128-15196150 GGGTGTCTCTGGGTGGGGGATGG - Intronic
902642276 1:17774567-17774589 GTGTGCCACTGTCAGGGGGAAGG + Intronic
905225089 1:36473673-36473695 GCATGCCTCTGGGAGGGAGAAGG - Intronic
905241926 1:36587117-36587139 CTGTGCATATCGGAGGGGGCGGG + Intergenic
906961858 1:50423621-50423643 GCGTGCCTCTGGGAGGGGAGGGG + Intergenic
914428596 1:147600167-147600189 GTGTGCTTGCCGGAGTGGGACGG + Intronic
915458198 1:156053997-156054019 GGGGGCCTCTGGGAGGGGGAAGG + Intergenic
918907888 1:190523025-190523047 GTGTTACTCTCAGAAGGGGAAGG - Intergenic
920703284 1:208233787-208233809 CAGTGCCTCTCGGGGAGGGAGGG + Intronic
921053977 1:211530488-211530510 GTGTTCCTCAGGGAGGGGAAAGG - Intergenic
1062777811 10:169003-169025 TTGTGCTTCTTGGAGCGGGAGGG + Intronic
1062960119 10:1567177-1567199 GTCTGCTTCTCGGTGGGGGGAGG - Intronic
1066421886 10:35271455-35271477 CTGTGCTTCTGGCAGGGGGAAGG + Intronic
1067083503 10:43226492-43226514 GCGTGGATCTCGGAGGAGGATGG - Intronic
1067557639 10:47283920-47283942 GTGTGGCTCTTGGTGGTGGAGGG - Intergenic
1069573316 10:69507361-69507383 GTGTGCCCCTCGGGGCAGGAGGG + Exonic
1069831905 10:71286872-71286894 GCGGGCCTTTCGGAGTGGGAGGG + Intronic
1070312335 10:75282902-75282924 GTGTGACTCCCAGAGAGGGAAGG - Intergenic
1070818830 10:79342948-79342970 GTTGGCCTCTGGGAAGGGGACGG - Intergenic
1071600024 10:86954478-86954500 GGGAGCCTGTGGGAGGGGGAGGG + Intronic
1072180710 10:92976621-92976643 GTGTTTCTCGCAGAGGGGGATGG - Intronic
1077098722 11:811521-811543 CTGTGACTCTGGGAGGGAGAGGG + Intronic
1083654963 11:64225150-64225172 ATCTGCCTCACGGAGGGGCAGGG + Intronic
1085253620 11:75159736-75159758 CTGTGCCTCTGGGCAGGGGAGGG - Intronic
1085282428 11:75340030-75340052 GTGTCTCTCTCCGAGTGGGAAGG - Intronic
1085700012 11:78737406-78737428 GTGTGCCTCTTAGATGGGGTTGG - Intronic
1087954236 11:104265005-104265027 GGGGGCCTCTTGGAGGGTGAAGG - Intergenic
1089739692 11:120573867-120573889 GTGGGCCTCTGGGATGTGGAAGG - Intronic
1090851975 11:130578801-130578823 GAGGGCCTCTCGGAGAGGGAAGG - Intergenic
1090996277 11:131868599-131868621 GTTTGGCTCTCGAAGAGGGAGGG - Intronic
1093778140 12:23101127-23101149 GAGTGCCTCTTGCAGGGAGATGG + Intergenic
1098209494 12:68148771-68148793 CTGTGGCTCTGGCAGGGGGAGGG - Intergenic
1102028601 12:109727307-109727329 GTGTGCCTCTCGGAGGGGGAGGG + Intronic
1102137056 12:110583836-110583858 GTGTCCCTATCAGAGTGGGAGGG + Intergenic
1103872384 12:124101177-124101199 GTGTTTCTCGCAGAGGGGGAGGG + Intronic
1104186130 12:126433587-126433609 TTGTGCCTTTCAGAGGGTGAAGG - Intergenic
1104759838 12:131290154-131290176 GTAGGCCTCTCGCTGGGGGAGGG - Intergenic
1104820889 12:131677095-131677117 GTAGGCCTCTCGCTGGGGGAGGG + Intergenic
1104917696 12:132274362-132274384 GTGAGCCTCTTGAAGGGTGAGGG - Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1107467554 13:40664840-40664862 GTGTGACCCTCGGCGGGGGCGGG - Intronic
1108340753 13:49496262-49496284 GCGTGCCTGTTGGTGGGGGAGGG + Intronic
1113364296 13:109661866-109661888 GTGTGCCTCTGGGCAGGGCAAGG + Intergenic
1113786878 13:113006662-113006684 GTGTGCATCTCAGTGGGGGCTGG + Intronic
1117420723 14:55542535-55542557 TTGTGCTTCTGGCAGGGGGAGGG + Intergenic
1122967900 14:105139787-105139809 GTGTGGCTGTTGGAGGTGGAGGG - Intergenic
1124017158 15:25886994-25887016 GTGTGTGTCTTGGAGGGGAAAGG + Intergenic
1124209681 15:27752804-27752826 GTGGGCCTCTGGGGGGGGGGGGG - Intergenic
1124347269 15:28931095-28931117 CTGTGCCTCATGGAGGGGGCTGG - Intronic
1128314924 15:66654439-66654461 GTGTGATTCTTGGAGGGGGCAGG + Intronic
1130273729 15:82465681-82465703 CTGTGCCTCTAGGAGGGGTGGGG + Intergenic
1130466077 15:84193052-84193074 CTGTGCCTCTAGGAGGGGTGGGG + Intergenic
1130498186 15:84480484-84480506 CTGTGCCTCTAGGAGGGGTGGGG - Intergenic
1130588369 15:85197648-85197670 CTGTGCCTCTAGGAGGGGTGGGG + Intergenic
1131448562 15:92519813-92519835 GTGTGCCTCTTGATGGGGGTGGG - Intergenic
1132612732 16:825302-825324 TTGTCCCTCTCCGAGCGGGAGGG + Intergenic
1137546456 16:49407934-49407956 CTCTGCCTCTGGGAGGTGGAAGG - Intergenic
1137561219 16:49503490-49503512 GAGTGCTGCTGGGAGGGGGAGGG - Intronic
1140244289 16:73234107-73234129 ATGTGTCTCTCCGAGAGGGAGGG + Intergenic
1144374973 17:14630208-14630230 ATGTGCCACTCAGAGTGGGAGGG - Intergenic
1146833521 17:36090566-36090588 CTTTGCCTCTGGGAGGAGGAAGG - Intergenic
1147192515 17:38746398-38746420 GTGTGCTTCTAGGTGGGGGGTGG - Intronic
1148123710 17:45226259-45226281 GTGTGCACATGGGAGGGGGAGGG + Intronic
1149507886 17:57211154-57211176 AAGTGCCTGACGGAGGGGGAGGG + Intergenic
1151872401 17:76845200-76845222 GTGTTTCTCTCGGCTGGGGAAGG - Intergenic
1152266461 17:79297630-79297652 GTGTGCCTTTCCCAGGGAGATGG + Intronic
1152846584 17:82603776-82603798 GTGTGCCTCTCACAGATGGAAGG + Exonic
1152918000 17:83051893-83051915 GTGGGCCTCCCGGAGGGGCGTGG + Intergenic
1155025387 18:21935917-21935939 GTGTCCCTCATGGAGGGGGGCGG - Intergenic
1155967960 18:32053657-32053679 GTGTGCCTCTAGGAGGCAGGAGG + Intronic
1156366168 18:36429248-36429270 CTGTGTCTGTCTGAGGGGGATGG + Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157473957 18:48009643-48009665 GTTTGGCTCTCGGGTGGGGATGG - Intergenic
1157518947 18:48331566-48331588 CTGTACCTCTTGGACGGGGATGG - Intronic
1158163939 18:54517758-54517780 GTGTGACTCTCGGAGGAGAAGGG + Intergenic
1159000982 18:62974930-62974952 GTGTGCCTGTCAGTGGGGTAGGG + Intronic
1159842727 18:73417728-73417750 GGGTGCCTCTCAGTGGGGTAAGG - Intergenic
1160385339 18:78493358-78493380 ATGTGACTCACTGAGGGGGATGG - Intergenic
1160385462 18:78493874-78493896 ATGTGACTCACTGAGGGGGATGG - Intergenic
1160415222 18:78705286-78705308 CTGGGCCTCCCGGAGGGAGAGGG + Intergenic
1160871832 19:1281288-1281310 CTGTGCCTCTGGGTGGGGGGGGG + Intergenic
1161060045 19:2210328-2210350 GCGTGCCTCTCGGTGCAGGAGGG + Intronic
1162742652 19:12782495-12782517 GGGCGCCTCCCGGAGGGGAACGG - Intronic
1162814292 19:13183916-13183938 GTGTCCCTCTGGGAGGAGGCGGG - Intergenic
1163192474 19:15687472-15687494 GTGTGCCTCTCCCATGTGGAAGG + Intronic
1164469517 19:28518370-28518392 GTGTGCCTCTCTGAGAGGACAGG + Intergenic
1164590062 19:29501851-29501873 GTGTGCTTCTCTGAGGCTGAGGG - Intergenic
1165110243 19:33498058-33498080 GTGTCCCTCCCGCAGCGGGAGGG + Intronic
1166347369 19:42175149-42175171 CTGGGGCTCTGGGAGGGGGAGGG - Intronic
927224076 2:20744677-20744699 ATGTGCTTCTGGCAGGGGGAAGG - Intronic
928091719 2:28378610-28378632 GTGTGCCTATGGCAGGGGGAGGG + Intergenic
929611691 2:43275484-43275506 GGGTGCCTCTGGGAGCTGGATGG - Intronic
931544094 2:63361805-63361827 CTGTGCTTCTCAGAGCGGGAGGG + Intronic
933469523 2:82703424-82703446 GTGTGCCTATTTGAGAGGGAGGG - Intergenic
933469679 2:82705780-82705802 GTGTGCCTATTTGAGAGGGAGGG - Intergenic
935036418 2:99379641-99379663 GGCTGCCTCTGGGAGAGGGAGGG - Intronic
937375998 2:121336017-121336039 GTGTGCCTGTCGGGGGGGGGGGG + Intergenic
938230858 2:129657555-129657577 TTGTGCTTCTGGCAGGGGGAGGG - Intergenic
939067317 2:137499100-137499122 GTGTGCCTCTTGCAGGAGAAGGG + Intronic
941066052 2:160904151-160904173 GTGTGCCTAGGGGATGGGGAAGG + Intergenic
942469458 2:176244562-176244584 GTGTGCTTCTTGGAGGAGGAGGG - Intergenic
948018596 2:234710927-234710949 GTTTGTCACTCTGAGGGGGATGG + Intergenic
948516268 2:238505659-238505681 GAGTGACTCAAGGAGGGGGAGGG - Intergenic
948687624 2:239678991-239679013 GGGTGCCACTCGGAGAGGCAGGG - Intergenic
1172420976 20:34817248-34817270 GTGTGTGTGACGGAGGGGGAGGG + Intronic
1172656391 20:36541207-36541229 GTTTGCCTCTCTGGAGGGGAAGG + Intergenic
1174577424 20:51546457-51546479 GAGTGACTCTGGGAGGTGGAGGG + Intronic
1175825454 20:61934223-61934245 GTGTGCCTCTCGGCAGTGGGGGG + Intronic
1176549119 21:8213872-8213894 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
1176557012 21:8258093-8258115 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
1176568051 21:8396910-8396932 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
1176575954 21:8441130-8441152 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
1177929595 21:27264541-27264563 GTGTGCCTCCTGAAGGGGTATGG + Intergenic
1178638120 21:34322909-34322931 GTCTGCTTCTCTGAAGGGGAAGG - Intergenic
1179506376 21:41844604-41844626 GTGTGTCCCTGTGAGGGGGAGGG - Intronic
1179506384 21:41844631-41844653 GTGTGTCTCTGTGAGGGGGGAGG - Intronic
1179506409 21:41844748-41844770 GTGTGTCCCTGTGAGGGGGAAGG - Intronic
1179506453 21:41844889-41844911 GTGTGTCCCTGTGAGGGGGAGGG - Intronic
1179506510 21:41845056-41845078 GTGTGTCCCTGTGAGGGGGAGGG - Intronic
1179506590 21:41845288-41845310 GTGTGTCCCTGTGAGGGGGAGGG - Intronic
1179506599 21:41845314-41845336 GTGTGTCCCTGTGAGGGGGAGGG - Intronic
1179565402 21:42244807-42244829 GTGTGCCTCTCCCATAGGGAAGG - Intronic
1179632772 21:42688908-42688930 GGGGGCCTCACTGAGGGGGACGG - Intronic
1180012159 21:45058481-45058503 GTGGGGCTCAGGGAGGGGGAGGG + Intergenic
1182256634 22:29043720-29043742 GTTTGCCTTTCAGAGGGAGATGG - Intronic
1182477528 22:30584338-30584360 GTGTGCCTGTCGGGAGGGGACGG - Intronic
1182529033 22:30941193-30941215 GTGTGCCTCTGTGACAGGGAGGG - Intronic
1182582098 22:31320325-31320347 GTGTGTCTCTGGGGAGGGGATGG + Intergenic
1183376440 22:37468058-37468080 GTGGGGCTCTCAGATGGGGAAGG - Intergenic
1184820319 22:46905094-46905116 CTGTGGCTTTCAGAGGGGGACGG + Intronic
1184935452 22:47717158-47717180 GTGTGCCTGTAGGGGGGGGTGGG - Intergenic
1203254004 22_KI270733v1_random:130188-130210 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
1203262060 22_KI270733v1_random:175267-175289 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
950498479 3:13348775-13348797 CCGTGCCTCAAGGAGGGGGAGGG - Intronic
952015804 3:28955902-28955924 GTGTGCGTGTTGTAGGGGGAAGG + Intergenic
952989669 3:38820862-38820884 GTGAGCCTGTCGGAGGTGGAAGG + Intergenic
953771279 3:45780142-45780164 CTGGGCCTGGCGGAGGGGGAAGG - Intronic
954276850 3:49547819-49547841 ATGAGCCTCTCTGAGGAGGATGG - Intergenic
954617094 3:51974671-51974693 GTGTGCGTCGGGGAGGGGGTGGG + Intronic
955344557 3:58151451-58151473 GTGTGCCTCAAGGTGGGGGGAGG + Intronic
960619893 3:119627631-119627653 GCGTTCCTCTCGGCGGGGGCAGG - Intronic
962696121 3:137948981-137949003 GTGTGTCCCTAGGAGGGAGATGG + Intergenic
963727322 3:148937096-148937118 GTAAGCCTCTAGGAAGGGGATGG - Intergenic
968148308 3:196318112-196318134 GTGTCCTTCTCGGTGGGCGACGG - Exonic
968576296 4:1367795-1367817 GGCTGCGTCTCGGTGGGGGAAGG - Intronic
968645976 4:1740686-1740708 GTGTGAGCCTCGGAGGGTGATGG - Intronic
969241740 4:5903145-5903167 GGGTGCCTCTCAGTGGGGGAGGG + Intronic
969567239 4:7985715-7985737 GGGTGACACTCTGAGGGGGATGG + Intronic
969697298 4:8742006-8742028 GTGGGTCACTGGGAGGGGGATGG - Intergenic
972775559 4:42236722-42236744 GTCTGCCCCTGGGAGGGGAAGGG + Intergenic
973138464 4:46735677-46735699 TTTTGCCTGTAGGAGGGGGAAGG - Intronic
975856231 4:78627479-78627501 GAGTGCCTCTGGGATGGGGATGG + Intergenic
977222911 4:94358508-94358530 GTGTGTCTGTTGGAGGGGGTGGG + Intergenic
979785504 4:124712185-124712207 GTGTGTCTTTTGAAGGGGGAGGG + Intronic
983122394 4:163902928-163902950 ATGTGCCTCTCGAAGGGAAAGGG - Intronic
983768450 4:171517785-171517807 GAGTGTCTCTCTGAGGGTGAGGG + Intergenic
986244790 5:5997588-5997610 GTGTGCCTGTGGCAGGGTGATGG + Intergenic
986516947 5:8574187-8574209 GTGTACCTCATGGGGGGGGAGGG + Intergenic
986544391 5:8879842-8879864 CTCTGCCTCTGGAAGGGGGAAGG - Intergenic
993252513 5:85547845-85547867 GTGTGCTTGTGGGAGGGAGAAGG + Intergenic
993389195 5:87297706-87297728 TTGTGCTTCTGGTAGGGGGAAGG - Intronic
995352366 5:111194261-111194283 TATTGCCTCTGGGAGGGGGAAGG - Intergenic
996230655 5:121059636-121059658 GTGTGCCTATCTGATGAGGAAGG - Intergenic
998536046 5:142931831-142931853 TTCTGCCTCTCTGAGGGAGATGG + Intronic
999195347 5:149778000-149778022 GTGTGTCTGTGGGGGGGGGAAGG - Intronic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
999334190 5:150700905-150700927 GTGTGCCTGCCGGAGGAGGATGG - Intronic
1004342324 6:14818625-14818647 ATGTGCCTCTGGGAGGGCAAGGG - Intergenic
1006307691 6:33234459-33234481 GTGTTCCTCTTGGAGGGGTGTGG + Intergenic
1007088927 6:39169823-39169845 GTGTGGCATTGGGAGGGGGAAGG - Intergenic
1009540278 6:64945880-64945902 GTGTGCCTATCTGATTGGGAAGG - Exonic
1013042902 6:106454045-106454067 TTGAGCCTCTCTGAGGTGGAGGG - Intergenic
1013117755 6:107115390-107115412 GTGTGCCCCGCTGAGGGGGAGGG - Intergenic
1013984874 6:116178756-116178778 GTGAGCATCTCAGAAGGGGAGGG + Intronic
1018802625 6:167235885-167235907 GTGTGCCCCACGGAGTGGGTGGG - Intergenic
1018876687 6:167827368-167827390 GTGGGCCTGGGGGAGGGGGAGGG - Intronic
1019365432 7:630289-630311 GTTTGCCTCTCCGATGGGGCTGG - Intronic
1020604651 7:10321262-10321284 GTATGAATATCGGAGGGGGAAGG - Intergenic
1024694433 7:51840190-51840212 GTTTGCCTATGGTAGGGGGATGG + Intergenic
1029284829 7:99458264-99458286 GTGTTCCTCACGGAGGGGCTCGG + Exonic
1033406320 7:141073843-141073865 GCCTGTCTCTCTGAGGGGGACGG - Intergenic
1036215778 8:6878517-6878539 GTGTGGCCCTTGGAGGGTGAGGG + Intergenic
1036552722 8:9829191-9829213 GAGTGCCGCTCGGAGGGCGGAGG - Intergenic
1037330824 8:17742007-17742029 GTGTTCCTCACAGAGGAGGAAGG + Intronic
1041740445 8:61151640-61151662 GTGTGCCTTTCACAGGGGCAGGG + Intronic
1045269902 8:100652766-100652788 TTGGGCCTCTGGGATGGGGAGGG + Intronic
1049206206 8:141364798-141364820 GGGTGTCTCTGGGAGGGGCATGG + Intronic
1053126613 9:35586000-35586022 GTGTGACTCCTGGAGGGGAAAGG - Intergenic
1053428728 9:38027891-38027913 GGGTGCCTCCTGGAGAGGGATGG + Intronic
1057080422 9:92170909-92170931 GTGTGCCCCACTGAGGGGGAGGG + Intergenic
1058506745 9:105674149-105674171 GTGTGGCCATGGGAGGGGGAGGG + Intergenic
1062331067 9:136045193-136045215 GTGTGCCTCTCTGCAGGGCATGG - Intronic
1203470405 Un_GL000220v1:113332-113354 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
1203478226 Un_GL000220v1:157304-157326 GGTCGCGTCTCGGAGGGGGACGG - Intergenic
1185761941 X:2695181-2695203 GTGTGTCTCTCGGGGTGCGAAGG + Intronic
1186410397 X:9341131-9341153 ATGTGTCTGTAGGAGGGGGAAGG - Intergenic
1190712277 X:53079415-53079437 GGGTGCCTTTCCGAGGGGGTGGG + Exonic
1192054072 X:67755719-67755741 TTGTGCCTCTGGGAAGGCGAAGG + Intergenic
1192463486 X:71338135-71338157 GTTTGGCTCATGGAGGGGGATGG + Intergenic
1192675994 X:73197524-73197546 GTGATCCTCTGGGAGGGGGAAGG - Intergenic
1193442270 X:81557036-81557058 GTGTGTGTGTGGGAGGGGGAAGG - Intergenic
1194041806 X:88950736-88950758 TGGTACCTCTAGGAGGGGGAAGG + Intergenic
1195942316 X:110176347-110176369 TTGTGCCTCTGGGAGGAAGATGG - Exonic
1196746978 X:119079806-119079828 GTGTGCCTCTAGGAATGAGAGGG + Exonic
1197794063 X:130282037-130282059 GTGTTCCTCTCTGAGTGTGAGGG - Intergenic
1200047306 X:153409771-153409793 GTGTGCCTCGGGCAGGGGAAGGG - Intergenic