ID: 1102028862

View in Genome Browser
Species Human (GRCh38)
Location 12:109728575-109728597
Sequence CAGTCTGAGCAAAGGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1045
Summary {0: 2, 1: 5, 2: 23, 3: 166, 4: 849}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102028862_1102028869 12 Left 1102028862 12:109728575-109728597 CCTCTGTGCCTTTGCTCAGACTG 0: 2
1: 5
2: 23
3: 166
4: 849
Right 1102028869 12:109728610-109728632 GGTGTACCCTCACCATCTGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1102028862_1102028870 13 Left 1102028862 12:109728575-109728597 CCTCTGTGCCTTTGCTCAGACTG 0: 2
1: 5
2: 23
3: 166
4: 849
Right 1102028870 12:109728611-109728633 GTGTACCCTCACCATCTGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 105
1102028862_1102028867 -9 Left 1102028862 12:109728575-109728597 CCTCTGTGCCTTTGCTCAGACTG 0: 2
1: 5
2: 23
3: 166
4: 849
Right 1102028867 12:109728589-109728611 CTCAGACTGGGGCATCTGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 231
1102028862_1102028874 25 Left 1102028862 12:109728575-109728597 CCTCTGTGCCTTTGCTCAGACTG 0: 2
1: 5
2: 23
3: 166
4: 849
Right 1102028874 12:109728623-109728645 CATCTGCAGGGCTAAGAGTCTGG 0: 1
1: 0
2: 5
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102028862 Original CRISPR CAGTCTGAGCAAAGGCACAG AGG (reversed) Intronic
901252874 1:7795107-7795129 CGGCCTGAGAAAGGGCACAGCGG + Intronic
901480212 1:9519909-9519931 CAGCATGTGCAAAGGCTCAGAGG + Intergenic
901562553 1:10084182-10084204 CAAGCCTAGCAAAGGCACAGGGG + Intronic
901785212 1:11620008-11620030 CAGTCTGTGGCCAGGCACAGTGG - Intergenic
901883071 1:12205255-12205277 CGGCCTGTGCAAAGGCCCAGGGG + Intronic
902156643 1:14492972-14492994 CAGCCAGGGCAAAGGCACTGAGG - Intergenic
902264814 1:15255748-15255770 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
902393567 1:16119980-16120002 CAGAATGGGCAAAGGCACAGAGG + Intergenic
902622541 1:17658929-17658951 CAGTATACGCAAAGGCCCAGAGG + Intronic
902651083 1:17838084-17838106 TAGCCTGTGCAAAGGCGCAGAGG + Intergenic
902679508 1:18033178-18033200 CAGAATGAGCAAAGGCTAAGAGG - Intergenic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902845780 1:19109772-19109794 CTGCATGTGCAAAGGCACAGGGG + Intronic
902948532 1:19862024-19862046 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
902957212 1:19933916-19933938 CAGCCTGTGCAAAGGCCCTGTGG + Intergenic
903052452 1:20611836-20611858 CAGTATGTGCAAAGGCCCTGAGG - Intronic
903094389 1:20955811-20955833 CAGTCTGAGAAAGGGAACACTGG + Intronic
903275620 1:22219479-22219501 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
903304634 1:22404155-22404177 CAGCCTTTGCAAAGGCTCAGAGG + Intergenic
903328499 1:22585155-22585177 CAGCCTGTGCAAAGGCCCCGAGG + Intronic
903367961 1:22816513-22816535 CAGCGTGAGCCAAGGCCCAGAGG - Intronic
903373844 1:22853652-22853674 CTGCCTGAGCAAAGGCCCAGAGG + Intronic
903543402 1:24109110-24109132 CAGCGTGGGCAAAGGCCCAGAGG - Intronic
903595490 1:24490662-24490684 CAGACTGCCCAAAGGGACAGTGG + Intergenic
903643468 1:24876265-24876287 CAGCCTGAACCAAGTCACAGAGG - Intergenic
903661163 1:24979727-24979749 CAGCATGGGCAAAGGCTCAGAGG + Intergenic
903965350 1:27085381-27085403 CATTCTGAGGCCAGGCACAGTGG - Intergenic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904254055 1:29243482-29243504 CAGTGTGTGCAAAGGTAGAGAGG - Intronic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
904458937 1:30664046-30664068 CACTGTGCCCAAAGGCACAGGGG + Intergenic
904602058 1:31678962-31678984 CAGCCGGTGCAAAGGCCCAGAGG - Intronic
904621901 1:31780904-31780926 AGGTATGTGCAAAGGCACAGAGG + Intergenic
904814186 1:33182739-33182761 CAGCCTGTGCAAAAGCATAGAGG + Intergenic
904850543 1:33455849-33455871 CAGTATGAGAAAAGACACAGAGG + Intergenic
905227245 1:36487251-36487273 CAGCCTGAGCAAAGGCCAGGAGG - Intergenic
905241826 1:36586547-36586569 TAGCTTGGGCAAAGGCACAGTGG - Intergenic
905260615 1:36715616-36715638 CAGCCAGTGCAAAGGCGCAGAGG - Intergenic
905312350 1:37058576-37058598 CAGTATGTGCAAAGGCCCTGTGG - Intergenic
905328795 1:37177382-37177404 CAGCCTGAGCAAAGGCCCAGAGG + Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
905907910 1:41631907-41631929 CTGCCTGAGCCAAGGCTCAGAGG - Intronic
905973374 1:42157321-42157343 CAGCCTGAATAAAGGCACTGAGG - Intergenic
906025129 1:42666958-42666980 CTGTGTGAGCAAAGGCTCAGGGG - Intronic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906674313 1:47682213-47682235 CAGTAAGTGCAAAGGCACAGAGG - Intergenic
906721080 1:48005274-48005296 CAGGCTGGGAAAAGGCCCAGAGG + Intergenic
906795274 1:48691888-48691910 AAGGCAAAGCAAAGGCACAGAGG - Intronic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907219801 1:52898046-52898068 AAGTATGGGCAAAGGCACAGAGG - Intronic
907238238 1:53065806-53065828 CAATGTGTGCAAAGGCCCAGAGG - Intronic
907266843 1:53267042-53267064 CAACCTGAGCAAAGGCTCTGAGG - Intronic
907332921 1:53683065-53683087 TGGTCTGTGCAAAGGCACTGAGG + Intronic
907377759 1:54057884-54057906 CAGTATATGCAAAGGCACAGAGG - Intronic
907431646 1:54415553-54415575 CAGCATGGACAAAGGCACAGAGG + Intergenic
907440201 1:54474247-54474269 CAGCATCAGCAAAGGCACAAAGG - Intergenic
907462672 1:54614559-54614581 CAGCATGTGCAAAGGCTCAGAGG + Intronic
907516412 1:54996088-54996110 CAGCATGTGCAAAGGCACTGAGG - Intergenic
907831336 1:58066991-58067013 CAGCATGAGCAAAGGCTCTGAGG - Intronic
907943394 1:59110258-59110280 CAGTGGGAGCAAAGGGACAGAGG - Intergenic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
908256488 1:62308005-62308027 CGGGGTGAGCAAAGGCACAGGGG - Intronic
908333625 1:63097401-63097423 CAGTATGAGCAAAGACATCGAGG + Intergenic
908887193 1:68802972-68802994 CAGTCAAAGCAAAGGCAAACTGG + Intergenic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
910367278 1:86479596-86479618 CAATGTGAGCCAGGGCACAGTGG + Intronic
910433854 1:87185290-87185312 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
910844858 1:91595060-91595082 CACTCTGGGCAAAGGGGCAGAGG + Intergenic
911069591 1:93822101-93822123 CAGTGTGGGCAAAGGCATTGAGG + Intronic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
911699365 1:100933336-100933358 TACTATGAGCAAAGGTACAGGGG - Intronic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912718456 1:111999911-111999933 CAGCCTGAGCAAACACTCAGGGG - Intergenic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912883183 1:113439366-113439388 CAGTATGTGCAAAGGCACAGAGG - Intronic
913298496 1:117345466-117345488 CAGCCTCTGCAAAGGCCCAGGGG + Intergenic
913404246 1:118471487-118471509 CAGCCTGAAGAAAAGCACAGAGG + Intergenic
913566301 1:120075932-120075954 CAGTGTGTGCAAAGAGACAGAGG + Intergenic
913567460 1:120087053-120087075 TAGCATAAGCAAAGGCACAGAGG + Intergenic
913630674 1:120706493-120706515 TAGCATAAGCAAAGGCACAGAGG - Intergenic
913631830 1:120717619-120717641 CAGTGTGTGCAAAGAGACAGAGG - Intergenic
914286889 1:146235288-146235310 CAGTGTGTGCAAAGAGACAGAGG + Intergenic
914288208 1:146247760-146247782 TAGCATAAGCAAAGGCACAGAGG + Intergenic
914453379 1:147812983-147813005 GAGTGTGAGCAAACTCACAGGGG + Intergenic
914547921 1:148686031-148686053 CAGTGTGTGCAAAGAGACAGAGG + Intergenic
914549244 1:148698506-148698528 TAGCATAAGCAAAGGCACAGAGG + Intergenic
914617440 1:149373212-149373234 TAGCATAAGCAAAGGCACAGAGG - Intergenic
914618588 1:149384314-149384336 CAGTGTGTGCAAAGAGACAGAGG - Intergenic
915540717 1:156564131-156564153 CCTGCTGAGCTAAGGCACAGGGG + Intronic
915744875 1:158148159-158148181 CAGGCTGAGCAGAGGCTCAAGGG - Intergenic
915906391 1:159881012-159881034 CACCATGAGCAAAGCCACAGGGG - Intronic
916488653 1:165281584-165281606 CAGGCTGACCACAGGCAGAGAGG + Intronic
916592416 1:166205219-166205241 CAGCCTCTGCAAAGGCTCAGGGG - Intergenic
916676067 1:167065354-167065376 CAGCATGTGCAAAGGCTCAGAGG + Intronic
917453447 1:175166191-175166213 CTGTTTGAGCAAAGGCCCAAGGG - Intronic
917488338 1:175475597-175475619 CAGCAGGTGCAAAGGCACAGTGG - Intronic
917796249 1:178534736-178534758 CAGCGTTAGCAAAGGCACAATGG - Intronic
917812763 1:178675972-178675994 CAGGCTGAGGCCAGGCACAGTGG + Intergenic
917849990 1:179053633-179053655 CAGTCTTAGAAAAGCCACAAAGG - Intronic
918322263 1:183375445-183375467 CAGCCTGGGCAAAGGCATAGGGG - Intronic
918634885 1:186763966-186763988 CAGCCAGTGCAAAGGCCCAGAGG - Intergenic
919616105 1:199810969-199810991 CAGTCTGAGGCCAGGCACGGTGG + Intergenic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919885373 1:201930030-201930052 CAATATGTTCAAAGGCACAGAGG + Intronic
919976208 1:202614746-202614768 CAGCCTATGCAAAGGCCCAGAGG + Intronic
920092946 1:203467073-203467095 CAGACTGGGCAAAGGCATAGAGG + Intergenic
920614953 1:207482813-207482835 CAGTTTGAATAAAGGCCCAGAGG + Intronic
921157891 1:212452442-212452464 CAGCATGTGCAAAGGCCCAGGGG - Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921350707 1:214231453-214231475 CAGTGTGTGCAAAGCTACAGTGG - Intergenic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
923024451 1:230193911-230193933 GAGGCTGAGCATAGGCACTGAGG - Intronic
923305928 1:232688083-232688105 AATAATGAGCAAAGGCACAGAGG - Intergenic
923541286 1:234889993-234890015 GGGTGTGAGCAAAGGCACACCGG + Intergenic
923788891 1:237094106-237094128 GTATCTGTGCAAAGGCACAGAGG - Intronic
924458425 1:244236879-244236901 CAGTATGTGCAAAGGCCCTGTGG + Intergenic
924655193 1:245968351-245968373 CAGCCTAGGCAAAGGCACTGAGG - Intronic
1063299728 10:4840686-4840708 CAGTATTTGCAAAGGCACAGAGG - Intronic
1063357405 10:5413266-5413288 CGGTCTGAGCAAAGGCATTTGGG - Intronic
1063397844 10:5708262-5708284 TAGTATGAGCAAATGAACAGCGG - Intronic
1063625564 10:7686402-7686424 CAGTATGAGCAAAGGCTCCCAGG - Intergenic
1063788800 10:9415907-9415929 CAGTCAGTGCAAAGGCCCTGAGG - Intergenic
1064244823 10:13659977-13659999 CACTCGGAGCAAATGCAGAGTGG - Intronic
1065484591 10:26225555-26225577 CAGACAGAGCAAAGGCCAAGTGG + Intronic
1066185227 10:33003941-33003963 AAGTCTTAGCAATGTCACAGAGG + Intronic
1066638440 10:37531362-37531384 CATTCTCAGCAAAGTAACAGAGG + Intergenic
1066657673 10:37711108-37711130 CAGTCTCTGCTAAGGCTCAGAGG - Intergenic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1067780261 10:49197309-49197331 CAGTGTCAGAAAAGGCTCAGGGG - Intergenic
1068132895 10:52916828-52916850 CGGTCTATGCAAAGGCAAAGTGG + Intergenic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068601872 10:58965253-58965275 CAGAATGTGCAAAGGCTCAGTGG - Intergenic
1069036874 10:63654906-63654928 CAGTCTCAGGCCAGGCACAGTGG + Intergenic
1069177622 10:65312919-65312941 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1069604928 10:69732950-69732972 CAGGCTGAACAAAGGCCCAGAGG + Intergenic
1069761157 10:70812546-70812568 CAGTTTGATCAAAGTCAGAGTGG - Intergenic
1069937064 10:71924966-71924988 CAGCATGTGCAAAGACACAGAGG - Intergenic
1070078399 10:73160867-73160889 AAGTATGTGCAAAGGCACAGAGG + Intronic
1070767095 10:79063032-79063054 GAGCATGAGCAATGGCACAGAGG + Intergenic
1070808594 10:79285903-79285925 CAGCCTGAGAAGAGGCACAGAGG + Intronic
1071060215 10:81561254-81561276 CAGTGTGAGCAAAGTCTCAAAGG - Intergenic
1071371532 10:84956646-84956668 CAGACTGAGCAAGGGGAAAGTGG - Intergenic
1071497140 10:86176432-86176454 CAGCATGTGCAAAGGCACTGAGG + Intronic
1071508992 10:86249650-86249672 CTGCCTGGGCAAAGGCATAGAGG - Intronic
1071807365 10:89138447-89138469 CAGCCTGAGCACAAGCACAGAGG + Intergenic
1072533823 10:96344393-96344415 AAGTCTGCCCAAAGACACAGAGG + Exonic
1072827251 10:98619673-98619695 CATTATGAGCAAAGGCACAGAGG - Intronic
1074047482 10:109851961-109851983 AAGTCAGAGGAAAGTCACAGAGG + Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074942120 10:118246165-118246187 CAGCCTGCGGAAATGCACAGTGG - Intergenic
1075105652 10:119538498-119538520 CTGGGGGAGCAAAGGCACAGAGG + Intronic
1075122326 10:119673087-119673109 CAGCATGGGCAAAGGCACAGGGG - Intronic
1075200761 10:120402016-120402038 CAGCATGTGCAAAGGCACTGGGG - Intergenic
1075549544 10:123382080-123382102 CAGCCTATGCAAAGGCACTGAGG - Intergenic
1075605410 10:123801796-123801818 CAGTATGTGCAAAGGCCCTGGGG - Intronic
1075955768 10:126521420-126521442 CATTCTGAGCCTAGCCACAGAGG - Exonic
1075985321 10:126780049-126780071 CTGTGTGAGCAAAGGCCTAGAGG - Intergenic
1076886654 10:133266183-133266205 CAAGCTGAGGAAAGGCAGAGGGG + Intronic
1076912813 10:133400369-133400391 GAGTCTGAGAACAGGCACAGAGG - Intronic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078303010 11:10152877-10152899 TAGCTTGATCAAAGGCACAGAGG + Intronic
1078597919 11:12704431-12704453 CGGTGGAAGCAAAGGCACAGAGG - Intronic
1078896222 11:15599622-15599644 CAGCTTGGGCAAAGGTACAGAGG - Intergenic
1079164951 11:18031736-18031758 CAATATGAGCAAAGGTTCAGAGG - Intronic
1079333794 11:19553806-19553828 CAGACTGAGGAGAGGTACAGAGG + Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079367147 11:19819391-19819413 CAGCGTGTGAAAAGGCACAGAGG + Intronic
1079455578 11:20633417-20633439 CCTTCTGCCCAAAGGCACAGAGG + Intronic
1080056371 11:27910860-27910882 CAGCAGAAGCAAAGGCACAGAGG + Intergenic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1080764083 11:35279518-35279540 CAGCCTGCACAAAGGCACTGAGG - Intronic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081591775 11:44428051-44428073 AAGGTTGAGCAAAAGCACAGAGG - Intergenic
1081686469 11:45046764-45046786 CAGCCTGACCAAAGGCTCAGAGG + Intergenic
1082130148 11:48478789-48478811 CATTCTGAGCAAACTAACAGAGG + Intergenic
1083277578 11:61605896-61605918 CAGCTTAAGCAAAAGCACAGAGG - Intergenic
1083292741 11:61698959-61698981 CAGACTGTGCAAGGGCACAGAGG + Intronic
1083328862 11:61887635-61887657 CAGCTAGAGCAAAGGCTCAGAGG - Intronic
1083356312 11:62068910-62068932 CAGTAGGAGCAAAGGCCCCGAGG + Intergenic
1083642933 11:64155211-64155233 CAGTATGTGCAAAAGCCCAGAGG + Intronic
1083684214 11:64366645-64366667 CAGCAAGTGCAAAGGCACAGAGG - Intronic
1084122434 11:67077512-67077534 CAGTCTGAGCGAAGGCTAGGAGG - Intergenic
1084452167 11:69245627-69245649 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1084887435 11:72220284-72220306 CATTTTGAGCAAAGGAAGAGAGG - Intronic
1084902360 11:72319102-72319124 TAGTGTCAGCAAAGGCCCAGAGG - Intronic
1084943654 11:72627402-72627424 CAGTCTGAGGAACGTCACAAAGG + Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1084947557 11:72646759-72646781 CAGGTTGGGCAAAGGCAAAGAGG - Intronic
1085217567 11:74845630-74845652 CAGCACGAGCAAAGGCGCAGAGG + Intronic
1085282124 11:75338009-75338031 CGGCTTGAGCAAAGGCACAGAGG + Intronic
1085295235 11:75427758-75427780 CAGTATGGGCAAAGGCACAAGGG - Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085401997 11:76241025-76241047 CGGTCTGAGGCAAAGCACAGGGG + Intergenic
1085719255 11:78898524-78898546 CAGTCTGAGCAGAGGCCTAGCGG - Intronic
1085905243 11:80752564-80752586 CAGTATAAGCAAAGGCTCTGAGG + Intergenic
1086248670 11:84787374-84787396 CAGCATTTGCAAAGGCACAGAGG - Intronic
1086426445 11:86688540-86688562 CAGGCTGAGCTAAGACACAAAGG - Intergenic
1086436187 11:86783061-86783083 CTTTCAGAGCAAAGGCAGAGGGG + Intergenic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1088489724 11:110375207-110375229 CAGTCTGAGCCAATTCTCAGTGG - Intergenic
1088691959 11:112335956-112335978 CAATCTTAGCAAAGTCTCAGAGG - Intergenic
1088789242 11:113209936-113209958 CAGCCTGGGCACAGGCACAGAGG + Intronic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1089359942 11:117879089-117879111 CAGTATGTGCAAAGGCCCTGAGG + Intergenic
1089576130 11:119445445-119445467 CAGTCTCACCAAAGTCACGGAGG - Intergenic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089918658 11:122185388-122185410 CAGCCTGTGCAAAGGCCCAGTGG - Intergenic
1090246353 11:125218521-125218543 TAGGCTGAGCAAAAGCACGGAGG + Intronic
1090249465 11:125241294-125241316 CAGCATGTGCAAAGGCACCGAGG - Intronic
1090919233 11:131193523-131193545 GAGCCTGAGAAAAGGCACGGAGG - Intergenic
1091533255 12:1380528-1380550 CTGTCTTAGCTAAGGCAAAGGGG + Intronic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1091817184 12:3447440-3447462 CAGCATAAGCAAAGGCCCAGAGG - Intronic
1092004462 12:5057437-5057459 CAGCTTGAGCGAAGGCACAGAGG + Intergenic
1092006350 12:5073776-5073798 CAGGCTTGGCAAAGGCAGAGAGG + Intergenic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1093819123 12:23590446-23590468 CAGTCTGTGCAAGGACACATAGG - Intronic
1094070065 12:26403163-26403185 CAGGATGAGCAAAGGCAAACAGG + Intronic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1094675251 12:32613463-32613485 CAGTTTGAGGCCAGGCACAGTGG + Intronic
1094752069 12:33421884-33421906 CAGCATGAACAAAAGCACAGAGG + Intronic
1095840115 12:46683619-46683641 CAGTATGTCCAAAGGCACTGAGG - Intergenic
1095929377 12:47610359-47610381 CAGTGTGTGCATAGGCACTGAGG - Intergenic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096885976 12:54719694-54719716 CAGTCTCATCGAAGGCTCAGAGG - Intergenic
1097226453 12:57479298-57479320 CAGTATAAGTAAAGGCATAGAGG + Exonic
1097228348 12:57492954-57492976 CAGTATGCATAAAGGCACAGAGG - Intronic
1098352616 12:69580240-69580262 TAGCATGTGCAAAGGCACAGAGG + Intergenic
1099944847 12:89233011-89233033 CAGCTTGAATAAAGGCACAGAGG - Intergenic
1100394645 12:94174116-94174138 CAGTCTGAGCCCAAGCACATAGG - Intronic
1100487556 12:95044910-95044932 GAGGCTGAGCACAAGCACAGTGG + Intronic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1100790526 12:98125218-98125240 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1101529398 12:105560322-105560344 CAGCATGAGCAAAAGCTCAGAGG - Intergenic
1101559969 12:105847621-105847643 CTGCCTGAGCCAAGGCACAGAGG + Intergenic
1101695473 12:107121775-107121797 TAGCATGTGCAAAGGCACAGGGG + Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102242103 12:111331027-111331049 CAGCCTGAGCAAAGACATAGGGG + Intronic
1102281899 12:111625025-111625047 CAGCAGAAGCAAAGGCACAGAGG - Intergenic
1102439781 12:112953252-112953274 CATTCTGAGCAAACGAACACAGG - Intronic
1102514941 12:113440070-113440092 GAGCCTGAGCAAAGGAAAAGAGG - Intergenic
1102523839 12:113496792-113496814 CAGCCAGTGCAAAGGCCCAGAGG - Intergenic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1102906259 12:116677565-116677587 CAGACTAGGCAAAGGCACAGAGG - Intergenic
1102965732 12:117124169-117124191 CAGCCTGTGCAATGGCCCAGAGG + Intergenic
1103003916 12:117406814-117406836 CAGCATGTGCAAAGGTACAGAGG - Intronic
1103137366 12:118519191-118519213 CAGTATGGGTAAAGGTACAGAGG - Intergenic
1103219980 12:119235926-119235948 CAGCATATGCAAAGGCACAGAGG - Intergenic
1103441866 12:120969006-120969028 CAGCTTGCACAAAGGCACAGAGG + Intergenic
1103696621 12:122820901-122820923 CAGCATGAGTAAAAGCACAGAGG + Intronic
1103935862 12:124476165-124476187 CAGCCTGTGCAAAGGCCCGGGGG - Intronic
1103948607 12:124540339-124540361 CAGCCTGTGCAAAGGCCCAGGGG + Intronic
1103973042 12:124684002-124684024 CACTCTGCTCAAAGCCACAGTGG - Intergenic
1103994307 12:124819269-124819291 CAGCCTGTGCAAAGGCCCTGTGG + Intronic
1104167437 12:126247252-126247274 CTGCCTGTGCAAAGGCTCAGTGG + Intergenic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1104877962 12:132049679-132049701 CTGTCTGTGCAAGGTCACAGAGG - Intronic
1105738378 13:23295955-23295977 CAGTCAGTGCAAAAGCACAGAGG - Intronic
1105955106 13:25274673-25274695 CAGTGTGAGTAAAAGCCCAGAGG - Intronic
1106580892 13:31017310-31017332 CAGCATGTGCAAAAGCACAGAGG + Intergenic
1106702638 13:32246461-32246483 TAGCATGAGTAAAGGCACAGAGG + Intronic
1107288516 13:38824507-38824529 CAGTCTCACCAAAGGCTCATAGG + Intronic
1107349954 13:39503276-39503298 CAGTCAGTGCAAAGGCACAAAGG - Intronic
1108379016 13:49839294-49839316 CAGCTTGAGCAAAGGCTGAGAGG - Intergenic
1108442483 13:50469443-50469465 CAGTCTGAGATCAGGGACAGCGG - Intronic
1108726636 13:53190495-53190517 TAGCAAGAGCAAAGGCACAGTGG + Intergenic
1108846047 13:54679326-54679348 CAATCTCACCAAAGGCTCAGAGG - Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1110356590 13:74574573-74574595 CAGCATGAACAAAGGCACTGAGG - Intergenic
1112119326 13:96392648-96392670 CAGTCTGTGCAAAGCCCCTGTGG + Intronic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1114029632 14:18566736-18566758 CAGATTGAGCAAAGGCTCTGAGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114650540 14:24281748-24281770 CAGCTGGAGCAAAGGCGCAGAGG + Intergenic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1115064607 14:29242468-29242490 CATACAGAGAAAAGGCACAGTGG + Intergenic
1115457851 14:33625466-33625488 CAGGCTGATTAAAGACACAGAGG + Intronic
1115742468 14:36403100-36403122 CGGCATGTGCAAAGGCACAGAGG - Intergenic
1115763091 14:36595199-36595221 GAGTCTGAGCACAGGCATAGGGG + Intergenic
1115982191 14:39065643-39065665 CAGTGTGAGGAGAGGCATAGAGG - Intronic
1116788089 14:49309867-49309889 CAGACAGAGGAAAGGAACAGAGG + Intergenic
1117008602 14:51447508-51447530 CAGTCTGAGCAAAGGCCTAGAGG - Intergenic
1117113439 14:52483982-52484004 TGGCATGAGCAAAGGCACAGTGG + Intronic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118332547 14:64825340-64825362 CAGGCTGTTCAAAGGCACAAGGG - Intronic
1118363926 14:65078043-65078065 CAATATGAGAAAAAGCACAGGGG + Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1118719163 14:68581515-68581537 CAGTCTGAGGGAAGGCACAGAGG + Intronic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1118888785 14:69889451-69889473 CAGCCTCAGCATAGGCTCAGAGG + Intronic
1119476402 14:74932555-74932577 CAGTGTGAGCAAAGGTCCTGAGG + Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1119954747 14:78784866-78784888 CAGCCTGAGCAAAGTCACAGGGG + Intronic
1120726612 14:87949186-87949208 CAGTATGTGCAAAGTCACAGAGG + Intronic
1120994955 14:90410037-90410059 TTATCTGAGCCAAGGCACAGTGG - Intergenic
1121008778 14:90507670-90507692 TAGCCTGAGCAGAGGCACTGAGG - Intergenic
1121421786 14:93821081-93821103 CAGCCTGAGCCAAGGTGCAGGGG - Intergenic
1121598088 14:95181125-95181147 CAGCCAGTGCAAAGGCACTGAGG - Intergenic
1121630986 14:95421823-95421845 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
1121647140 14:95526160-95526182 CAACCAGGGCAAAGGCACAGAGG - Intergenic
1121654017 14:95581835-95581857 CAGTCTAAATAAAGACACAGAGG - Intergenic
1121692131 14:95885550-95885572 AAGTGTGAGCAGAAGCACAGAGG + Intergenic
1122025454 14:98872692-98872714 CAGGCTGTGCAAAGCAACAGAGG + Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122131753 14:99608091-99608113 CAGTACAAGCAAAGGCCCAGAGG + Intergenic
1122194225 14:100073157-100073179 GAGTGTCAGCAAAGGCAGAGTGG - Intronic
1122293975 14:100694574-100694596 CTGCCTGGGCAAAGGCACACGGG + Intergenic
1122466689 14:101938553-101938575 CAGCGTGTGCAAAGGCACTGGGG - Intergenic
1122489640 14:102105509-102105531 CCGTGTGTGCAAAGGCACAAAGG + Intronic
1122539863 14:102492138-102492160 CAGTCTGACGAAAAGCACATGGG - Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1123222213 14:106867608-106867630 CAGTGTGAACACAGACACAGAGG - Intergenic
1123739423 15:23221878-23221900 CAGAGTGAGAAAAGGCAAAGAGG - Intergenic
1124290643 15:28450830-28450852 CAGAGTGAGAAAAGGCAAAGAGG - Intergenic
1124292593 15:28466716-28466738 CAGAGTGAGAAAAGGCAAAGAGG + Intergenic
1124376847 15:29133938-29133960 CAGCCTGTGCAAAGGCTCAGAGG - Intronic
1124396067 15:29303020-29303042 CAGTCTGAGCAGACTCAAAGGGG + Intronic
1124491854 15:30163093-30163115 CAGCCTATGCAAAGGCCCAGAGG + Intergenic
1124599774 15:31124364-31124386 CAATCTGAGGCCAGGCACAGTGG + Intronic
1124751682 15:32375224-32375246 CAGCCTATGCAAAGGCCCAGAGG - Intergenic
1126848550 15:52784308-52784330 CAGCCTGACCCAGGGCACAGCGG - Intronic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127381024 15:58430601-58430623 CAGTCTGTGCAAAGGCCCTGAGG - Intronic
1127720969 15:61698948-61698970 CGGTGTAAGCCAAGGCACAGAGG + Intergenic
1127749067 15:62014973-62014995 GAGTCTGAGCAAAGATACAAAGG + Intronic
1127794490 15:62426418-62426440 CAGTCAGAACCAAGGCACTGAGG - Intronic
1127961732 15:63895338-63895360 CAGCTTGAGCAAAGACACAGAGG - Intergenic
1128025559 15:64433716-64433738 TAATGGGAGCAAAGGCACAGAGG + Intronic
1128054950 15:64692398-64692420 CCTTCTGAGCAAAGGAACTGGGG + Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128255847 15:66196032-66196054 CAGTATGTGCAAAGGCCCTGAGG + Intronic
1128368578 15:67022774-67022796 CAGTCAGTGCAAAGGCCCTGAGG + Intergenic
1128515670 15:68340406-68340428 CAGTTTGTGCAAAGGCTCTGAGG + Intronic
1128699431 15:69793619-69793641 CAGAGTGAGCAAAGGCACAGAGG - Intergenic
1128762382 15:70226163-70226185 CAGGATGAGCAAAGCCCCAGAGG + Intergenic
1128796400 15:70469784-70469806 CAGTGTGTGCAAAGGCACAAAGG + Intergenic
1128911857 15:71522911-71522933 CAGTCTGAACCACGGCAAAGGGG + Intronic
1128930699 15:71702687-71702709 CTGTCTGTGCAAAGGCCCCGTGG - Intronic
1129172334 15:73815878-73815900 CAGCATGTGCAAAGGCCCAGAGG - Intergenic
1129227468 15:74178516-74178538 CAGTATAAGCAAAGGTGCAGAGG - Intergenic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1129252294 15:74315722-74315744 CTGCGTGAGCAAAGGCACAGAGG + Intronic
1129435412 15:75535812-75535834 GACTCTGAGCAAAGACACACTGG + Intronic
1129556114 15:76511619-76511641 CAGTTTATGCAAAAGCACAGAGG - Intronic
1129605246 15:77021777-77021799 CAGCAGGAGCAAAGGCCCAGAGG - Intronic
1129705829 15:77793512-77793534 CAGCCTGAGCAAAGGTGCAGTGG - Intronic
1129851895 15:78798256-78798278 CAGAGTGAGCAAAGGCCCAGCGG - Intronic
1130112477 15:80977143-80977165 CAGTCTGAGCTAAGACCCTGTGG - Exonic
1130373638 15:83308857-83308879 CTTGCTGAGCAAAGGCACGGAGG - Intergenic
1130661873 15:85837306-85837328 CAGCCTGAGCAAACGAACACAGG - Intergenic
1130739867 15:86587560-86587582 CAGTATAAGCAAAGGCATAAAGG + Intronic
1130821635 15:87502227-87502249 CAGCCTGTGCAAAGGCATGGGGG - Intergenic
1131118730 15:89809905-89809927 CAGAATGAGCAAAGTCACAGAGG - Intronic
1131432760 15:92400042-92400064 CGGGATGTGCAAAGGCACAGAGG - Intronic
1132177014 15:99724056-99724078 CAGTGTGAGCGAAGGCCTAGAGG - Intronic
1132201062 15:99955134-99955156 CAGGCTGTGCAAGGGGACAGAGG - Intergenic
1133568980 16:7023083-7023105 CAGCCAGTGCAAAGGCACTGAGG + Intronic
1133770057 16:8862677-8862699 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1134041331 16:11070772-11070794 CAGTCAGAGCAAAGACTCTGAGG - Intronic
1134191229 16:12122552-12122574 CAGCCTGTGCCAAGACACAGAGG + Intronic
1134219342 16:12341388-12341410 AAGTCTGAGGAAAGGCACAGAGG - Intronic
1134289829 16:12895136-12895158 GAGTCTGAGCAGAGAGACAGGGG + Intergenic
1134667768 16:16031625-16031647 CAGTGTGTGCAAAGGCCCGGTGG - Intronic
1135404285 16:22186980-22187002 CAGCCTCAGCAAAAGCCCAGAGG - Intronic
1135830836 16:25771453-25771475 GAGTCTGTGCAAAGGCCCTGGGG - Intronic
1136033302 16:27519194-27519216 GGGTATGAGCAAAGGCACTGAGG + Intronic
1136069274 16:27778365-27778387 CAGCCTGGGCAAAGGCTGAGAGG + Intronic
1136495143 16:30638518-30638540 CATTCTGAGGCCAGGCACAGTGG + Intergenic
1136597302 16:31260182-31260204 CAGTCTGGGGAGAGGCAAAGGGG + Intronic
1136849297 16:33601119-33601141 GTGTCTGAGCACAGGAACAGAGG + Intergenic
1136922542 16:34344586-34344608 CAGCCTGGACAAAAGCACAGAGG - Intergenic
1136982031 16:35067220-35067242 CAGCCTGGACAAAAGCACAGAGG + Intergenic
1137066476 16:35850578-35850600 CAGCCTGACCAAAGCCACAGTGG - Intergenic
1137542926 16:49377296-49377318 CGGGGTGAGCAAAGGCCCAGAGG + Intronic
1137733336 16:50706152-50706174 CAGCCAGAGCCAAGGCCCAGAGG + Intronic
1137753065 16:50880741-50880763 CAGCCTGAGCAAGGGCCCTGGGG + Intergenic
1137820198 16:51436786-51436808 CAGTCCCTGCAAGGGCACAGGGG + Intergenic
1138136172 16:54524887-54524909 CAGCCTGAAGAGAGGCACAGAGG + Intergenic
1138315418 16:56065468-56065490 GACTCTAAGCAAAGGCACTGGGG - Intergenic
1138600188 16:58049447-58049469 CAGTGTAAGGAAAGGCATAGAGG - Intergenic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1138649714 16:58452770-58452792 GGGTCTGAACAAAGGCACTGTGG - Intergenic
1138679156 16:58672487-58672509 CAGTCAGTGCCAAGGCACTGAGG - Intronic
1138683232 16:58702123-58702145 CACTCTTGGCAAAGGCAAAGGGG - Intergenic
1138705270 16:58909033-58909055 CAATCTCATCAAAGGCTCAGAGG - Intergenic
1139428952 16:66900880-66900902 CTGTCTGGGCAAAGGCTCAGAGG - Intergenic
1139973362 16:70790294-70790316 GAGGCTGAACAAAGGCTCAGAGG + Intronic
1140245113 16:73241377-73241399 CACACTAACCAAAGGCACAGAGG + Intergenic
1140297570 16:73724466-73724488 AAGTCTCACCAAAGGAACAGTGG - Intergenic
1140351261 16:74263904-74263926 CAGCCCGAGCAACAGCACAGAGG + Intergenic
1140480922 16:75262507-75262529 CAGGCTGAGCCAAGGCCCAGCGG + Intronic
1140663362 16:77208593-77208615 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1140703055 16:77600412-77600434 AAGTCTCAGCAAAGACATAGAGG + Intergenic
1140712644 16:77692783-77692805 TAGTCTGTGCAAAGGCCCTGAGG - Intergenic
1140884239 16:79228926-79228948 CAGTCTGAGACAGGGCACGGTGG + Intergenic
1141884015 16:86879471-86879493 TAGTCTGTGCAAAGGCCCTGTGG - Intergenic
1142177507 16:88651802-88651824 CAGGCTGGGCAGAGCCACAGAGG - Intergenic
1142298447 16:89242351-89242373 CAGGCTGAGCATCAGCACAGAGG + Intergenic
1203111004 16_KI270728v1_random:1449769-1449791 GTGTCTGAGCACAGGAACAGAGG + Intergenic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1143777710 17:9210192-9210214 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1143917800 17:10306776-10306798 CAGTCTCAGCAGTGGCAAAGTGG - Intronic
1144507355 17:15843854-15843876 TAGAATGAGCAAAGGCACAGAGG + Intergenic
1144643219 17:16950812-16950834 CACTATGAGCAGAGGCTCAGAGG - Intronic
1145081891 17:19901074-19901096 CAGTGTGAGTAAAGGCCCTGAGG - Intergenic
1145119251 17:20241874-20241896 TAGAATGAGCAAAGGCACAGAGG + Intronic
1145171480 17:20661459-20661481 TAGAATGAGCAAAGGCACAGAGG + Intergenic
1145201801 17:20952203-20952225 TGGAATGAGCAAAGGCACAGAGG + Intergenic
1145750581 17:27352975-27352997 TAGTCTGTGCAAACACACAGAGG + Intergenic
1146173803 17:30652005-30652027 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146266199 17:31454559-31454581 CAGACTTAGGCAAGGCACAGTGG - Intronic
1146347259 17:32068026-32068048 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146442336 17:32908014-32908036 AAGCCTGAGCAAAGGCCCTGAGG + Intergenic
1146487369 17:33254296-33254318 CAGTATGAGGACAGGGACAGGGG - Intronic
1146606954 17:34268794-34268816 TAGCCTGAGCAAAGTCATAGGGG + Intergenic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146660233 17:34660701-34660723 TAGTGTAGGCAAAGGCACAGAGG + Intergenic
1146679027 17:34793689-34793711 CAGACTGGGCAAAGGCATGGAGG - Intergenic
1146938668 17:36828311-36828333 CAGCATAAGCAAAGGCACAGAGG + Intergenic
1146938769 17:36828985-36829007 CAGTGTGAGGCCAGGCACAGTGG + Intergenic
1147185013 17:38708458-38708480 AAGCCTGGGCAGAGGCACAGAGG + Intronic
1147424647 17:40340525-40340547 GAGTCTGTGCAAAGGCCCTGGGG - Intronic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147650768 17:42060602-42060624 CAGCCGGAGCAAAGGCATTGAGG - Intronic
1147678862 17:42226503-42226525 CATTCTTAGAAAATGCACAGAGG + Intronic
1148197701 17:45726572-45726594 CAGGCTGAGCAAGGCAACAGAGG + Intergenic
1149026953 17:52037776-52037798 CAGGATGACCAAAGGCACAGAGG - Intronic
1149270351 17:54970058-54970080 CAGGCCAAGCAAAGGCCCAGGGG + Intronic
1149446054 17:56714262-56714284 CAGTCTGGGCAAAGAGACATAGG + Intergenic
1149866416 17:60153690-60153712 GAGACTGAGCAAAGGCAGAGCGG + Intronic
1150303439 17:64064804-64064826 CAGCCTGAACAAAGGCCCCGGGG + Intronic
1150848180 17:68680186-68680208 CAGACAGTGCAAAGGCACTGAGG + Intergenic
1151039827 17:70845946-70845968 TAGTCTCAGCAAAGACATAGAGG + Intergenic
1151376299 17:73691242-73691264 TGGTCAGAGCAAAGGCAGAGAGG - Intergenic
1151893143 17:76963033-76963055 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1152562688 17:81086461-81086483 CAGACTGAGCAAAGGAGCAAAGG + Exonic
1152757275 17:82092288-82092310 AGGTCTGAGCAGAGGCACTGAGG - Intronic
1152794141 17:82298640-82298662 GGGGCTGAGCAAGGGCACAGAGG + Intergenic
1153640446 18:7152528-7152550 CAGACTGTTCCAAGGCACAGTGG - Intergenic
1154437532 18:14358131-14358153 CAGGCTGTGCTAAGGGACAGTGG - Intergenic
1155224086 18:23713272-23713294 CAGCACGAGCAAGGGCACAGGGG - Intronic
1155308206 18:24499276-24499298 CAGGCTGGGAAAAGGCACATGGG + Intergenic
1157381391 18:47221538-47221560 CAGCAGGGGCAAAGGCACAGAGG - Intronic
1157400070 18:47379819-47379841 CAGTGTGTGCAAAGGCCCAGAGG - Intergenic
1157454044 18:47810361-47810383 TAACCTGAGCAGAGGCACAGTGG - Exonic
1157556607 18:48616881-48616903 CAGTGTGAGCAAAAGCACAGAGG + Intronic
1157874492 18:51259878-51259900 AGGTCTGTGCAAAGGCACTGTGG - Intergenic
1157995306 18:52547736-52547758 CAGCATGAGCAAAGGAACAAAGG + Intronic
1159134564 18:64321969-64321991 CTGTCATAGCAAAAGCACAGGGG - Intergenic
1159390706 18:67788909-67788931 GAATCTTAGCAAAGGCAGAGTGG + Intergenic
1160630739 18:80245567-80245589 GAGGCTGAGCAAAGGCTCAGAGG + Intronic
1160751719 19:737588-737610 ACGTCTGAGCAAAGACCCAGAGG + Intronic
1160752038 19:738913-738935 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1161213311 19:3079702-3079724 CAGGCTGTGCAAAGGCCCTGGGG + Intergenic
1161258915 19:3324807-3324829 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161315503 19:3615448-3615470 CAGTGCGTGCAAAGGCCCAGAGG - Intronic
1161345426 19:3766791-3766813 CAGCCTGTGCAAAGGCCCCGGGG + Intronic
1161345973 19:3768891-3768913 CAGGCTGTGCAAAGGCCCTGGGG - Intergenic
1161416807 19:4151829-4151851 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1161433749 19:4249644-4249666 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161479926 19:4505366-4505388 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161483279 19:4521481-4521503 CAGCCTCAGCAAAGGCCCGGAGG + Intergenic
1161506350 19:4645931-4645953 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1161522252 19:4731111-4731133 CAGCCTGTGCAAAGGCCCTGCGG - Intergenic
1161533840 19:4806583-4806605 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161544223 19:4870204-4870226 CAGTCCGTGCAAAGGCCCTGAGG + Intergenic
1161625383 19:5323568-5323590 CAGACTGTGCAAAGGCCCTGGGG + Intronic
1161634202 19:5377102-5377124 CAGTCTGTGCAAAGGCCCTGAGG + Intergenic
1161635308 19:5384970-5384992 CAGCCAGAGCAAAGGCCCTGCGG - Intergenic
1161650343 19:5480478-5480500 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161658828 19:5533442-5533464 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161664236 19:5565220-5565242 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1161868855 19:6854911-6854933 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
1162156367 19:8680856-8680878 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1162400655 19:10444631-10444653 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162449805 19:10747949-10747971 CAGCCTGGGCAAAGGCCCTGGGG + Intronic
1162528969 19:11224614-11224636 CAGTCAGTGCAAAGGCCCTGAGG + Intronic
1162613631 19:11777095-11777117 CACTCTGAGGCCAGGCACAGTGG - Intronic
1162766520 19:12923097-12923119 CAGTCAGTTCAAAGGCCCAGAGG - Intronic
1162829986 19:13278359-13278381 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1162850981 19:13430950-13430972 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162988613 19:14288035-14288057 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1163015091 19:14450035-14450057 CAGTCTGAGCAATGACACACAGG - Intronic
1163570002 19:18075719-18075741 CACTCTGAGTACAGGAACAGGGG - Intronic
1163684221 19:18701491-18701513 TATTCTGGGCCAAGGCACAGAGG - Intronic
1163770179 19:19186274-19186296 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1164569911 19:29366324-29366346 CAGCATGAGCAAGGGGACAGAGG - Intergenic
1164589008 19:29495956-29495978 GAGTTTGAGCAATGGCACAGGGG + Intergenic
1165323891 19:35102872-35102894 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1165940958 19:39414514-39414536 CAGCATGTGCAAAGGCCCAGCGG + Intronic
1166138411 19:40791529-40791551 CAGCATGAGCAAGGGCCCAGAGG - Intronic
1166314277 19:41980081-41980103 CAGCCTGTGCAAAGGCCCAGAGG - Intronic
1166511242 19:43410354-43410376 CAGTGTGAGCAAAGCCAAAGAGG + Intronic
1166537880 19:43586628-43586650 CACTCCGAGCAAAGGCATGGGGG + Exonic
1166599317 19:44080160-44080182 CAGTGTGATCATAGGCACACTGG + Intronic
1166617232 19:44261086-44261108 CAGGCTGAGCTCAGGCAGAGTGG + Intronic
1166740389 19:45111193-45111215 CAGCATGTGCAAAGGCTCAGAGG - Intronic
1167004461 19:46766649-46766671 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167026645 19:46924429-46924451 CAGTGTGAGAAAGGGCAGAGTGG + Intronic
1167218884 19:48184287-48184309 CAGCCAGTGCAAAGGCCCAGAGG + Intronic
1167562226 19:50232784-50232806 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167615822 19:50532518-50532540 GAGCCTGTGCAAAGGCAGAGAGG - Intronic
1168188026 19:54713715-54713737 GAGTCTGAGGCCAGGCACAGTGG + Intergenic
1168251460 19:55144659-55144681 CAGTGTGTGCAAAGGCTCAGGGG + Intronic
1168263783 19:55209974-55209996 CAGTCTAGGCAAAGGCCAAGAGG - Intergenic
1168264632 19:55215778-55215800 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1168517375 19:57018777-57018799 CAATATGTGCAAAGGCCCAGAGG - Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925118109 2:1397581-1397603 GAGTCTGAGGAAAAGCACAGAGG + Intronic
925210965 2:2045732-2045754 CCAGCTGAGCAAAGGCACTGAGG - Intronic
925886970 2:8401698-8401720 CAGTCCCAGCATAGGCACACAGG + Intergenic
926225823 2:10966281-10966303 CAGGCTGAGCAGAGACACATGGG - Intergenic
926268926 2:11350363-11350385 CAGCACCAGCAAAGGCACAGAGG - Intergenic
926679388 2:15652390-15652412 CCATCTGAGCCGAGGCACAGAGG - Intergenic
927068078 2:19493791-19493813 AAGTCTGTGCAAAGGCCCAGAGG + Intergenic
927212023 2:20644938-20644960 CATCCTAAGCAAAGGCACGGAGG - Intronic
927241122 2:20920246-20920268 CAGTGGGAACAAAGGCATAGAGG + Intergenic
927678232 2:25122586-25122608 CAGACTGTGCAAAGGCCCTGAGG - Intronic
927689212 2:25195801-25195823 CAGGCTGTGCAAAGGCCCAGAGG - Intergenic
927895174 2:26776851-26776873 CAAACAGAGCAAAGGCACAGGGG + Intronic
928057084 2:28067536-28067558 AAGTTTGAGGAAAGGCCCAGAGG + Intronic
928062867 2:28132574-28132596 CAGCTTTAGCAAAAGCACAGAGG - Intronic
928666242 2:33553186-33553208 TTGTGTGAGCAAAGGCACTGAGG - Intronic
929579778 2:43074520-43074542 TAGCCTAAGCAAAGGCAGAGAGG + Intergenic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
929870010 2:45751104-45751126 GAGTATAAGCAAAGGCACAGAGG - Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929929079 2:46238237-46238259 CAGCCTGAGCAAAGGTGCAGAGG - Intergenic
929982709 2:46696907-46696929 TATTCTGAGCTAAGGCACTGTGG + Intergenic
930104025 2:47626214-47626236 CAGTGTAAGCAAAGGCTCAGAGG + Intergenic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930156746 2:48113731-48113753 CAGTCTGAGCCCAGGCTCTGGGG + Intergenic
930233015 2:48861600-48861622 GAGCATGAGCAAAGGCACAACGG - Intergenic
930625956 2:53697879-53697901 AAGTCTGAGCAAAGCCATAGGGG - Intronic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
930840553 2:55840488-55840510 TAGTTTGAGCAAAGGCACAGTGG + Intergenic
931273053 2:60719595-60719617 CAGCCTGAACAAAGGCACAGAGG + Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931384588 2:61786626-61786648 CCATCTGAGCAAAGGCATGGAGG + Intergenic
931667910 2:64623443-64623465 CAGTGTGTGCAAAGGCCAAGAGG + Intergenic
932195516 2:69779868-69779890 CACCCTGAGCAAAGGTACAGAGG - Intronic
933047115 2:77553177-77553199 AAGTCTGAGGAAAGAAACAGTGG + Intronic
933666177 2:84967054-84967076 GAGTATGCACAAAGGCACAGGGG + Intergenic
933716777 2:85367399-85367421 CAGTCTGTGAAAAGGCACCAAGG + Intronic
935199045 2:100840077-100840099 CAGTATGAGCAAAGGCCCCGGGG - Intronic
935277310 2:101486065-101486087 CAGCTTGTGCAAAGGCACTGAGG - Intergenic
935351927 2:102158546-102158568 CAGCATGTGCAAAGGCCCAGAGG + Intronic
935464477 2:103380344-103380366 CAGTCTCAGCCAGGGCCCAGGGG - Intergenic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
935688337 2:105706893-105706915 CAGCCTGGGCAAAGGCACTGGGG - Intergenic
935921828 2:108023885-108023907 TAATATGAGCAAAGGTACAGGGG - Intergenic
936387879 2:112046620-112046642 CAGTGTGAGCAAAGCAGCAGTGG - Intergenic
937232586 2:120406755-120406777 CAGCTTGGGCAAAGGCTCAGAGG + Intergenic
937583951 2:123523768-123523790 CAGTCTCCTCAAAGGCTCAGTGG + Intergenic
938080472 2:128367391-128367413 AAGGCTGAGCAAAGGCAGTGGGG + Intergenic
939042590 2:137208613-137208635 CAGTCTCCTCAAAGGCTCAGAGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939414890 2:141882963-141882985 CAGTCTCACCAAAGGCATTGCGG + Intronic
939876836 2:147587204-147587226 CAGCCTGAACAAAGGTTCAGAGG - Intergenic
940033199 2:149286573-149286595 CACTGTGAACAAAGGCAAAGAGG + Intergenic
941492176 2:166155823-166155845 CAGCCTGAGCATATTCACAGAGG - Intergenic
942079381 2:172385765-172385787 GACACAGAGCAAAGGCACAGGGG - Intergenic
942832244 2:180250961-180250983 GAGTCTGTGCAGAGGCACAAAGG - Intergenic
943376517 2:187084300-187084322 CAGCTTAAGCAAAGGCAAAGAGG + Intergenic
943614735 2:190080405-190080427 CTGTCAGTGCAAAAGCACAGAGG + Intronic
943721987 2:191214348-191214370 TAGAATGTGCAAAGGCACAGAGG + Intergenic
944200606 2:197103473-197103495 CAGCCTGAACAAATTCACAGAGG + Intronic
944283131 2:197921677-197921699 CGGTGTGATCAAAGGTACAGAGG - Intronic
944897396 2:204178774-204178796 CAGCATGTGCAAAGGCCCAGAGG + Intergenic
944968901 2:204968591-204968613 CAGTATCTGCAAAGGCACAGAGG - Intronic
945143760 2:206715061-206715083 CAGACTGGGCAAAGGCATGGAGG + Intronic
946104336 2:217355993-217356015 CAGCCTGAGCTAAGGCACTGTGG + Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946239781 2:218346440-218346462 CAGCATGAGCGAAGGCACAGAGG - Exonic
946370924 2:219280782-219280804 CAGGCTGGAAAAAGGCACAGAGG - Intronic
948644456 2:239395106-239395128 CAGTGTGTGCAAAGGCCCCGAGG + Intronic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1168876378 20:1174851-1174873 CAGCATGAGCAGAGGCTCAGAGG - Intronic
1168968519 20:1914746-1914768 CAGCCTGGGCAAAGACTCAGAGG - Intronic
1169263593 20:4154648-4154670 CAGTCTCAGGCCAGGCACAGTGG - Intronic
1169368669 20:5011593-5011615 GTGACTAAGCAAAGGCACAGGGG + Intergenic
1169489001 20:6055767-6055789 CTGTCCGTGCAAAGGCAAAGAGG - Intergenic
1169928204 20:10804941-10804963 CAGTCTGACGAAAGGCCCATAGG + Intergenic
1170092873 20:12611201-12611223 CAGTCTCAGAAAAGGTACATTGG - Intergenic
1170370926 20:15647310-15647332 CAGCCTGGGCAAAAGCACAGGGG + Intronic
1170509326 20:17060441-17060463 CAGTATGTGCAAATGCACAGAGG + Intergenic
1170611020 20:17913439-17913461 GAGTCAGAGCACAGGCAAAGGGG + Intergenic
1170943037 20:20864969-20864991 CAGGCTGAGCTAAGGAACATTGG - Intergenic
1171170859 20:23014296-23014318 CAGTGTGTGCAAAGGCCCTGGGG + Intergenic
1171250851 20:23645908-23645930 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1172040663 20:32042519-32042541 GCGTGGGAGCAAAGGCACAGAGG - Intergenic
1172097982 20:32469924-32469946 GAGTCTGGACAAAGGCACTGAGG - Intronic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172699035 20:36841540-36841562 CAGTGTGTGCCAAGGCTCAGAGG + Intronic
1172754320 20:37272736-37272758 CAGCCTGAGCAAAGGCTTGGAGG + Intergenic
1172774078 20:37397200-37397222 CAGCCAGAGCAAAGGCTCTGAGG - Intronic
1172776036 20:37407596-37407618 CAGCCTGGGCAAAGGCATGGAGG - Intergenic
1172805555 20:37609278-37609300 CAGCCTAAGCAAAGTCAGAGAGG - Intergenic
1172821493 20:37738831-37738853 GAGCATGAACAAAGGCACAGAGG + Intronic
1172834125 20:37861963-37861985 CAGTGTGAGTGAAGGCATAGGGG + Intronic
1172956987 20:38767925-38767947 TAGCATGAGCAAGGGCACAGGGG + Intronic
1173330049 20:42068243-42068265 CTGTCTGAGGAAAGGCACCATGG + Intergenic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173496732 20:43524778-43524800 CAACCTATGCAAAGGCACAGAGG + Intronic
1173620205 20:44430553-44430575 CAGCCTGAGCCAAGGCCTAGTGG + Exonic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1173966416 20:47115935-47115957 CAGTGTGTGCAAAGGCCCTGTGG - Intronic
1174220972 20:48955248-48955270 CAGTAAGTGCAAAGGCACTGAGG - Intronic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1174277223 20:49412990-49413012 CGGTAAGAGCAAAGGCAAAGGGG + Intronic
1174447969 20:50602915-50602937 CAGTCAGTGCAAAGGCCCTGAGG - Intronic
1174457722 20:50661588-50661610 CATTCTGAGGAGAGGCAAAGAGG + Intronic
1174503173 20:51000312-51000334 CAGACAGTGCAAAGGCCCAGAGG - Intergenic
1174532535 20:51225453-51225475 CAGTGTGGGGGAAGGCACAGTGG - Intergenic
1174582394 20:51581185-51581207 CAGCAGGACCAAAGGCACAGAGG - Intergenic
1174583906 20:51592761-51592783 CAGTGTGTGCAAAGGCCCCGGGG - Intergenic
1176025095 20:62981717-62981739 CAGTATGGGCAAAGGCCCGGTGG + Intergenic
1177451757 21:21277533-21277555 CAGTTTGGGCAAATGCACAATGG + Intronic
1178425310 21:32474368-32474390 CAGCTTGTGCAAAGGCCCAGGGG - Intronic
1180453748 22:15493786-15493808 CAGATTGAGCAAAGGCTCTGAGG + Intergenic
1180624865 22:17187575-17187597 TAGGCTGGGCACAGGCACAGTGG - Intronic
1180746148 22:18090407-18090429 CAGTGCGAGCCAAGGCACAGAGG - Exonic
1180978768 22:19868829-19868851 CAGCATGGGCAAAGGCACAGAGG + Intergenic
1181566607 22:23742616-23742638 CAGTCCGTGGAAATGCACAGGGG + Exonic
1181604005 22:23969108-23969130 TTGTCTGAGCAAAGGGAGAGTGG - Intronic
1181604508 22:23972198-23972220 TTGTCTGAGCAAAGGGAGAGTGG + Exonic
1181991586 22:26841103-26841125 CAGCCTGGGCAAAGGCCCGGAGG + Intergenic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182649588 22:31840322-31840344 CAGTTTGTGCAAAGGCTCTGTGG + Intronic
1183180048 22:36253819-36253841 AAGTCTGAACAGAGGGACAGAGG - Exonic
1183334868 22:37240843-37240865 CAGCTTGAGCAAAGGCCCTGGGG + Intronic
1183400720 22:37602429-37602451 GAGGCTGGGCACAGGCACAGGGG - Intergenic
1183515363 22:38262447-38262469 CTATATGAGCAAAGGCACGGAGG + Intronic
1183519335 22:38287454-38287476 CAGCATGTGCAAAGGCCCAGAGG - Intergenic
1183756814 22:39774911-39774933 CAGCATGAGCAAAAACACAGAGG - Intronic
1184034609 22:41912550-41912572 GAGTTTGTGCAAAGGCCCAGAGG - Intronic
1184089691 22:42285799-42285821 CAGCATGTGCAAAGGCCCAGAGG - Intronic
1184275850 22:43409358-43409380 CAGCCTGTGCAAAGGCTCAGAGG - Intergenic
1184407513 22:44308455-44308477 CAGCATGAGTAAAGGCCCAGAGG - Intronic
1185379839 22:50503291-50503313 CAGGGTCAGCTAAGGCACAGTGG + Exonic
949133206 3:530553-530575 CAGTCTGATCCCTGGCACAGAGG + Intergenic
949216390 3:1574201-1574223 CAGTATATGCAAAGGCACAAAGG - Intergenic
949529043 3:4935534-4935556 CAGCAGGAGCAAAGGCCCAGAGG - Intergenic
949537865 3:5009795-5009817 TGTTCTCAGCAAAGGCACAGTGG - Intergenic
949610961 3:5702931-5702953 CAGTCTGAGGAGAGTCACAAGGG + Intergenic
950146996 3:10657252-10657274 CGGCATGTGCAAAGGCACAGGGG - Intronic
950199979 3:11035901-11035923 CAGCTTGTGCAAAGGCCCAGCGG + Intronic
950205322 3:11075790-11075812 GAGCATGTGCAAAGGCACAGAGG - Intergenic
950280854 3:11706775-11706797 CAGTCTGAGAAAAGGCACAGGGG + Intronic
950387547 3:12672096-12672118 CAGTATGGGCAAAGGCATAGAGG + Intergenic
950434846 3:12973284-12973306 CAGGATAAGCAAAGGCACTGGGG - Intronic
950482215 3:13251123-13251145 CAGCCAGTGCAAAGGCCCAGAGG - Intergenic
950626466 3:14251120-14251142 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
950659840 3:14460507-14460529 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
951866578 3:27315309-27315331 CAGACTGGGAAAAGGCACAGGGG + Intronic
952035533 3:29196230-29196252 CAGTCTCAGGTAAGCCACAGTGG - Intergenic
952880358 3:37981917-37981939 TATTCTGAGCATAGGCACAGTGG - Exonic
953096379 3:39780616-39780638 CAGTGTGAGCACAGACACAGTGG + Intergenic
953293161 3:41686928-41686950 CATTCTGAGGCTAGGCACAGTGG + Intronic
953386434 3:42508850-42508872 CAGTGTGATCACAGGCACACAGG - Intronic
953515392 3:43586116-43586138 CATTCTGAGCAAGGGGACTGTGG - Intronic
953614965 3:44481853-44481875 AAGTCTGAGGCCAGGCACAGTGG + Intergenic
953714471 3:45306055-45306077 CAGTATGTGAAAAGGCACTGAGG - Intergenic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954385703 3:50242764-50242786 CAGTCTGAGCAAAGGCCTAAAGG + Intronic
954838460 3:53491880-53491902 GGGTAAGAGCAAAGGCACAGGGG - Intergenic
955056602 3:55460812-55460834 CAGCTTGAGCAAAGGCCAAGAGG - Intergenic
955662355 3:61314804-61314826 CAGCATGTGCAAAGGCTCAGTGG - Intergenic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
957825354 3:85435282-85435304 CATTCTCAGCAAAGTAACAGAGG - Intronic
957894978 3:86410653-86410675 CAATGGGAACAAAGGCACAGGGG - Intergenic
957932719 3:86902955-86902977 CAATTTGAGAAAAGGCACAAAGG + Intergenic
959542784 3:107559012-107559034 TAGCCTGAGAAAAGGCATAGTGG + Intronic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
959837442 3:110936701-110936723 AAGAATGTGCAAAGGCACAGAGG + Intergenic
960529639 3:118748601-118748623 TACCATGAGCAAAGGCACAGAGG - Intergenic
960611148 3:119555883-119555905 CAGCCTGGACAAAGGCACAAAGG - Intronic
960996367 3:123343036-123343058 CATTGTGATAAAAGGCACAGAGG - Intronic
961107532 3:124254902-124254924 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
961122069 3:124381260-124381282 GAATATGTGCAAAGGCACAGAGG + Intronic
961181804 3:124883777-124883799 CTGTCTTAGCAAAGGCAGCGTGG + Intronic
961381013 3:126496567-126496589 CAGTCAGTGCAAAGGCCCTGAGG + Intronic
961567515 3:127774208-127774230 CAGTCAGTGCAAAGGCCCGGGGG - Intronic
962052073 3:131826742-131826764 CAGTCTCAGGTCAGGCACAGTGG + Intronic
962120626 3:132556634-132556656 CAGTCTGAACCACGGCCCAGAGG + Intergenic
962207268 3:133445250-133445272 CAGCAGGTGCAAAGGCACAGAGG + Intronic
962580701 3:136795359-136795381 CAGCTTGAGCAAAGGCCGAGAGG + Intergenic
962665367 3:137648927-137648949 CAGTTTGAGCAAAGGTACACAGG - Intergenic
963068457 3:141282245-141282267 CAGTTTGTGCAAAGGCCCTGAGG - Intronic
963297550 3:143562385-143562407 CAGTAAGAGCAAAGGGAGAGAGG + Intronic
963464417 3:145660687-145660709 CAGCATGTGCAAATGCACAGAGG - Intergenic
963580366 3:147118898-147118920 CAGTCTCACTAAAGTCACAGTGG + Intergenic
964432053 3:156617582-156617604 CAGTTAGAGCAAAGGCTCTGTGG + Intergenic
964434074 3:156634033-156634055 CAGCAGGAGCAAAGACACAGAGG + Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
966125572 3:176572418-176572440 CAGGCTGAGGCCAGGCACAGTGG + Intergenic
966699059 3:182824840-182824862 AAATCAAAGCAAAGGCACAGTGG - Intronic
967074959 3:185993671-185993693 CAGTCCGTGCAAAGGCTCACAGG - Intergenic
967075158 3:185995217-185995239 CAGTGTAAACAAAGGCATAGAGG + Intergenic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
967830303 3:193912875-193912897 AAGTCTGAGCAGAGGCTCAAAGG - Intergenic
967889991 3:194358129-194358151 CAGCCTGTGCAAAGGCCCCGTGG - Exonic
968057625 3:195704771-195704793 GAGCTTGAGCAAAGGCTCAGAGG + Intergenic
968382584 4:108642-108664 CAACATGTGCAAAGGCACAGGGG + Intergenic
968403341 4:317248-317270 CAGCATGTGCAAAAGCACAGCGG - Intergenic
969061225 4:4436869-4436891 CAGCATGAGCAAATGCTCAGAGG - Intronic
969228589 4:5814716-5814738 CATCATGAGCAAAGGCCCAGTGG - Intronic
969463487 4:7341262-7341284 CAGCATGTGCAAAGGCCCAGGGG - Intronic
969662245 4:8537077-8537099 CAGCCTGAGCAAAGGCTGAGAGG + Intergenic
969687137 4:8681945-8681967 CAGGCTGAGCAGAGCCAGAGTGG - Intergenic
969701038 4:8767959-8767981 CAGCCGCTGCAAAGGCACAGAGG - Intergenic
969919323 4:10522930-10522952 CAGCATGTGCAAAGGCCCAGAGG + Intronic
970321716 4:14881397-14881419 CAGCCTGGGAAAAGGCTCAGAGG + Intergenic
970422483 4:15918517-15918539 CAGCATGAGCAAGGGCTCAGAGG - Intergenic
970538325 4:17052720-17052742 CAGCATGTGCAAAGGCCCAGGGG + Intergenic
970586136 4:17516084-17516106 TAGTCTGAGAAAATGCAAAGGGG + Intronic
970828439 4:20306697-20306719 CAGTCCAGGCAAAGGCACAGAGG - Intronic
971036909 4:22703709-22703731 CAGCATGTGCAAAGGTACAGAGG - Intergenic
971225942 4:24751695-24751717 CTGTCTGTGCAAAGGCCCTGAGG - Intergenic
971873604 4:32275706-32275728 CAGTTGGAGCAAAGTGACAGAGG - Intergenic
972282176 4:37612969-37612991 CAGTCTGAGCTTATGCTCAGGGG - Exonic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972302027 4:37793406-37793428 CAGTCTTCCCAAAGGCACAGAGG + Intergenic
972633245 4:40859849-40859871 CAGTCAGTGCAAAGGCTCTGAGG - Intronic
973855397 4:55006067-55006089 CAGCCTGAGCAAAGGCCCTGAGG + Intergenic
975496861 4:75045173-75045195 CAGTCAGTGCAAAGGCCCTGAGG + Intronic
975695778 4:77011479-77011501 CAGCGTGAGCAAAGACACAGAGG + Intronic
975877972 4:78867016-78867038 CAGCCTGAGCAATGGCATGGTGG + Intronic
976830745 4:89310761-89310783 CAGTCTGAGAAATGAAACAGAGG - Intergenic
976849096 4:89524586-89524608 ATGTCTGAGGCAAGGCACAGTGG - Intergenic
978063751 4:104370700-104370722 CATACTGATCAAAAGCACAGAGG + Intergenic
978065358 4:104392438-104392460 TAATATGAGCAAAAGCACAGAGG + Intergenic
978210206 4:106126077-106126099 CAACATGTGCAAAGGCACAGTGG - Intronic
978757799 4:112323060-112323082 CAGCAAGAGCAAAGACACAGAGG - Intronic
979720711 4:123896880-123896902 CAGCATGTCCAAAGGCACAGAGG + Intergenic
980098787 4:128520643-128520665 ATGTGTGTGCAAAGGCACAGAGG + Intergenic
980159419 4:129141376-129141398 CAGAATGAACAAAGGCACAGAGG + Intergenic
980758640 4:137199000-137199022 CAGGCTGTCCACAGGCACAGTGG + Intergenic
980796421 4:137690004-137690026 TAGCATGTGCAAAGGCACAGAGG + Intergenic
980905430 4:138944081-138944103 CAGTAAGAGCAAAGGCACAGAGG + Intergenic
981022844 4:140047162-140047184 CCGCCTAAGCAAAGACACAGGGG + Intronic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
981934733 4:150227546-150227568 CAGTCTGAGCAAAGGCCCAGAGG + Intronic
982091224 4:151881590-151881612 CAGTCAGTGCAAAGGCCCTGAGG + Intergenic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
983643475 4:169965943-169965965 TCCTCTGAGCAAAGACACAGAGG + Intergenic
983899822 4:173122094-173122116 CAGTGTGTGCAAAGGCACAGAGG - Intergenic
984420232 4:179511887-179511909 CAGTCTGAGCTAGGGAATAGAGG + Intergenic
984823288 4:183903320-183903342 CAGTCTGTGCAAAGGCCCTGGGG - Intronic
984843727 4:184092415-184092437 CACTCTGGGCAGAGGCACAGTGG - Intronic
985881351 5:2641167-2641189 CAGTGTGGGCCAAGGCACACGGG + Intergenic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
986979804 5:13434323-13434345 CAGTCTTTGGAAAGGCACAGAGG + Intergenic
987555232 5:19437739-19437761 TACCATGAGCAAAGGCACAGAGG - Intergenic
987857393 5:23438382-23438404 CAGTCTCCTCAAAGGCTCAGAGG - Intergenic
989664912 5:43842672-43842694 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
990363777 5:55048406-55048428 CAGCATGAACAAAGCCACAGAGG + Intergenic
990527090 5:56638747-56638769 CAGTGCGAGGAATGGCACAGAGG - Intergenic
991406479 5:66305406-66305428 CAGCATGTGCAAGGGCACAGAGG + Intergenic
991609993 5:68440155-68440177 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
992005508 5:72473563-72473585 CAGTCTAAACAAAGGCAACGAGG - Intronic
992371764 5:76151215-76151237 CAAACTGAGCAAAGGCACAAAGG + Intronic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992879167 5:81088137-81088159 CAGTCTGTGCAGAGGAATAGAGG - Intronic
992887963 5:81177843-81177865 CAGTATGTGCAAAGGCCCTGGGG + Intronic
993064673 5:83082958-83082980 CAGTCAGTGCAAAGGCCCTGTGG - Intronic
994059236 5:95455786-95455808 CAGCCTGAGCAAAGGCCTGGAGG + Intergenic
995816252 5:116171704-116171726 CATTCTGAGCAAAGTAACACAGG + Intronic
995912662 5:117206069-117206091 CAGTCAGAGTAATGGCATAGTGG + Intergenic
997002257 5:129775560-129775582 TAGTATAATCAAAGGCACAGAGG + Intergenic
997196866 5:131986106-131986128 CAGCCTGGGCACAGGCACAGAGG + Intronic
997369365 5:133348312-133348334 GAGTCTAAGCAGAGGCACTGGGG + Intronic
997404247 5:133631874-133631896 CATTCTCAGCAAAGTAACAGAGG + Intergenic
997698617 5:135880766-135880788 CAGCCTGAGCAAAGACCTAGGGG - Intronic
997749831 5:136333329-136333351 CAGCGTAAGTAAAGGCACAGAGG + Intronic
997755852 5:136398834-136398856 CAGGCTGAGCAAATACTCAGAGG + Intergenic
997767342 5:136518305-136518327 CAGTGTTGGCAAAGGCTCAGTGG - Intergenic
998384127 5:141746573-141746595 CAGTTTGTGCAAAGGCCCTGTGG + Intergenic
998522739 5:142815661-142815683 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
998778979 5:145635003-145635025 CAGTGTGAACAAAGACTCAGAGG - Intronic
999641010 5:153673169-153673191 CATTCTGAGCAAAGGCCCAGAGG - Intronic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1000149922 5:158489914-158489936 CAGTATGTGCAAAGGCCTAGAGG + Intergenic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1000289956 5:159860963-159860985 CAGTCTGAGCCAAAGCCCAGGGG - Intergenic
1000847942 5:166304806-166304828 CAGTCACCGCAAAGGCTCAGAGG + Intergenic
1001138589 5:169123775-169123797 CAGTCAGAGCAAAGGCAGACTGG + Intronic
1001200421 5:169711054-169711076 CAGGCAGAGCAAAGGAACTGAGG - Intronic
1001288021 5:170437823-170437845 AAGGCTGTGCAAAGGCCCAGAGG - Intronic
1001298460 5:170515961-170515983 CAGGATAAGCAAAGTCACAGAGG + Intronic
1001315325 5:170637590-170637612 CAGCCTGAGCAAAGGCCTTGAGG - Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001641375 5:173246313-173246335 CAGTCACAGCAAAGGCCCTGTGG + Intergenic
1001689831 5:173624778-173624800 GAGTTTGAGCAAAAGCTCAGAGG + Intergenic
1001747313 5:174101500-174101522 CAGAATGAGGAAATGCACAGAGG - Intronic
1001966578 5:175914020-175914042 CTGCATGGGCAAAGGCACAGAGG - Intergenic
1002062156 5:176631563-176631585 CAGCATGGGCAAAGGCACTGTGG + Intronic
1002174733 5:177395398-177395420 CAGTATGTGCAAAGGCTCAGAGG + Intronic
1002250369 5:177925184-177925206 CTGCATGGGCAAAGGCACAGAGG + Intergenic
1002329397 5:178431076-178431098 CGGTGTGAGCAAAGACATAGAGG + Intronic
1002439166 5:179255486-179255508 CAGTCTGCTCACAGGCACAAAGG - Intronic
1002521969 5:179797124-179797146 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1004063825 6:12223572-12223594 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1004366049 6:15013606-15013628 CAGTATGGGCAAAGGCAGAGAGG - Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1004484333 6:16051645-16051667 AAATGTGAGAAAAGGCACAGCGG - Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1005243767 6:23858655-23858677 AAGTATGTGCAAAGGCACAGAGG - Intergenic
1005269601 6:24148989-24149011 CATTGTGAGTGAAGGCACAGGGG - Intronic
1005319337 6:24637155-24637177 CAGTCAAAGCAAAAGCAGAGTGG + Intronic
1005372898 6:25153693-25153715 CAGGCTGAGAAAAGGGGCAGAGG + Intergenic
1006277499 6:33017353-33017375 TGGCCTGGGCAAAGGCACAGAGG + Intergenic
1006523606 6:34586459-34586481 CAACCTGAGCTGAGGCACAGAGG + Intergenic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006669046 6:35718221-35718243 CAACTCGAGCAAAGGCACAGAGG + Intronic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006904290 6:37522651-37522673 CAGCTTGAGTCAAGGCACAGAGG + Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1006923302 6:37640238-37640260 TAGGCTGAGCAAAAGCCCAGAGG + Intronic
1007353753 6:41294813-41294835 CAGTGTGAACACAGGCACACAGG + Intergenic
1007738026 6:43994102-43994124 CTGTCTGAGGAAAGGAGCAGGGG - Intergenic
1007894993 6:45345930-45345952 CAGCATGATCAAAGACACAGAGG - Intronic
1008496031 6:52135420-52135442 CAGCTTGAGCAAAGACATAGTGG - Intergenic
1009427481 6:63530322-63530344 CAGCCTGAGAAAAAGCACAAAGG + Intronic
1009878567 6:69537005-69537027 CAGCCTGAGCAAACGAATAGAGG - Intergenic
1010148799 6:72705056-72705078 TAGATTGAGCAAAGGCAGAGAGG - Intronic
1010350142 6:74863816-74863838 CAGTAAGAGAAAAGACACAGTGG + Intergenic
1010762123 6:79735420-79735442 CAGCCTATGCAAAGGCACAGAGG - Intergenic
1011007554 6:82664006-82664028 CAGTATGAGCTGAGGCCCAGAGG - Intergenic
1011085073 6:83530842-83530864 TAGGCTGAGCAAAAGCCCAGAGG - Intergenic
1011474028 6:87735082-87735104 CAGTCTGGGGCCAGGCACAGTGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1011656429 6:89556027-89556049 CACTCTGACAAGAGGCACAGAGG + Intronic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1012313407 6:97756080-97756102 GACTCTGCTCAAAGGCACAGTGG - Intergenic
1012840836 6:104326989-104327011 CAGTAAGAGCAAAGGCCCTGAGG - Intergenic
1013085690 6:106855091-106855113 CAGTGTGATCAAAGGAGCAGAGG + Intergenic
1013123468 6:107160721-107160743 CTGTTTGAGCAAAGGCACAAAGG + Intronic
1013521718 6:110939544-110939566 CAGCATTAGCAAAGGCCCAGTGG + Intergenic
1013896219 6:115091621-115091643 CAGAGTGAGCAAAGGCACAATGG - Intergenic
1014015416 6:116524402-116524424 CATTCTCAGCAAAGGCTCACAGG + Exonic
1014572486 6:123027016-123027038 CAGCATGAGCTAAGGTACAGAGG + Intronic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1015025485 6:128527310-128527332 CAGTCTGAGAAAAGAATCAGAGG + Intergenic
1015103835 6:129512836-129512858 CAGTGGGAGAAAAGGCAGAGAGG + Intronic
1016097914 6:140060798-140060820 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1016506505 6:144786618-144786640 AAGCCTGAGCAAAGGCACAGAGG - Intronic
1017083603 6:150692901-150692923 TAGCATAAGCAAAGGCACAGAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018183695 6:161246388-161246410 ACTTCTGAGCATAGGCACAGGGG + Intronic
1018243660 6:161802113-161802135 CAATCTCAGCAAAGGCTCATTGG + Intronic
1018351285 6:162961906-162961928 GAGTGTGAGCAAAGACAGAGAGG - Intronic
1018849652 6:167577893-167577915 CAGTCTCAGGAGAGGCACCGTGG + Intergenic
1018908867 6:168090449-168090471 CAGCATGTGCAAAGGCCCAGGGG - Intergenic
1019102172 6:169640461-169640483 CAGTTTTAGCAAAAGTACAGAGG + Intronic
1019714219 7:2530911-2530933 CAGCCTGGGCAAAGGTGCAGAGG + Intergenic
1019921542 7:4166505-4166527 CAGCCTGAGGAAAGGCTCACGGG + Intronic
1020933956 7:14436431-14436453 CAGTCTCAGCCATGGCCCAGAGG - Intronic
1021149016 7:17126662-17126684 CATTATGAGCAAAGGTAAAGAGG - Intergenic
1021416638 7:20393714-20393736 CAGCAAGAACAAAGGCACAGAGG - Intronic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1022184257 7:27951869-27951891 CAATCTGAGGAAGGACACAGAGG - Intronic
1022384317 7:29887574-29887596 CAGTGTGAGCAGGGACACAGGGG + Intronic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022539904 7:31125802-31125824 CAGGCTGAGCCAAGGCACACTGG - Intergenic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023735542 7:43232865-43232887 ATTTCTGAGCAAAGGCACATGGG - Intronic
1023762854 7:43483007-43483029 CAGCCTAAGCAAAGGTGCAGAGG + Intronic
1024001068 7:45189659-45189681 CAGTCCGAGCAAGGACACTGAGG - Intergenic
1024414785 7:49094107-49094129 AAGCCTCAGCAAAGACACAGTGG + Intergenic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1026810459 7:73459741-73459763 CAGACTGAGAAAAGGCCCAGAGG + Intronic
1026916327 7:74122065-74122087 CAGTGAGAGGATAGGCACAGTGG + Exonic
1027050532 7:75018765-75018787 CAGCATGTGCAAAGGCCCAGGGG + Intronic
1027754180 7:82189651-82189673 AAGTCTGAGTAAAGACTCAGAGG + Intronic
1028163887 7:87515882-87515904 CAGTCTGAGGTCAAGCACAGTGG - Intronic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029382513 7:100222905-100222927 CAGCATGTGCAAAGGCCCAGGGG - Intronic
1029572510 7:101379514-101379536 CAATCTGTGCAAAGGCCCTGAGG - Intronic
1029941096 7:104481509-104481531 CAGCATAAGCAAAGGCCCAGAGG - Intronic
1030747377 7:113183595-113183617 CAGCATGTGCAAAGGCTCAGAGG + Intergenic
1031837777 7:126699505-126699527 CAGTCTTATCAAAATCACAGGGG - Intronic
1032238433 7:130143061-130143083 GAGAGTGAGCAAAGGCACAGTGG - Intergenic
1032532598 7:132634595-132634617 CAGCATGTGCAAAGGCCCAGGGG - Intronic
1032706388 7:134423963-134423985 CAGCCTGAGCCAAGGCACAGGGG + Intergenic
1032803284 7:135333598-135333620 CATCCTGAGCGCAGGCACAGAGG - Intergenic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1033458877 7:141527512-141527534 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1034625040 7:152485964-152485986 CTGCGTGAGCAAAGGCACAGAGG - Intergenic
1035657445 8:1320552-1320574 CAGGCTGAGCTCAAGCACAGGGG - Intergenic
1036743911 8:11390695-11390717 GAGGCTGGGCAAAGGCAGAGGGG + Intronic
1036830420 8:12015887-12015909 CAGCCTGTGCAAAAGCCCAGAGG + Intergenic
1037585630 8:20274034-20274056 CCTTCTGAGCAAAGTCCCAGGGG - Intronic
1037996980 8:23359860-23359882 CAGCATGGGCAGAGGCACAGAGG - Intronic
1038058475 8:23885280-23885302 CTATGTGAACAAAGGCACAGAGG - Intergenic
1038380778 8:27091272-27091294 CAGTGTGAGCAAGGGCACTCAGG - Intergenic
1038608190 8:29031977-29031999 CACCATGTGCAAAGGCACAGAGG + Intronic
1039300634 8:36205148-36205170 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1039304485 8:36246812-36246834 CCGTGTGAGCAAAGGCACCGAGG - Intergenic
1039462056 8:37753312-37753334 CAGTCTGCCCCAAGTCACAGAGG + Intronic
1039482023 8:37881055-37881077 CACTTAGAGGAAAGGCACAGGGG + Intronic
1039483443 8:37892852-37892874 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1039519053 8:38155215-38155237 TAGGGTGAGGAAAGGCACAGAGG - Intergenic
1039870885 8:41544158-41544180 CAGCCTGTGCAAAGGCCCTGAGG + Exonic
1039901232 8:41753884-41753906 CAGCCTGTGCAAAGCCCCAGAGG - Intronic
1040593982 8:48820166-48820188 AGCTCTGAGCATAGGCACAGAGG + Intergenic
1040734807 8:50492000-50492022 CATTCTCAGCAAAGTAACAGAGG - Intronic
1041008015 8:53514756-53514778 CAGCCTCAGCAGAGCCACAGTGG + Intergenic
1041375610 8:57207501-57207523 CACCCTGAGAAAAGGCTCAGGGG - Intergenic
1041376373 8:57211880-57211902 CACCCTGAGAAAAGGCTCAGGGG - Intergenic
1042763920 8:72300184-72300206 CAAACTGAGCAAAGGAGCAGAGG - Intergenic
1042995174 8:74690367-74690389 CAGTGTGAGCTAATGTACAGAGG + Intronic
1043313709 8:78894317-78894339 CAATCTCACCATAGGCACAGAGG - Intergenic
1043434596 8:80226152-80226174 CAGCCTGAGGCCAGGCACAGTGG + Intronic
1043529417 8:81133373-81133395 CAGAGTGAGCAAAAGCTCAGAGG - Intergenic
1043531970 8:81161144-81161166 CAGGCTGTGCAAAGGCCCTGTGG + Intergenic
1043850010 8:85205480-85205502 CAGCCTGACCATATGCACAGAGG - Intronic
1043860957 8:85316657-85316679 CTGACTGTGCAAAGGCACTGAGG + Intergenic
1043877864 8:85507050-85507072 CAATCTCACCAAAGGCTCAGAGG + Intergenic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1046513190 8:115224534-115224556 CAGAGTGAGCAAAATCACAGAGG - Intergenic
1047035270 8:120931517-120931539 AAGCCTGAGCTAAGGCACAAAGG - Intergenic
1047281323 8:123448649-123448671 CAGTCTGCGCAAGGACACAGAGG - Intronic
1047329366 8:123872421-123872443 AAGTCTGAGAAATGGCCCAGAGG + Intronic
1047454504 8:124997504-124997526 CAGGATGAGCAAAGACACTGAGG + Intergenic
1047521922 8:125601569-125601591 CAGCATTTGCAAAGGCACAGAGG + Intergenic
1047551239 8:125874591-125874613 CTGTGTGAGCAAAGGCACACAGG - Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1048113212 8:131490633-131490655 CAGTCTAGGCACAGGCACAGGGG - Intergenic
1048194564 8:132321756-132321778 CAGCCTGGGCCAAAGCACAGGGG - Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048475478 8:134738783-134738805 CAGCATGTGCAAAGGCCCAGGGG + Intergenic
1048681704 8:136849835-136849857 CAGTCTGAGAAATGGTTCAGTGG + Intergenic
1049196754 8:141320096-141320118 CCACCTGAGCAAAGGCACAAAGG + Intergenic
1049224349 8:141442518-141442540 CAGCCTGGGCAAGGGCACAGAGG + Intergenic
1049232254 8:141490484-141490506 CAGCGTGAGCAAGGGCTCAGAGG - Intergenic
1049389123 8:142359075-142359097 CAGCCTGGGTGAAGGCACAGAGG - Intronic
1049433773 8:142576981-142577003 CAGGCTGTGCAAAGGCCCTGGGG - Intergenic
1049922570 9:379061-379083 CAGCATGAGCAAAGTCTCAGAGG + Intronic
1050118518 9:2284970-2284992 CAGTATGTGCAAAGGCCCTGAGG - Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051423309 9:16910156-16910178 CAGCCTGAACAAAGACACAGAGG + Intergenic
1051457635 9:17278478-17278500 CTGTTTGAGGAAAGACACAGAGG - Intronic
1051489128 9:17641705-17641727 CATTCTCAGCAAACTCACAGAGG - Intronic
1051807894 9:21016584-21016606 CAGCCTGAGCAAAGAGGCAGAGG + Intronic
1051857993 9:21591657-21591679 CAGACTGATCAAAAGCTCAGAGG + Intergenic
1052109162 9:24559266-24559288 AAGTATGTGCAAAGGCCCAGAGG + Intergenic
1053081334 9:35179749-35179771 CAGGCTGGGCTAGGGCACAGTGG - Intronic
1053284456 9:36841358-36841380 CATTGTGGGGAAAGGCACAGAGG - Intronic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055488959 9:76784821-76784843 CAGTATGGGCAAAGACACTGAGG - Intronic
1055493317 9:76828248-76828270 GAGCCTGTGCAAAGGCACTGAGG + Intronic
1055649711 9:78395384-78395406 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1056034531 9:82589865-82589887 AAGTCTGAGCAAAGGCGAAGGGG - Intergenic
1056090958 9:83205454-83205476 CAGCATGAGCATAGTCACAGAGG - Intergenic
1056096765 9:83262697-83262719 CAGTCTGTGCAAAGACACAGAGG - Intronic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056521421 9:87405208-87405230 CAGCATGAACCAAGGCACAGAGG - Intergenic
1056900749 9:90597211-90597233 CAGTGGGAGGAAAGGCAAAGGGG - Intergenic
1057199420 9:93132426-93132448 CAGTGGGAGCAAAGGCTCAGAGG - Intronic
1057828778 9:98391660-98391682 CAGCATGAGCCAAGGCCCAGTGG + Intronic
1058003446 9:99890720-99890742 TAGCTTGAGCAAAGGCATAGAGG + Intergenic
1058375228 9:104315141-104315163 CAGTTTGAGCAGAGGCCCAAAGG - Intergenic
1058452064 9:105106345-105106367 CAGTCTCAGGCAGGGCACAGTGG - Intergenic
1059322562 9:113481009-113481031 CAGCAGGTGCAAAGGCACAGAGG - Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059454455 9:114390726-114390748 CATGCTGAGCAAGGGCAGAGAGG - Intronic
1059519531 9:114927443-114927465 CAGCATGAGCAAAGAGACAGAGG - Intronic
1059632499 9:116139703-116139725 CAGTATGTGCAAAGGCCCTGTGG - Intergenic
1059687653 9:116652883-116652905 CAGAGTGAGCAAAGGCACAGAGG - Intronic
1059724577 9:116993291-116993313 CAGGCTGTGCAAAGGCTCACAGG - Intronic
1059766371 9:117387548-117387570 CAGCCTGTGCAAAGGCCAAGAGG + Intronic
1059918052 9:119125735-119125757 CAGAATGAGCAAAGACACAGAGG - Intergenic
1060051719 9:120382968-120382990 CAGCCTGTGCAAAGGCATGGAGG - Intergenic
1060405396 9:123370558-123370580 CAGTCTCAGGACAAGCACAGTGG - Exonic
1060528650 9:124334709-124334731 CAGCACGTGCAAAGGCACAGAGG + Intronic
1060602428 9:124887067-124887089 CAGTCTGAGGAAAGGGAGAGAGG + Intronic
1060765436 9:126292178-126292200 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1060770976 9:126332115-126332137 CAGCCTCAACAAAGGCACCGTGG - Intronic
1060826972 9:126693191-126693213 CAGTCAGAGCAAGGGCAGCGGGG + Exonic
1060879124 9:127105420-127105442 GAGTCTGTGCAAGGGCCCAGGGG - Intronic
1060936172 9:127517435-127517457 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1061250822 9:129425367-129425389 CCCTGTGAGCAAAGGCCCAGGGG - Intergenic
1061352621 9:130077710-130077732 TAGTCTATGCAAAGGCAGAGTGG + Intronic
1061482871 9:130905788-130905810 CAGCATGTGCAAAGGCCCAGAGG - Intronic
1061569798 9:131470178-131470200 CAGACTGGGCAAAGTCACACGGG + Intronic
1062380106 9:136282961-136282983 CAGTCTGAGGCCGGGCACAGTGG + Intronic
1062543238 9:137050750-137050772 GAGCATGAGCAAAGGCCCAGTGG - Intronic
1186237708 X:7531494-7531516 CTGTCTGTGCAAAGGCCCTGGGG + Intergenic
1186277714 X:7957830-7957852 GAGTTTGTGCAAAGGCAGAGAGG - Intergenic
1186460332 X:9743404-9743426 CCCTTTGAGGAAAGGCACAGAGG - Intronic
1186798167 X:13066694-13066716 CAGGAAGAGCAGAGGCACAGAGG - Intergenic
1188153840 X:26716133-26716155 CAGTCAGAGCAAAAGCAGACTGG - Intergenic
1188237637 X:27749392-27749414 CAGTCTCAGAAAAGGAAAAGAGG + Intergenic
1189734493 X:44055876-44055898 CAGTGTGAGCAAAAACCCAGAGG - Intergenic
1189892955 X:45624571-45624593 CAGGCTGTGCAAAGGCTCTGTGG + Intergenic
1190286971 X:48967786-48967808 CAGCCTGAGAAAAGGCTTAGAGG - Intronic
1190301841 X:49061646-49061668 CAGCCTGGGCAAAGGCCCTGAGG + Intronic
1190744261 X:53312126-53312148 CAGCATGAGCAAACACACAGAGG - Intronic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1190937668 X:55011020-55011042 CAGCATGAGCAAAGTCCCAGAGG + Intronic
1191683804 X:63868581-63868603 CAGCCTAAGTAAAGGCACAGAGG - Intergenic
1191753333 X:64567370-64567392 CAGCATAAGCAAAGGCACAAAGG - Intergenic
1192197057 X:69035403-69035425 CAGCATGTGCAAAGGCCCAGAGG - Intergenic
1192233206 X:69279817-69279839 CAGCATGAGGGAAGGCACAGAGG - Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192461420 X:71320471-71320493 CATCCTGGACAAAGGCACAGAGG - Intergenic
1192804710 X:74498534-74498556 CAGTCTCCCCAAAGGCTCAGAGG - Intronic
1193096432 X:77554602-77554624 CAGTTTGGGCAAAGGGACAGAGG - Intronic
1193142135 X:78038641-78038663 CAATGTGTGCAAAGGCCCAGAGG + Intronic
1194620039 X:96160159-96160181 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1195462605 X:105144649-105144671 CACTGTGAACAAAGACACAGAGG - Intronic
1195908504 X:109867648-109867670 CAGTCTAAGTGAAGGCAAAGAGG + Intergenic
1196432513 X:115641960-115641982 CAGCATGAGCAAAGGCACCTGGG - Intronic
1196505230 X:116434498-116434520 TAGCATGAGCAAAGGCACTGAGG + Intergenic
1196764435 X:119230081-119230103 CATTCTGAACAAAGGTACAGAGG - Intergenic
1197026069 X:121751032-121751054 TAATGTGAACAAAGGCACAGAGG + Intergenic
1197272325 X:124438213-124438235 CAGTCAGAGGCCAGGCACAGTGG - Intronic
1197640076 X:128958150-128958172 CAGTATGAGCAAAGACATAGAGG - Intergenic
1197705832 X:129633909-129633931 CAGTTTGAGGCCAGGCACAGTGG + Intergenic
1197771182 X:130090475-130090497 CAGTGTGAACACAGGCACGGAGG - Intronic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198122451 X:133607594-133607616 CAGACTGGTCAAAGGGACAGAGG - Intronic
1198249801 X:134868962-134868984 GAGTATGAGTAAGGGCACAGAGG - Intergenic
1199718102 X:150521513-150521535 CAGTGTGAAGAAAGGTACAGTGG - Intergenic
1200176797 X:154122678-154122700 CAGTCCGGGCACAGTCACAGGGG + Intergenic
1200243329 X:154508922-154508944 CAACCTGAGCAAAGGCAGTGTGG + Intronic
1200386167 X:155893038-155893060 CAGTCTGAGGCCAGGCACGGTGG - Intronic