ID: 1102033938

View in Genome Browser
Species Human (GRCh38)
Location 12:109760346-109760368
Sequence CTCCGGTTATGGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102033931_1102033938 -4 Left 1102033931 12:109760327-109760349 CCCTAAAGGACCAGTGAGGCTCC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1102033932_1102033938 -5 Left 1102033932 12:109760328-109760350 CCTAAAGGACCAGTGAGGCTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102033938 Original CRISPR CTCCGGTTATGGAGGAAAGA GGG Intronic
903708225 1:25302597-25302619 CTCCGGTTCTGGAGCAGTGAAGG + Intronic
903718887 1:25389816-25389838 CTCCGGTTCTGGAGTAGTGAAGG - Intronic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
907520887 1:55022570-55022592 CTGCGTTTATGGAGGAGAGAAGG - Intergenic
908098691 1:60768013-60768035 CTCCTTTTCTGGGGGAAAGAAGG + Intergenic
909233928 1:73128203-73128225 ATTCAGTTATGGAGGAATGAAGG - Intergenic
909925119 1:81429796-81429818 TTCGGGTAATGGAGGAAAGGAGG + Intronic
912878110 1:113383557-113383579 GTGGGGTTATGGAGGAGAGAAGG - Intergenic
913314906 1:117541316-117541338 CTCTGTTTGTGGAGAAAAGAAGG + Intergenic
915716871 1:157952534-157952556 CTCCCTTTATGTGGGAAAGAAGG + Intergenic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1072256339 10:93624873-93624895 CTCCTCTTATGGTGGAAAGATGG + Intronic
1072799970 10:98385889-98385911 GTCCAGGTATAGAGGAAAGAAGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1076002978 10:126927090-126927112 CTCCAGTCATTGAGGAAATAAGG + Intronic
1076253160 10:128998861-128998883 CTCCGATTTTGATGGAAAGAAGG + Intergenic
1077156364 11:1093670-1093692 CTCTGCTTATGGACCAAAGATGG + Intergenic
1084949787 11:72658270-72658292 CCCAGGTTATGGAGGAAACAAGG + Intronic
1089679093 11:120109574-120109596 CTCCTATTAGGGAGGAAGGAGGG - Intergenic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1101553877 12:105788606-105788628 ATCATGCTATGGAGGAAAGAAGG + Intergenic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102053187 12:109878186-109878208 GGCTGGTTTTGGAGGAAAGAGGG - Intronic
1102539551 12:113608814-113608836 CTCCCAGTATGGAGGAAAGAAGG + Intergenic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1107887238 13:44883853-44883875 CTCCACTGATGGAGGCAAGATGG - Intergenic
1110908417 13:80922625-80922647 CTCTGGTTCAGGATGAAAGATGG - Intergenic
1111234514 13:85391156-85391178 CTCCTGTTATGCAGGGAAAATGG - Intergenic
1114255682 14:20999575-20999597 CTCAGGCTATGGAACAAAGATGG - Intronic
1115512056 14:34147398-34147420 CTCCGGATAAGGAGGAGGGAAGG + Intronic
1122290389 14:100677711-100677733 TTCCGGTTCTGGGGGAAGGAAGG - Intergenic
1128877566 15:71214865-71214887 GTCGGTTTTTGGAGGAAAGAGGG - Intronic
1128890546 15:71328021-71328043 CTATTGTAATGGAGGAAAGAAGG - Intronic
1140142028 16:72267223-72267245 CTCAGGTGAAGGAGGCAAGAAGG - Intergenic
1142063779 16:88048369-88048391 TTTCAGTAATGGAGGAAAGAAGG + Intronic
1144028600 17:11300406-11300428 CTCGGATTCTGAAGGAAAGAGGG - Intronic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1147594074 17:41705536-41705558 CTCCAGCGATGGAGGAAAGGAGG + Intergenic
1149155663 17:53626851-53626873 GTCTGGTTGTGGAGGAAATAGGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1154340355 18:13497718-13497740 CTCCCTTTGGGGAGGAAAGAAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164424423 19:28128288-28128310 TTCCAGTGATGGAGGAGAGATGG - Intergenic
1165608958 19:37133919-37133941 CTCCGGTGGTGGAGGAAAAGAGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
1168699817 19:58430936-58430958 CTCTGGTGATGGAGAAAGGAAGG + Intergenic
925565335 2:5247508-5247530 CTCCGTTCATTGAGGAGAGAGGG + Intergenic
927374037 2:22392607-22392629 CTCAGGTTATAGAGGACAAAAGG - Intergenic
927757013 2:25716844-25716866 CTCCTGACATGGAGGAAAGAAGG - Intergenic
929085203 2:38161161-38161183 CTTCAGTTCTGGAGGAAAGCTGG + Intergenic
930942384 2:57028274-57028296 GTCTGGTCATGGAGCAAAGAGGG + Intergenic
932240476 2:70152526-70152548 CTCCCTTTATGAAGGAAAGATGG - Intronic
938152412 2:128899139-128899161 CTCGGGTTAGGGGGGAAAGGTGG - Intergenic
941976013 2:171406303-171406325 CACCTGTTATGTATGAAAGAGGG + Intronic
947316616 2:228866159-228866181 CTCCTGTCATGGAGCAAAGTTGG + Intronic
948607383 2:239144627-239144649 CCCCTGTTACGCAGGAAAGACGG - Exonic
1171957738 20:31472862-31472884 CTCAGGTCCTGGAGGACAGAGGG - Intronic
960465963 3:117997079-117997101 CTCCGGTTCTGGATGGAACAGGG - Intergenic
970581512 4:17477908-17477930 CTCTGGTTAGGGAGGCATGACGG - Intronic
974845143 4:67342793-67342815 CACAGGTTATGGATGAAAGAAGG + Intergenic
977723860 4:100271362-100271384 CTCTTGTGGTGGAGGAAAGAGGG + Intergenic
979919628 4:126480360-126480382 CCCAGGTTATTGTGGAAAGAAGG + Intergenic
985191363 4:187376909-187376931 CTCCAGTTAAGGAGGGAAGCAGG + Intergenic
986094092 5:4538739-4538761 CTCAGGTTATGGAATAAAGAAGG - Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
991638891 5:68733873-68733895 CTCAGGTCATGGAGGAGAAATGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996500347 5:124209632-124209654 CTTTGCTTTTGGAGGAAAGAGGG - Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1004790026 6:19015129-19015151 CTAGGGTTAAGGAGGAATGAAGG + Intergenic
1011421632 6:87179821-87179843 CTCCGTACATGGAGGAAATAGGG - Intronic
1011773960 6:90707437-90707459 CTCCTGTGAAGGAGGAAAGGTGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014098342 6:117483121-117483143 CTCTGGTTTTGGGGGAAGGAAGG - Intronic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG + Exonic
1019083372 6:169452010-169452032 CTCCATTTATGGAGACAAGATGG + Intergenic
1024567490 7:50693998-50694020 CTTCTGTTATGGAGAATAGAGGG + Intronic
1027704540 7:81511808-81511830 TACTGGTTATGGAGAAAAGATGG + Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1031320614 7:120322702-120322724 CTCCGGTTAAGAATGAAAGATGG + Intronic
1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG + Intergenic
1034681799 7:152934465-152934487 CTCCACTTTTGGAGGAATGAAGG + Intergenic
1042428031 8:68672156-68672178 GTCTGGTTATGGAGGCAAGGGGG + Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1052395054 9:27928628-27928650 CGCAGGTTATGGAGAATAGAGGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1186154431 X:6710855-6710877 CTCCAGCTATGGAGGAAAACTGG - Intergenic
1186371959 X:8955877-8955899 CTCATGAGATGGAGGAAAGAGGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1194786443 X:98090130-98090152 CTCCAATTATTGAGGAAACAAGG + Intergenic
1196313679 X:114197780-114197802 CCAGGGTTATGGAGGAAGGAGGG + Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic