ID: 1102031933

View in Genome Browser
Species Human (GRCh38)
Location 12:109744603-109744625
Sequence ACAGCTCATGGGCCTCAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102031933_1102031945 25 Left 1102031933 12:109744603-109744625 CCCGCTTGAGGCCCATGAGCTGT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 1102031945 12:109744651-109744673 TCTGGCCTTGCTTTTTCACTGGG 0: 1
1: 0
2: 6
3: 23
4: 271
1102031933_1102031944 24 Left 1102031933 12:109744603-109744625 CCCGCTTGAGGCCCATGAGCTGT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 1102031944 12:109744650-109744672 CTCTGGCCTTGCTTTTTCACTGG 0: 1
1: 0
2: 5
3: 20
4: 231
1102031933_1102031940 7 Left 1102031933 12:109744603-109744625 CCCGCTTGAGGCCCATGAGCTGT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 1102031940 12:109744633-109744655 TGGGTGTTTCCTTCCCTCTCTGG 0: 1
1: 1
2: 3
3: 26
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102031933 Original CRISPR ACAGCTCATGGGCCTCAAGC GGG (reversed) Intronic
900225883 1:1533481-1533503 ACCACTCATGTGCCTCAAGGTGG + Intronic
901900364 1:12356447-12356469 CCAGCTCATGCTCCTCAAACTGG - Exonic
902219402 1:14955360-14955382 CCAGCTCAGGGGCCACCAGCAGG - Intronic
905244504 1:36603219-36603241 ACAACTCATAGGCTTCAAACTGG - Intergenic
905336032 1:37245099-37245121 ACTTGTTATGGGCCTCAAGCAGG + Intergenic
905616282 1:39402374-39402396 ATGGGTCATGGGCCTCAACCTGG - Intronic
915027024 1:152840810-152840832 GCAGCTCAGGGGCCTCAAACAGG + Intergenic
917460581 1:175225730-175225752 ACCGCTCATGGGTGTCAAGAAGG - Intergenic
918630991 1:186718247-186718269 ACAGCTCAACGGCCTGAATCTGG + Intergenic
919884758 1:201925098-201925120 CCAGCTCATGAGGCTCAGGCAGG + Intronic
920417317 1:205807430-205807452 CCAGCTCATGGGCCTGGAGTGGG + Intronic
923786649 1:237074475-237074497 ACACCTCTGAGGCCTCAAGCAGG + Intronic
923946302 1:238891782-238891804 ACAGCTCATGGGCCATAATCTGG - Intergenic
1070467046 10:76733913-76733935 ACAGCTAATGGGCCTCCACCAGG - Intergenic
1076244020 10:128932317-128932339 GCAGCTCAGGGGCCTCATCCTGG + Intergenic
1077245832 11:1537561-1537583 TCATCTCATGGGCCCCAGGCTGG - Intergenic
1078010927 11:7572541-7572563 ACGGCCCCTGGGCCTGAAGCAGG - Intronic
1078689562 11:13565405-13565427 ACAGCTCAGGGGCATCAAAATGG + Intergenic
1079393074 11:20039083-20039105 GAGGCTCTTGGGCCTCAAGCAGG - Intronic
1083828045 11:65214100-65214122 AGGGCTCAGGGGCCCCAAGCTGG - Intergenic
1084089609 11:66871135-66871157 AGAACTCGTGGGCCTCATGCAGG + Exonic
1088750106 11:112836017-112836039 TCAGCTCCTGGGCCTGAACCTGG + Intergenic
1088983763 11:114887755-114887777 ACTGCTCATGGCCCTGAGGCAGG + Intergenic
1090619452 11:128548639-128548661 GCAGCGCCTGGGCCCCAAGCGGG - Intronic
1091211610 11:133865342-133865364 ACAGGTCGTTGGCCTCAAACAGG + Intergenic
1095101881 12:38193613-38193635 ACAGATCATGGGCCTAAAGTAGG - Intergenic
1096574851 12:52546341-52546363 GGAGCTCATGAGCCTGAAGCTGG - Exonic
1096937242 12:55294740-55294762 ATTGGTCATGGGACTCAAGCTGG - Exonic
1098605095 12:72380670-72380692 ACAGATCATGGACCGCCAGCAGG + Intronic
1100602149 12:96121116-96121138 ACATGTCATGGTCCACAAGCAGG + Intergenic
1102031933 12:109744603-109744625 ACAGCTCATGGGCCTCAAGCGGG - Intronic
1103019793 12:117524943-117524965 CCAGCTCAAGGCCTTCAAGCGGG - Exonic
1104781025 12:131420626-131420648 ACAGCTCGGGGTCCACAAGCAGG + Intergenic
1105347902 13:19590724-19590746 ACAGCTCCTGGGCCTCAGCAGGG + Intergenic
1108346817 13:49554517-49554539 CCAGCTCATGAGCCGCAGGCCGG + Intronic
1108623228 13:52204125-52204147 ACAGCTCCTGGGCCTCAGCAGGG + Intergenic
1108663500 13:52606913-52606935 ACAGCTCCTGGGCCTCAGCAGGG - Intergenic
1109004348 13:56852386-56852408 ACATCACATGTGCATCAAGCAGG + Intergenic
1109147983 13:58806538-58806560 ACAGCTGATGGCCTTCCAGCAGG + Intergenic
1112011771 13:95299500-95299522 GCAGCCCATGGGCCTCAGGTTGG - Intronic
1112012133 13:95301376-95301398 TCCGCTCCTGGACCTCAAGCAGG + Exonic
1115199535 14:30838089-30838111 GCAGCCCATGGGCCACAAGTTGG + Intergenic
1122063761 14:99157633-99157655 ACATCTCATTGGCCTGAAGTGGG - Intergenic
1126362812 15:47863645-47863667 ACAGCATATGGCCCTAAAGCAGG + Intergenic
1127299615 15:57639840-57639862 ACAGCTCAGGGGACCCAAGGGGG + Intronic
1129887350 15:79047955-79047977 ATAGCTCTTGGGCCTCGGGCAGG - Intronic
1132067480 15:98744194-98744216 ACAGCTCATGATCCTCTACCTGG - Intronic
1132316520 15:100894241-100894263 CCAGCTCAGTGGCCACAAGCAGG - Intronic
1132348189 15:101121200-101121222 CCAGCTCACCGGCCTCACGCTGG - Intergenic
1133193582 16:4152410-4152432 GCAGCTCATCTGCCTCAGGCTGG + Intergenic
1133359961 16:5166391-5166413 ACAGCTGGTGGGTCTCAAGCTGG - Intergenic
1133437179 16:5789966-5789988 ACACCTCACGGGCTTCATGCAGG + Intergenic
1134542125 16:15075988-15076010 ACATCTCCTTGGTCTCAAGCTGG + Intronic
1136068620 16:27775108-27775130 GCAGCTCCTGGCCCTCAGGCGGG + Intronic
1137366750 16:47866094-47866116 ACAGCTCAGGGGACTCAATATGG + Intergenic
1138444900 16:57057662-57057684 ATAGCTCAGGTGCCTCCAGCAGG - Intronic
1138981258 16:62271628-62271650 AACGCTCATGGGCTTCAAACTGG - Intergenic
1139328151 16:66167662-66167684 AGAGCTCATGGGGCGGAAGCAGG + Intergenic
1140673085 16:77298451-77298473 CCAGCTCCTGGGGCTGAAGCAGG + Intronic
1147571363 17:41573018-41573040 ACAGCTCATGAGCATGGAGCTGG - Intergenic
1150690040 17:67357777-67357799 ATAGCTTATGGGCTTCAAGTAGG - Intronic
1152957758 18:53830-53852 ACAGTTCATGGGCCTAAAGTAGG + Intronic
1153538277 18:6127199-6127221 GCAGCCCATGGGCCGCAAGTTGG - Intronic
1156576794 18:38326740-38326762 ATTTGTCATGGGCCTCAAGCAGG + Intergenic
1161090684 19:2358503-2358525 CCAGCTCCTGGGATTCAAGCTGG - Intergenic
1161297414 19:3526875-3526897 ACAGCTCATAGCCCTAAGGCAGG - Intronic
1165485170 19:36091088-36091110 ACAGCACATGGGACTCTGGCAGG - Intronic
928092237 2:28382019-28382041 ACAGCACAGGGGCCCCCAGCTGG + Intergenic
928170331 2:28999251-28999273 ACAGCTGGGTGGCCTCAAGCTGG + Exonic
931515383 2:63048052-63048074 CCAGCTCAAGGCCCTCGAGCCGG - Intergenic
931828121 2:66022474-66022496 ACAGCCCATGGGCCACATGCAGG + Intergenic
935717541 2:105952404-105952426 ACAGCACAGGGGCATCCAGCAGG - Intergenic
942609056 2:177723182-177723204 ACAGAACATCAGCCTCAAGCTGG + Intronic
944501547 2:200365338-200365360 AAAGATCATGGGGCTCAAGGAGG + Intronic
947463985 2:230325450-230325472 ACTGCTCTTGGGCAGCAAGCAGG - Intergenic
948899446 2:240949006-240949028 CCAGCTGTTGGGCCTCAAGGAGG - Intronic
949061278 2:241959247-241959269 AGAGCTCAGAGGCCTCAGGCGGG - Intergenic
1169474051 20:5914899-5914921 ACATATCATGGGGCTCAACCTGG - Intronic
1171776846 20:29376487-29376509 ACAGATCATGGGCCTAAAGTAGG + Intergenic
1171818226 20:29807917-29807939 ACAGATCATGGGCCTGAACTAGG + Intergenic
1172038722 20:32028934-32028956 CCAGCTCCTGGCCCTCAGGCAGG - Intronic
1172590591 20:36114972-36114994 ACAGCTCATAGGCCTGCAGGGGG + Intronic
1173324327 20:42018766-42018788 TCAGCTCTTGGGCCTCTACCAGG + Intergenic
1174165069 20:48578539-48578561 ACATCTCATGGCCCTAAGGCTGG + Intergenic
1174542259 20:51298790-51298812 ACTGCTCACAGGCCACAAGCAGG + Intergenic
1175368937 20:58473947-58473969 ATAACACATCGGCCTCAAGCAGG - Intronic
1176141486 20:63546946-63546968 ACAGCTGATGGGCCCCGGGCCGG - Intronic
1178202680 21:30425715-30425737 ACAGCTGTTGGGCCTCCAGCAGG + Exonic
1180321664 22:11327325-11327347 ACAGATCATGGGCCTAAACTAGG + Intergenic
1181618400 22:24070934-24070956 ACTGCTGATGGGCATCGAGCAGG + Exonic
1182434259 22:30320295-30320317 AAAGGTCATGGCCATCAAGCAGG - Intronic
1184851389 22:47123267-47123289 ACAGGTGAGGGGCCTCCAGCAGG - Intronic
1184915555 22:47566392-47566414 TCAGCTGATGGGCATCAGGCTGG + Intergenic
950535672 3:13576785-13576807 AGAGCCCAAGGGCCTCTAGCAGG - Intronic
955089458 3:55734806-55734828 AGAAGTCATGGCCCTCAAGCGGG - Exonic
955344552 3:58151444-58151466 ACAGTTCGTGTGCCTCAAGGTGG + Intronic
960672370 3:120165890-120165912 ACAGCTCCTGGGACTCAAGTAGG - Exonic
962276626 3:134019594-134019616 CCAGCTCATGGGGCTCAAAAAGG - Intronic
968356975 3:198116356-198116378 ACAGATCATGGGCCTAAAGTAGG - Intergenic
968427622 4:534131-534153 AAAGCTCAAGGGCCAGAAGCCGG + Intronic
969460150 4:7324716-7324738 AAAGCACATGGGACTCAAGGTGG - Intronic
985442683 4:189995242-189995264 ACAGATCATGGGCCTAAAGTAGG + Intergenic
985476234 5:80815-80837 TCAGCTCATGGGTCCCAAGGAGG + Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
991254152 5:64596323-64596345 AGAGATCATGGGTCTCAAACTGG + Intronic
997386237 5:133475028-133475050 TCAGCTCATGTGTCACAAGCAGG + Intronic
997573167 5:134949089-134949111 ACAGGGAATGGTCCTCAAGCAGG + Intronic
998474869 5:142412195-142412217 ACAGCAGATGGTCCCCAAGCTGG - Intergenic
998524087 5:142826659-142826681 CCACCTCATGGGTCTCAAGAAGG - Intronic
999239086 5:150117224-150117246 ACAGAACATAGGCCTCAGGCTGG + Intronic
1003569460 6:7246716-7246738 CAAGCTCATGGACTTCAAGCTGG + Exonic
1005960383 6:30689275-30689297 TGAGCTCATGGGCCTCAAACAGG - Exonic
1005973537 6:30779879-30779901 GCCGCTCAGGGGCCTCATGCTGG + Intergenic
1006101037 6:31686622-31686644 AAAGCTCATGAGCCGTAAGCAGG + Intergenic
1006819044 6:36876089-36876111 CCAGCTCAAGGGCCACAAGGTGG - Intronic
1007664520 6:43506414-43506436 GGGGCTCAGGGGCCTCAAGCTGG + Exonic
1016072941 6:139762284-139762306 ACACCTCATGAAACTCAAGCTGG - Intergenic
1019279128 7:191550-191572 ACATCCCCTGTGCCTCAAGCCGG - Intergenic
1019503265 7:1376243-1376265 ACAGCTGATGGGCCGTAAGCTGG + Intergenic
1019542841 7:1559324-1559346 ACAGCTCATGGGCCCTCAGCCGG - Intronic
1019665500 7:2250136-2250158 ACGGCTCATGGGCCCCACGCTGG - Intronic
1022728198 7:32999269-32999291 AGTGCTCATGGGCATCAAGGGGG + Intronic
1022754878 7:33276909-33276931 TCACCTCATGGGCCACAAGAGGG + Intronic
1024229669 7:47354545-47354567 CCAGCACCTGGGCCTCAGGCTGG - Intronic
1025045454 7:55688751-55688773 AGTGCTCATGGGCATCAAGGGGG - Intergenic
1025218258 7:57078934-57078956 TCACCTCATGAGCCTCAAGGTGG - Intergenic
1025629178 7:63252554-63252576 TCACCTCATGAGCCTCAAGGTGG - Intergenic
1025653087 7:63491527-63491549 TCACCTCATGAGCCTCAAGGTGG + Intergenic
1027765721 7:82338962-82338984 ACAGCTGAGGGGCCCTAAGCAGG + Intronic
1028163047 7:87507704-87507726 AAAGCTCAGGAGCCTCAACCCGG - Intronic
1034158281 7:148973423-148973445 ACAGCTCATGGAGCTCAGCCAGG - Intergenic
1038022390 8:23561550-23561572 CCAGCTCTGGGACCTCAAGCAGG - Intronic
1038079693 8:24119997-24120019 ACAACTCCTGGGCCTGAAGGAGG - Intergenic
1038583326 8:28769019-28769041 CCTGTTAATGGGCCTCAAGCTGG - Intronic
1043378885 8:79681802-79681824 GCAGCCCATGGGCCACAAGTTGG + Intergenic
1045215937 8:100148359-100148381 ACAGCTCAGTGGCTTCAATCTGG - Intergenic
1054961804 9:70977724-70977746 ACAGCTCATGGAACTCAGGAAGG + Intronic
1060155082 9:121313930-121313952 ACAGGTGCTGGGCCCCAAGCCGG + Exonic
1062740397 9:138170770-138170792 ACAGATCATGAGCCTAAAGTAGG - Intergenic
1203369891 Un_KI270442v1:293196-293218 ACAGATCATGGGCCTAAACTAGG + Intergenic
1186162251 X:6789590-6789612 AGAGCTCATGGCCCCCAAGCTGG + Intergenic
1190069348 X:47266645-47266667 ACAGCTCATGGGGCAGGAGCTGG - Intergenic
1195651850 X:107292953-107292975 ATAGCCCATGGGCATAAAGCTGG + Intergenic
1198815603 X:140586736-140586758 TCAGCTCAGAGGCCTCAAGTGGG + Intergenic
1199557967 X:149129646-149129668 ACAGCTCAGAGACCTCAACCAGG - Intergenic
1199972625 X:152872198-152872220 ACAGGTCAGGGGCCCCAGGCTGG - Intergenic
1200116300 X:153771158-153771180 AGAGGTTATGGGCCCCAAGCAGG - Intronic
1200179846 X:154143648-154143670 ACAGCTCATGGGGGGCAAGGGGG + Intergenic
1201068418 Y:10121870-10121892 ACAGATCATGGGCCTAAACTAGG - Intergenic
1201760020 Y:17526745-17526767 ACAGATCGTGAGCCTCAAGTAGG + Intergenic
1201841534 Y:18379245-18379267 ACAGATCGTGAGCCTCAAGTAGG - Intergenic