ID: 1102033688

View in Genome Browser
Species Human (GRCh38)
Location 12:109759146-109759168
Sequence GTGGCAGTCAGGAGACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102033688_1102033691 -9 Left 1102033688 12:109759146-109759168 CCTCCAAGTCTCCTGACTGCCAC 0: 1
1: 0
2: 1
3: 23
4: 287
Right 1102033691 12:109759160-109759182 GACTGCCACTCCCAGCTCCTTGG 0: 1
1: 0
2: 4
3: 190
4: 2696
1102033688_1102033693 -4 Left 1102033688 12:109759146-109759168 CCTCCAAGTCTCCTGACTGCCAC 0: 1
1: 0
2: 1
3: 23
4: 287
Right 1102033693 12:109759165-109759187 CCACTCCCAGCTCCTTGGACAGG 0: 1
1: 0
2: 1
3: 37
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102033688 Original CRISPR GTGGCAGTCAGGAGACTTGG AGG (reversed) Intronic
900995590 1:6121641-6121663 GTGGCAGAGAGGAGAGATGGGGG + Intronic
901669966 1:10850335-10850357 GTTACAGACAGGAGACTAGGAGG - Intergenic
902242670 1:15099421-15099443 GGGACAGTAAGCAGACTTGGGGG + Intronic
903154040 1:21431760-21431782 GTGCCAGGCTGGACACTTGGGGG - Intergenic
903667837 1:25018667-25018689 GTGGCATTGAGAAGACCTGGGGG + Intergenic
903963178 1:27070191-27070213 GTGGAGATCAGGGGACTTGGGGG + Intergenic
905325591 1:37149503-37149525 GTGGCAGGCAGGAGGCCTGGTGG + Intergenic
905489803 1:38334467-38334489 CAGGCAGTCAGGATGCTTGGAGG - Intergenic
905494134 1:38371351-38371373 GTGGTAGTCAGGAAAATTGAAGG + Intergenic
905973475 1:42157770-42157792 GTGGCAGTGTGGAGCCATGGAGG - Intergenic
906579796 1:46927158-46927180 GGGGAACTCAGGGGACTTGGAGG + Intergenic
906603930 1:47151741-47151763 GGGGAACTCAGGGGACTTGGAGG - Intergenic
906843017 1:49160504-49160526 CTCCCAGTCAGGAGACATGGGGG + Intronic
907483454 1:54760542-54760564 GTGGAAGTCAGGAGACCAGTGGG - Intronic
908544492 1:65149186-65149208 CTGGCCGTCAGGAGACTCGGAGG + Intronic
910859301 1:91728213-91728235 GTGGCAGTTTGGTGAGTTGGGGG + Intronic
911332121 1:96537314-96537336 GTGGCAGCCACGAGCCTTGCTGG - Intergenic
912369414 1:109162065-109162087 TTGGATGGCAGGAGACTTGGGGG - Intronic
915243068 1:154537589-154537611 GTGGCAGCGAGCAGACTTGGAGG + Intronic
915244330 1:154545497-154545519 GGGGCAGTCAGGAGAAGTGGAGG + Intronic
916140617 1:161693829-161693851 CTCCCAGTCAGGAGACTCGGGGG - Intergenic
916748932 1:167706649-167706671 GTGACTAACAGGAGACTTGGGGG - Intergenic
917207112 1:172587939-172587961 GTGGCATACAGGAGAGTGGGGGG - Intronic
917527329 1:175800555-175800577 GTGACATTGAGTAGACTTGGAGG + Intergenic
918210184 1:182343480-182343502 CTGGCACTCAGCAGACATGGTGG - Intergenic
918532369 1:185537746-185537768 ATGGCAGTCAGGAGACTCCTTGG - Intergenic
918795413 1:188888304-188888326 GTTGATGTCTGGAGACTTGGTGG - Intergenic
920104003 1:203537602-203537624 GTGGCAGGCAGGACTCCTGGGGG + Intergenic
921626250 1:217380349-217380371 CTGCCAGTCAGGAGGCATGGGGG - Intergenic
922563664 1:226587274-226587296 GTCACAGTCAGGAGACTGAGGGG + Intronic
923682836 1:236132851-236132873 GCTGCTGTCAGCAGACTTGGAGG + Intergenic
924296086 1:242587635-242587657 CTCCCAGTCAGGAGACATGGGGG - Intergenic
1063881673 10:10538239-10538261 GAGGCAGGAAGGAGACATGGGGG - Intergenic
1064040877 10:11962461-11962483 GTAGAACTGAGGAGACTTGGTGG - Intronic
1064598816 10:16972802-16972824 GTGGCAGTCACTAGAATTAGAGG - Intronic
1066665011 10:37774122-37774144 GTGGCTGTCAGGAGAGAAGGAGG - Intergenic
1066993424 10:42539167-42539189 CTCCCAGTCAGGAGACATGGGGG + Intergenic
1069043612 10:63720175-63720197 GTGTCAGTCAGGAGCATTGCAGG + Intergenic
1069868714 10:71520251-71520273 GTGGCAGTCAGGAAATGTGTGGG + Intronic
1070086744 10:73245347-73245369 GTGGGGGTGAGGAGAGTTGGGGG - Intronic
1070465811 10:76722723-76722745 GAGACACTCAGGAGATTTGGTGG - Intergenic
1070582358 10:77731798-77731820 CTGGGATTCAGGAGACTTGTCGG - Intergenic
1071346849 10:84701503-84701525 TTGTCAGTCTGAAGACTTGGCGG + Intergenic
1071566794 10:86675236-86675258 GGGGAAGTGAGGAGACCTGGTGG + Intronic
1072733438 10:97863744-97863766 CTGGGAGTCAGGAGACTGGGGGG - Intronic
1072742696 10:97919348-97919370 GTCTCAGTCAGGTGAATTGGAGG + Intronic
1073380792 10:103076600-103076622 GCTGAGGTCAGGAGACTTGGAGG + Intronic
1074702982 10:116108698-116108720 GAGCCAGTGAGGGGACTTGGTGG - Intronic
1075565038 10:123497153-123497175 GGGGCAGTGAGGAGATTAGGAGG - Intergenic
1076573603 10:131449256-131449278 GGGGCAGGCAGAAGCCTTGGTGG - Intergenic
1078150909 11:8758964-8758986 GTGGCAGTGAGGGGAATTGATGG - Intronic
1079510503 11:21205065-21205087 CTCCCAGTCAGGAGACATGGGGG + Intronic
1080481107 11:32651282-32651304 GTGTTAGGCAGGTGACTTGGTGG - Intronic
1081136497 11:39445919-39445941 GTGTCAGTATGGAGACTAGGGGG - Intergenic
1081699013 11:45140732-45140754 GTGGCATTCAGGAGTCTTCCTGG + Intronic
1081959274 11:47122365-47122387 ATGGCATTCAGGTGACTTAGAGG + Intronic
1082773279 11:57225631-57225653 GTGGCAAACAGGAGAATGGGAGG + Intergenic
1083385457 11:62306109-62306131 CTCCCAGTCAGGAGACTCGGGGG + Intergenic
1084568324 11:69944163-69944185 GTGTTTGTCGGGAGACTTGGTGG - Intergenic
1086399616 11:86449863-86449885 CTGTCAGTCTGGAGACCTGGAGG - Intronic
1087596188 11:100257472-100257494 GTCCCAGTCAGGAGGCATGGGGG - Intronic
1089043835 11:115481389-115481411 GGGGCTGTCAAGAGACTTTGAGG - Intronic
1091365722 11:135018658-135018680 GGGCCACACAGGAGACTTGGGGG + Intergenic
1092253276 12:6913257-6913279 GTGGCAGGCAGAGGAGTTGGTGG + Intronic
1093214549 12:16347776-16347798 GTGGCAGATGGAAGACTTGGGGG + Exonic
1093590258 12:20894501-20894523 GTGGCATGCAGGAGACTTGGGGG - Intronic
1095585235 12:43842562-43842584 TTGGGACTCAGGAGCCTTGGAGG + Intronic
1095859614 12:46902051-46902073 GTGGCATCCAGGAGACAGGGCGG - Intergenic
1097229398 12:57500271-57500293 GAGACAGTCAGAAGACGTGGTGG - Intronic
1100197882 12:92267971-92267993 GTGGCAGACAGGAGATTTTTAGG - Intergenic
1102033688 12:109759146-109759168 GTGGCAGTCAGGAGACTTGGAGG - Intronic
1102558227 12:113742851-113742873 GTGGCAGTCATGAGATGAGGAGG + Intergenic
1102655133 12:114476271-114476293 GTGGAAGTAAGGTGACTTGAGGG - Intergenic
1103255582 12:119539147-119539169 CTCCCAGTCAGGAGACATGGCGG + Intronic
1105355179 13:19653116-19653138 CTCCCAGTCAGGAGACATGGGGG - Intronic
1106342216 13:28841372-28841394 GTGGCAGTCATGGTAGTTGGAGG + Intronic
1107825710 13:44327238-44327260 TTGGAAGTCAGGAGCCTAGGAGG + Intergenic
1108236902 13:48417111-48417133 TTCCCAGTCAGGAGACATGGGGG - Intronic
1110499203 13:76206861-76206883 GTGGTTGTCTGGAGACTTGCTGG + Intergenic
1114262033 14:21043856-21043878 GTGGCAGTGAGGTGACCTGAAGG + Exonic
1114688213 14:24555141-24555163 GTGTGAGCCATGAGACTTGGTGG + Intergenic
1115098340 14:29667175-29667197 CTGGCAGGCAGAAGACCTGGGGG + Intronic
1115124262 14:29973024-29973046 CTCCCAGTCAGGAGGCTTGGGGG - Intronic
1115721032 14:36161677-36161699 CTCTCAGTCAGGAGACATGGGGG + Intergenic
1116136180 14:40927061-40927083 TTGGCAGTTTGGAAACTTGGTGG - Intergenic
1117200300 14:53383193-53383215 GTGCCAGACAGGAGGCATGGAGG - Intergenic
1117411906 14:55457569-55457591 GTGGCAGTCTGGAGACTGAGGGG - Intergenic
1118043047 14:61938064-61938086 GTTTCAGACAGGAAACTTGGAGG + Intergenic
1121515057 14:94544042-94544064 GTGGCAGCCAGGAGGCTGTGTGG - Intergenic
1121964490 14:98291413-98291435 TTGGCAATCTGGACACTTGGGGG - Intergenic
1122768788 14:104087880-104087902 GTGGGAAACAAGAGACTTGGAGG + Intronic
1122967792 14:105139326-105139348 GTGGCACTCAGGAGGTGTGGAGG + Intergenic
1123149475 14:106166974-106166996 GTGACAGTGAGGTGACTTGGGGG - Intergenic
1123218030 14:106830805-106830827 GTGGCACTCAGGACACAAGGGGG - Intergenic
1123218068 14:106830980-106831002 GTGGCACTCAGGACACAAGGGGG - Intergenic
1123509503 15:20982448-20982470 GAGGCAGTCAGTAGAGGTGGTGG - Intergenic
1123566725 15:21556187-21556209 GAGGCAGTCAGTAGAGGTGGTGG - Intergenic
1123602986 15:21993480-21993502 GAGGCAGTCAGTAGAGGTGGTGG - Intergenic
1124372929 15:29113646-29113668 GTGGGAGTCAGAAAACTTGGTGG + Intronic
1124591268 15:31055549-31055571 GTGGCAGCCTGGAGACCGGGAGG - Intronic
1124929140 15:34101878-34101900 GTGGCGGCCGGGAGACTGGGAGG - Exonic
1125882476 15:43206530-43206552 CTGGCAGTCTCGAGACTGGGAGG + Exonic
1126202139 15:45998652-45998674 GGGCCAGTCAGGGGACTAGGTGG - Intergenic
1127990702 15:64113949-64113971 GTGGCAGTCAGTAAAGTTGGTGG + Intronic
1129034679 15:72642011-72642033 CTAGCAGTCAGGGGCCTTGGTGG - Intergenic
1129215203 15:74095205-74095227 CTAGCAGTCAGGGGCCTTGGTGG + Intergenic
1129407812 15:75330717-75330739 CTGGAAGTCAGGGGCCTTGGTGG - Intergenic
1129470980 15:75753494-75753516 CTGGAAGTCAGGGGCCTTGGTGG - Intergenic
1129653304 15:77506654-77506676 GTGGCAGGCAGGAGTCTCAGAGG - Intergenic
1131408146 15:92183539-92183561 GTGTCAGGCAGGAGCCTTTGGGG + Intergenic
1131778148 15:95824384-95824406 ATGGCAGTTAGGAAACTTGATGG - Intergenic
1202975086 15_KI270727v1_random:283282-283304 GAGGCAGTCAGTAGAGGTGGTGG - Intergenic
1132692518 16:1187973-1187995 GTGTCAGTCAGGAGAGTAGATGG + Intronic
1133137575 16:3722488-3722510 GAGGTGGGCAGGAGACTTGGGGG - Intergenic
1133996475 16:10752342-10752364 CTGGCTGTCAGGTCACTTGGAGG - Intronic
1136680593 16:31959859-31959881 GTGACAGTGAGGTGACCTGGGGG + Intergenic
1136692059 16:32039511-32039533 GGGGCACTCAGGACACTTGGTGG + Intergenic
1136780989 16:32901718-32901740 GTGACAGTGAGGTGACCTGGGGG + Intergenic
1136792602 16:32982949-32982971 GGGGCACTCAGGACACTTGGTGG + Intergenic
1136877254 16:33871105-33871127 GGGGCACTCAGGACACTTGGTGG - Intergenic
1136888832 16:33952201-33952223 GTGACAGTGAGGTGACCTGGGGG - Intergenic
1137541044 16:49361938-49361960 GTGGCAGGCAAGAGAGCTGGTGG - Intergenic
1138337115 16:56261892-56261914 TTAGCAGTCAGGAGTCTTGACGG - Intronic
1138549706 16:57740702-57740724 ATGGCAGACAGGAGCCTCGGAGG - Intronic
1138622975 16:58226478-58226500 GTGTCAGTCAGGACACTTTCTGG - Intergenic
1139329106 16:66173863-66173885 GTGGGAGCCAGGAGCCTAGGTGG + Intergenic
1142125229 16:88406866-88406888 GGGGGAATCAGGAGACCTGGGGG - Intergenic
1142278196 16:89133873-89133895 GTGGCGGTCAGGAGAGACGGCGG + Intronic
1142384890 16:89757572-89757594 GCCGCAGGCAGGAGACATGGGGG + Intronic
1203083585 16_KI270728v1_random:1165437-1165459 GTGACAGTGAGGTGACCTGGGGG + Intergenic
1203094817 16_KI270728v1_random:1244428-1244450 GGGGCACTCAGGACACTTGGTGG + Intergenic
1142740209 17:1927452-1927474 GGGGCAGCCAGCAGGCTTGGAGG + Intergenic
1143171481 17:4933070-4933092 GTGGGCGTCAGGAGCCCTGGGGG - Exonic
1145762674 17:27435072-27435094 CTGGCTGCTAGGAGACTTGGAGG + Intergenic
1146343472 17:32041576-32041598 ATGGAAGGCAGGAGACCTGGCGG - Intronic
1147040190 17:37712395-37712417 ATGGCAAACAGGAGACGTGGGGG - Intronic
1148486653 17:47995258-47995280 CTGGCAGTCAGGAGAGGGGGTGG - Intergenic
1148775341 17:50092083-50092105 GTGGCTCACAGGAGACTAGGGGG - Intergenic
1148974994 17:51519825-51519847 GTGGGAGGCAGGAGTCTTGCAGG - Intergenic
1150575925 17:66430755-66430777 GTGGCCTTCAGGAGACTTTCTGG + Intronic
1150678320 17:67263898-67263920 GTGGCATAAAGGAGATTTGGAGG - Intergenic
1151984208 17:77531618-77531640 GTGGCCTCCAGGGGACTTGGCGG + Intergenic
1152041265 17:77905402-77905424 CTGGGAGTCAGGAGTCTAGGAGG + Intergenic
1152325602 17:79634112-79634134 GTGGCAGCCTGGAGCCCTGGAGG + Intergenic
1152431943 17:80253102-80253124 GGGGCAGGCAGGAGTCTGGGAGG + Exonic
1152644507 17:81462663-81462685 GTGGCGGCCAGGAGGCATGGAGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155749504 18:29403490-29403512 GTGGCATTCAAGAGATTTGAAGG - Intergenic
1156476988 18:37411755-37411777 GTGGCAGGCAGGAGATGAGGCGG + Intronic
1156857498 18:41799306-41799328 GTCACAGTGAGAAGACTTGGCGG + Intergenic
1159804159 18:72935541-72935563 CTGGTAGTCAGGAGACTTCCAGG + Intergenic
1160668454 19:344555-344577 GTGGCAGCCGGGGGAGTTGGGGG + Intronic
1160842270 19:1151423-1151445 GTGGGAGGGAGGAGACTAGGGGG - Intronic
1161440971 19:4291464-4291486 CAGGCAGGCAGGAGACCTGGGGG + Intergenic
1161605631 19:5213293-5213315 GTGGGAGGCAGGAGCCATGGAGG - Intronic
1161643438 19:5437675-5437697 GTGGCCTCCAGGAGACTTTGGGG + Intergenic
1161847425 19:6719711-6719733 CTGGAAGTCCAGAGACTTGGAGG - Intronic
1162648123 19:12064894-12064916 CTGGGAGTCCCGAGACTTGGGGG + Intronic
1164412172 19:28015102-28015124 GAGGCCCTCAGGAGACTTGTTGG - Intergenic
1165971902 19:39638776-39638798 GTGTCAGACAGGCAACTTGGTGG + Intergenic
1166345463 19:42162625-42162647 CTGGCTGTGAGGAGACTTGAGGG - Intronic
1167679317 19:50909619-50909641 GGAGCAGTCAGGACTCTTGGGGG + Intronic
1167963604 19:53126546-53126568 AAGGCAGGCAGGAGACTTGAGGG + Intronic
1168094167 19:54105179-54105201 GTGGGAGCCAGGAGTCCTGGGGG - Intronic
931479083 2:62621842-62621864 CTCCCAGTCAGGAGACATGGGGG + Intergenic
931736253 2:65197444-65197466 GTAGCAGCCACAAGACTTGGGGG - Intergenic
933766446 2:85712509-85712531 ATGGGAGGCAGGAGACTGGGTGG + Intergenic
935131796 2:100266146-100266168 CTGGCAGACTGGACACTTGGTGG + Intergenic
935325900 2:101936347-101936369 CTCCCAGTCAGGAGACATGGGGG - Intergenic
935675646 2:105592980-105593002 GTGCCAGGAAGGAGACGTGGAGG - Intergenic
935852325 2:107235998-107236020 CTCCCAGTCAGGAGACATGGAGG - Intergenic
936149581 2:110007832-110007854 CTGGGATTCAGGAGACTTGTCGG - Intergenic
936195097 2:110363537-110363559 CTGGGATTCAGGAGACTTGTCGG + Intergenic
936881883 2:117262846-117262868 GTGGCACCCAGGCAACTTGGTGG + Intergenic
936944681 2:117919721-117919743 GTGCCAGCCAGCAGGCTTGGTGG - Exonic
938062781 2:128265915-128265937 GTGCCAGGCTGGACACTTGGGGG + Exonic
938124671 2:128663332-128663354 GAGGCAGTCAGGATGCTGGGAGG + Intergenic
940821459 2:158360357-158360379 CTCCCAGTCAGGAGACATGGGGG - Intronic
943350776 2:186793687-186793709 CTCCCAGTCAGGAGACATGGGGG - Intergenic
943701807 2:190995448-190995470 GTGGCAGGCAAGAGAGTTTGTGG + Intronic
944481321 2:200160562-200160584 GTGCCAGTGGGGAAACTTGGAGG + Intergenic
944663807 2:201942435-201942457 GTGTGAGTCAGGATACGTGGAGG + Intergenic
947379182 2:229528581-229528603 GTGGAAGCCAGCAGACTTGCGGG - Intronic
948032433 2:234829981-234830003 GTGGAAGGCACGAGACTTTGTGG - Intergenic
948830980 2:240598156-240598178 GGGGCAGGCAGGAGACGTGGGGG - Intronic
1169194761 20:3677178-3677200 CTGGCAGGCAGGAGGCCTGGAGG - Intronic
1169273278 20:4216866-4216888 ATGACAGTCAGGAGCCTTTGGGG + Intergenic
1170590061 20:17765088-17765110 GGGACATTCAGGAGGCTTGGGGG - Intergenic
1171963055 20:31509181-31509203 GTGGCATTCGCTAGACTTGGGGG - Intergenic
1173410927 20:42808872-42808894 CGGGCAGTCAGCAGACTTTGAGG - Intronic
1173581241 20:44148390-44148412 ACGGGAGTCAGGAGACATGGGGG - Intronic
1175227482 20:57453056-57453078 GTGGAAGGCAGGACACCTGGTGG + Intergenic
1176058528 20:63161502-63161524 ATGGCAGGAAGGGGACTTGGAGG - Intergenic
1177129729 21:17241157-17241179 CTCCCAGTCAGGAGACATGGGGG - Intergenic
1178202682 21:30425730-30425752 GGGGCTGTCAGGAGACCTGCTGG - Exonic
1178203545 21:30436784-30436806 GGGGCTGTCAGGAGACCTGCTGG - Intergenic
1180174483 21:46081055-46081077 GTGGTGGGCAGGAGACTGGGTGG - Intergenic
1180583173 22:16860533-16860555 CTGGGATTCAGGAGACTTGGTGG + Intergenic
1182079913 22:27521701-27521723 GATGCAGCCAGGAGACCTGGGGG - Intergenic
1182762149 22:32731297-32731319 CTGGGATTCAGGACACTTGGGGG + Intronic
1183355537 22:37357103-37357125 GGGGCAGTGAGGAGACCTTGGGG - Intergenic
1183795507 22:40113770-40113792 GGGGATGCCAGGAGACTTGGTGG - Intronic
1185346591 22:50313271-50313293 GTGGCTGGCAGGACCCTTGGAGG - Intronic
950527980 3:13535836-13535858 GTCTCAGGCAGGAGCCTTGGGGG + Intergenic
951289694 3:20860649-20860671 GTGGCAGGCAGAAAAGTTGGAGG + Intergenic
951609859 3:24479819-24479841 TTGGCAGTCAGAAGACAAGGTGG - Intronic
953879252 3:46683216-46683238 GCGGCAGTCGGGAGGCTGGGAGG + Exonic
954531153 3:51321012-51321034 CTCCCAGTCAGGAGACATGGGGG - Intronic
955192391 3:56773560-56773582 GTGCAAGTGAGGGGACTTGGAGG - Intronic
958261200 3:91383209-91383231 CTCTCAGTCAGGAGACATGGTGG + Intergenic
959534676 3:107471048-107471070 CTCGCAGTCTGGAGACATGGGGG - Intergenic
966745722 3:183274865-183274887 GAGGCAGTGAGGAGTCTTTGAGG - Intronic
968188458 3:196649970-196649992 GTAGCAGTCAGGGGAGGTGGGGG + Intronic
968470123 4:776841-776863 GTGGCACTAAGGAGATTTGGGGG - Intergenic
968914102 4:3489652-3489674 GTGGCAGAGAGAAGACTCGGTGG - Intronic
971988080 4:33853154-33853176 GAGGCTGTCTGTAGACTTGGTGG + Intergenic
973273071 4:48280600-48280622 CTCCCAGTCAGGAGGCTTGGGGG - Intergenic
973642667 4:52918736-52918758 GTGGCAGTGAGGGGACATGTAGG - Intronic
974737232 4:65952330-65952352 ATGGGAGTCAGGGGACTTAGTGG - Intergenic
976548549 4:86366680-86366702 GTGGCAGTAAGGAGATTTCTGGG + Intronic
976852538 4:89564636-89564658 GTGGCACTAAGGAGAGTTTGGGG - Intergenic
977673446 4:99722168-99722190 GTGGCAGTCAGAAGAATGGCAGG + Intergenic
978139129 4:105297647-105297669 GTCCCAGTCAGGAGGCATGGGGG - Intergenic
978408186 4:108401033-108401055 ATGGTAGTCAGGAGATTCGGGGG + Intergenic
979297692 4:119052111-119052133 GTGCCACTCAGGAAATTTGGAGG + Intronic
981202111 4:141992466-141992488 CTCCCAGTCAGGAGGCTTGGGGG + Intergenic
981454742 4:144940432-144940454 TTGGCAATTAGGAGATTTGGGGG - Intergenic
982122316 4:152155132-152155154 TTGGCAGTCAGGTGCGTTGGGGG + Intergenic
982733483 4:158980390-158980412 CTCCCAGTCAGGAGACATGGGGG - Intronic
983015150 4:162604448-162604470 GTGAAAGTCAGGAGAATTTGGGG - Intergenic
983563211 4:169122223-169122245 GTGGCAGCCAGGAGAGGGGGTGG + Exonic
984208165 4:176812743-176812765 GTGGCACTCAGAAGGCTTGAGGG - Intergenic
985695962 5:1340260-1340282 GTGGCTGTAAGGAGACTGAGAGG + Intronic
985813121 5:2105147-2105169 CTGGGAGTCAGGGTACTTGGGGG + Intergenic
986187587 5:5459291-5459313 GTGGCAGTTAGGGGAGATGGAGG + Intronic
986335422 5:6751453-6751475 GGGGCAGTGAGGAAACTTGCAGG - Intronic
987922156 5:24297009-24297031 GTGCCTGTCAGGGGGCTTGGGGG - Intergenic
989192273 5:38682887-38682909 CAGGCAGTGAGGAGACTTGGGGG - Intergenic
991223636 5:64243776-64243798 GTCCCAGTCAGGAGACTCGGGGG - Intronic
991564900 5:67995040-67995062 GTAACAGTCAGGACACTTGCAGG - Intergenic
993695685 5:91058912-91058934 GGGGTAGTCAGGAGACTTTGTGG - Intronic
999060149 5:148625027-148625049 GGGGAGGTCAGGAGGCTTGGGGG + Intronic
999248870 5:150169749-150169771 GTGGCAGGCTGAAGACCTGGTGG - Intronic
999978869 5:156939731-156939753 TTAGGAGTCAGAAGACTTGGTGG - Intronic
1000193704 5:158937946-158937968 CTGGCAGCCAGGAGCCATGGAGG - Intronic
1000701638 5:164458186-164458208 ATGGCTGCCAGGAGACTTGAGGG - Intergenic
1001740713 5:174050869-174050891 GGGGCAGTGTGGAGGCTTGGCGG - Intronic
1002791124 6:438529-438551 GTGGCAGTCAGAAGTCATGGAGG - Intergenic
1002996182 6:2287211-2287233 CTTCCAGTCAGGAGACATGGGGG - Intergenic
1006188141 6:32191949-32191971 TTGGCAGACAGGAGCCGTGGGGG + Intronic
1007293097 6:40801816-40801838 GTGGCAGGAGGGAGACTGGGAGG + Intergenic
1008993965 6:57636941-57636963 CTCCCAGTCAGGAGACATGGTGG - Intronic
1009182568 6:60536031-60536053 CTCCCAGTCAGGAGACATGGTGG - Intergenic
1010023611 6:71190029-71190051 CTGGCTGTCAGGAAAGTTGGTGG + Intergenic
1012415986 6:99014212-99014234 GGGGCACTCAGAAGACTTAGTGG + Intergenic
1013390314 6:109679640-109679662 CTCCCAGTCAGGAGACATGGGGG - Intronic
1013660925 6:112296329-112296351 GTGGATGCCAGGAGACTAGGAGG + Intergenic
1014908266 6:127057353-127057375 GTGGCAGGCAAGAGAGTTTGTGG + Intergenic
1016390107 6:143565976-143565998 GTGGAAGTCAGGAGGCTTGTGGG + Intronic
1017873186 6:158503172-158503194 GGGGCTGGCAGGAGACTTGGGGG - Exonic
1019173785 6:170149557-170149579 GTGGCAGGCAGCAGGCTTGTTGG - Intergenic
1019173827 6:170149740-170149762 GTGGCAGGCAGCAGGCTTGCTGG - Intergenic
1019173922 6:170150207-170150229 GTGGCAGGCAGCAGGCTTGTTGG - Intergenic
1019332660 7:468216-468238 GTGACAGTCATGAGAGGTGGTGG - Intergenic
1019499268 7:1356204-1356226 GGGGCACTCAGGAGCCATGGAGG - Intergenic
1020854070 7:13395070-13395092 GTGGCAGACAGGAGACTGAAAGG - Intergenic
1020884418 7:13804093-13804115 GTCCCAGTCAGGAGACACGGGGG - Intergenic
1021348923 7:19565014-19565036 GTGGCAGTCAGCAGAGAGGGAGG - Intergenic
1026371964 7:69709097-69709119 GTTGCAGTGAGCAGACTTAGCGG + Intronic
1027038821 7:74946241-74946263 GTTGCAGTCAGCAGACATCGAGG - Intergenic
1027051843 7:75025619-75025641 TGGGCAGGCAGGTGACTTGGGGG - Intergenic
1027637148 7:80689691-80689713 GTCCCAGTCAGGATACATGGAGG - Intergenic
1028204229 7:87997766-87997788 GAGGAAGGCAGAAGACTTGGTGG - Intronic
1029392360 7:100283738-100283760 GTTGCAGTCAGCAGACATCGAGG + Intergenic
1032312517 7:130801982-130802004 CTCCCAGTCAGGAGACATGGGGG + Intergenic
1033658104 7:143386783-143386805 ATGGCTGGCAAGAGACTTGGAGG + Intronic
1034327821 7:150253351-150253373 GTGGACATCAGGAGACTTGAGGG - Intronic
1034765387 7:153716082-153716104 GTGGACATCAGGAGACTTGAGGG + Intergenic
1035320664 7:158027258-158027280 GTGGAAGCCAGGAGACGAGGTGG - Intronic
1036799972 8:11783458-11783480 GTGGGAGTCAGAAGACCTGAGGG + Intronic
1037900327 8:22684428-22684450 GTGGTAGCCAGGAGAGGTGGTGG + Intergenic
1038083242 8:24163976-24163998 CTCCCAGTCAGGAGACATGGGGG + Intergenic
1038687662 8:29733299-29733321 GCAGGAGTCGGGAGACTTGGTGG - Intergenic
1044783792 8:95773008-95773030 GTGGCAGGAAGGAGAATAGGTGG + Intergenic
1044999960 8:97870046-97870068 GGGGCAGTCAAGAGACTTCAGGG + Intronic
1046573902 8:116001129-116001151 GTGGGAGTGAGGAGGGTTGGAGG - Intergenic
1048336159 8:133504012-133504034 GTGGCAGAAAGGAGGCTGGGAGG + Intronic
1049249674 8:141581649-141581671 GAGGCAGTCACGAGGCTGGGAGG + Intergenic
1049330246 8:142046605-142046627 GTGGCAGGAGGGAGAGTTGGTGG + Intergenic
1049491227 8:142904159-142904181 GTGTCAGTCTGGAGGCCTGGGGG - Intronic
1050337548 9:4604056-4604078 GTGGAGGACAGGAGACTTGGAGG - Intronic
1053007923 9:34616278-34616300 GAGGCATCCAGGAGAGTTGGGGG - Intronic
1053314789 9:37042054-37042076 ATGGGAGCCAGGAGACTAGGAGG - Intergenic
1057519298 9:95748521-95748543 GTGGCAAACAGGAGCCCTGGAGG - Intergenic
1059320645 9:113465764-113465786 GAGGCAGACAGGAGCCTGGGTGG + Intronic
1060549866 9:124479814-124479836 GAGGCAGGCAGGGCACTTGGTGG + Intergenic
1061741969 9:132713729-132713751 GTGGTTGCCAGGAGACTGGGTGG + Intergenic
1061760654 9:132848823-132848845 TTGGAAGTCAGGTGACTGGGAGG + Intronic
1061783641 9:133010117-133010139 GGGGCAGACAGGGGACCTGGGGG - Intergenic
1061906548 9:133702284-133702306 GTGGAGGTGAGGAGTCTTGGGGG - Intronic
1062025092 9:134336547-134336569 GTGGCCGGCCGGAGCCTTGGTGG + Intronic
1062432584 9:136532678-136532700 GGGGCTGTCAGGAGCCCTGGGGG + Intronic
1186480228 X:9891015-9891037 GTGGCTGTCAGAGAACTTGGTGG - Exonic
1187050470 X:15690965-15690987 GTCTCACTTAGGAGACTTGGGGG + Intronic
1187959371 X:24554008-24554030 GGGCCAGTCAGGAGACTGAGAGG + Intergenic
1188668306 X:32852023-32852045 CTCGAAGTCAGGGGACTTGGTGG + Intronic
1188705694 X:33326848-33326870 GTGACTGTCAGGAGATATGGAGG + Intronic
1189788408 X:44580948-44580970 TTGGAAGTCAGGAGACTAGAAGG + Intergenic
1189810003 X:44773053-44773075 GTGGCAGTCACAAGGCATGGTGG - Intergenic
1192662202 X:73053055-73053077 CTTCCAGTCAGGAGACGTGGGGG - Intergenic
1192763159 X:74118035-74118057 GTGTCAGTCTGGAGGCCTGGGGG - Intergenic
1193404539 X:81084606-81084628 CTCCCAGTCAGGAGGCTTGGGGG - Intergenic