ID: 1102034281

View in Genome Browser
Species Human (GRCh38)
Location 12:109761954-109761976
Sequence CTGGGGAAGCAGTTGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102034281 Original CRISPR CTGGGGAAGCAGTTGGTGCA GGG (reversed) Intronic
900166782 1:1247104-1247126 TTGGGGAAGCAATGGGGGCAGGG - Intergenic
900893714 1:5468289-5468311 CTCAGGCAGCAGTAGGTGCAAGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901295427 1:8157402-8157424 TTGGAGACGCAGTTGGTACATGG + Intergenic
902777500 1:18684156-18684178 CTGGGGAAGAAGGTGGTGGCTGG + Intronic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
904369486 1:30039554-30039576 CTGAGGCAGCAGTAGGTACAAGG - Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
904809289 1:33152935-33152957 CTGAGGAGGCAGTTTGTGCCTGG + Intronic
904873018 1:33633632-33633654 CTGGGGAAGTTGTTGGTTCCTGG + Intronic
905132326 1:35770148-35770170 CTGGGGGAGCTGGAGGTGCACGG + Intergenic
906112330 1:43332292-43332314 CTGGGGAAGCAATGGGAACAAGG + Intergenic
906956207 1:50377011-50377033 TTGGGGAAACAGTTGGTGTTTGG - Intergenic
907258917 1:53201444-53201466 CTGGGGAAGAATCTGTTGCATGG - Intronic
907822813 1:57987767-57987789 CTGGTGAAGGAGTTGGGGGAGGG + Intronic
910107243 1:83644806-83644828 CTAGGGCAGCTGTTGGTCCAGGG + Intergenic
911797026 1:102088620-102088642 ATGGGGAAGCATTTAGTCCATGG + Intergenic
912156316 1:106924834-106924856 CTTGGGAAGCAGTTGTTCTAGGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914449044 1:147774421-147774443 CTGGGGGAGAAGTTGGAGAATGG - Intergenic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915294672 1:154911678-154911700 GTGGGGAAGCAGTGGGTCAAGGG - Intergenic
916170105 1:161995574-161995596 CTGGGGAGGCAGTTGGGGAGAGG + Intronic
919005653 1:191896346-191896368 CTGGGGAAGATGTTGGTCAAAGG - Intergenic
919469169 1:197957586-197957608 CAGGGGAAGCTGATGATGCAGGG + Intergenic
919816446 1:201443829-201443851 CTGGGGAAGCAGGGTTTGCAGGG - Intergenic
919974632 1:202602637-202602659 CAGAGGAGGCAGTTGGGGCAGGG + Intronic
921429741 1:215051666-215051688 CTTGGGAAGCAGCAGATGCAAGG + Intronic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
923234285 1:232017616-232017638 CTGGGTAAGCAGTTGAGTCACGG + Intronic
923272788 1:232372757-232372779 CTGGGGTGTCAGTTGGTACAGGG + Intergenic
924395756 1:243618950-243618972 ATGTGGGATCAGTTGGTGCAGGG - Intronic
1063007643 10:1989215-1989237 CTGAGGATGCATTTGGTTCAGGG + Intergenic
1064612008 10:17113550-17113572 CTGGAGATTCAGTTGCTGCAGGG + Intronic
1064665344 10:17644657-17644679 CTGGTGTAGCATCTGGTGCAGGG + Intronic
1065052539 10:21810599-21810621 ATGGGGAAGCAGTACGTCCATGG - Intronic
1069487304 10:68832166-68832188 CTGGGGAAGGAGGTACTGCAGGG + Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069548975 10:69349311-69349333 CTGGTGAGGCAGGTGGGGCAGGG - Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1070024203 10:72616340-72616362 CTGGAGAAGCATTTAGTTCAAGG + Intronic
1070490524 10:76971627-76971649 CAGAGGAAGCAGGTGGTACAGGG - Intronic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072569008 10:96642348-96642370 CTGGGGAGGCAGTGGTTACAGGG + Intronic
1073087404 10:100901915-100901937 AAGAGGATGCAGTTGGTGCAGGG - Intergenic
1074231273 10:111538318-111538340 CTGAGGAAGCTGTTGTGGCAGGG + Intergenic
1075117475 10:119638939-119638961 CTGGGGGAGCAGTTCCAGCAGGG + Intergenic
1075260328 10:120958033-120958055 CTGGGGGAGCAGTTGGTACAGGG + Intergenic
1075336806 10:121614638-121614660 CTGGAGAAGCAGTTAGCACAAGG + Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1075917306 10:126179789-126179811 CTGGGGTAGCAGTTCATGCATGG + Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077278248 11:1728069-1728091 CTGGGGAAGCAGCTGATTCCAGG - Intergenic
1077305461 11:1866889-1866911 CTGGGGCTGCAGTTGGTGCTGGG - Exonic
1077458463 11:2695287-2695309 CTGGAGAAGCTGTTTGTGTAGGG - Intronic
1078682012 11:13486228-13486250 GTGGCGACGCAGTTGCTGCAGGG + Intergenic
1079291495 11:19192120-19192142 CTGGGCAAGCAGTTGAAGCAAGG + Intronic
1079709669 11:23666053-23666075 CTTGGGAAGTAGATGGGGCAGGG + Intergenic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1081906311 11:46672614-46672636 CTTGGGAAGCAGTTGGTGATGGG - Exonic
1081997360 11:47374206-47374228 CTGGGGATGGAGTTGGGGGAGGG + Intronic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1085564121 11:77497497-77497519 CTGTGAAAGCAGTTGGTAAAAGG - Intergenic
1085689915 11:78656488-78656510 CTGGGGGAGCAGTGAGGGCAGGG - Exonic
1085868663 11:80324758-80324780 AAGGGGAAGCATTTGGTGCAAGG - Intergenic
1086092870 11:83021417-83021439 CTGGGGAATGAGGTGGTGCCTGG - Intronic
1087254528 11:95939236-95939258 CTGGGGCTGCAGTTCCTGCAGGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088814985 11:113414589-113414611 CAGAGGAGGCAGTTGGGGCAAGG + Intronic
1089002880 11:115067017-115067039 CTGGAGGAGCAGTGGGTGCCTGG - Intergenic
1089269244 11:117290218-117290240 CTTGGGAAGCTCTTGATGCAAGG - Intronic
1089385550 11:118065165-118065187 GTGGAGAAGCAGGTGGGGCAGGG - Intergenic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091369470 11:135046602-135046624 CTGGGGAAGCACTTGTGGGATGG - Intergenic
1091531222 12:1357843-1357865 CTGGGGATGAAGTTGGAGGAGGG - Intronic
1091682124 12:2534601-2534623 CTGGATAAGCATTTGCTGCAGGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1095981332 12:47976406-47976428 CTGGGGAAGCTGTGGGCTCAGGG - Intronic
1096262052 12:50099099-50099121 CAGGGGATGCTGTTGGTTCAAGG + Exonic
1096843517 12:54392766-54392788 GAGGGGAAGAAGTTGGTGAAAGG + Intergenic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1097269240 12:57764309-57764331 CTGGGGAAGCAACTAGTGGATGG - Intronic
1098160865 12:67648010-67648032 CTGGGGAAGCAGTTGGCTGTGGG - Intergenic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1099647087 12:85371060-85371082 TTAGGAAAGCAGTTTGTGCAAGG + Intergenic
1099857019 12:88180649-88180671 CTGGGGCTGCAGGTGCTGCAGGG + Intronic
1101069563 12:101060031-101060053 CTGCGGAAGCAGTGTTTGCAGGG - Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102119549 12:110429636-110429658 GTGGGGACGCAGCAGGTGCAGGG + Intergenic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1103371367 12:120421990-120422012 CTGGGGAAAGATTTGGTGCTGGG + Intergenic
1103443203 12:120978642-120978664 TTGGGGGGGCAGTGGGTGCAAGG + Exonic
1103607321 12:122096938-122096960 CTGGGGAATGACTTGGTACATGG + Intronic
1103936725 12:124481087-124481109 CTGAGGAAGCAGGGGGTGAAGGG + Intronic
1104946091 12:132415477-132415499 CTGGGGAAGCACTTTGGGCAGGG - Intergenic
1108140192 13:47412568-47412590 CTGGAGAAGCAGTTGCTGATGGG + Intergenic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1108468272 13:50740997-50741019 ATGGGGAAGCAGGTGGTGGTAGG - Intronic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1112138894 13:96615868-96615890 CTGGGAAAGCAGTTGCTCCATGG + Intronic
1113801201 13:113087250-113087272 CTGGGCAAGCTGCTGATGCAGGG + Exonic
1113932474 13:113975615-113975637 CTGGGCAAGTGGTGGGTGCAGGG + Intergenic
1115488105 14:33932114-33932136 ATAGGGATGCAGTAGGTGCAAGG + Intronic
1117275909 14:54192973-54192995 ATGGGGAAGCAGTGGGTGCTTGG - Intergenic
1117956290 14:61125995-61126017 CTGGGGAAGCAGATGTCCCAAGG - Intergenic
1118398240 14:65355717-65355739 CTAGGGGAGCAGTTGGTGCCTGG - Intergenic
1122853438 14:104548678-104548700 CTGGGGAGGATGTTGGAGCAGGG - Intronic
1123115973 14:105894222-105894244 CTGGGGCAGCTGTTGGGACAGGG + Intergenic
1123130107 14:105978641-105978663 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1123580360 15:21709767-21709789 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1123617008 15:22152390-22152412 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127616476 15:60690949-60690971 CTGTGGAAGGAGTTTGAGCAGGG - Intronic
1127877291 15:63122166-63122188 CTGGCGAAGCACCTGGAGCAGGG - Exonic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1128891334 15:71334542-71334564 CTCTGGGGGCAGTTGGTGCATGG + Intronic
1129059999 15:72853205-72853227 TGGGGAAAGCAGTTGGGGCACGG - Intergenic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1131087477 15:89589019-89589041 CAGGGGAAGCAGTGTGTTCAGGG + Intronic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131683406 15:94747380-94747402 TTGGGGAAGCAGATGTTGAACGG - Intergenic
1131697408 15:94893019-94893041 ATGGGGATGCATTTGTTGCAAGG - Intergenic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1202989230 15_KI270727v1_random:444012-444034 CTGGGGGAGCAGTTCCAGCAGGG - Intergenic
1132981623 16:2741189-2741211 CTGAGGCAGGGGTTGGTGCAGGG - Intergenic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1134039021 16:11053673-11053695 CAGGGGAAGAAATTGATGCATGG + Intronic
1134850366 16:17473938-17473960 ATGGGAAAGAAGTAGGTGCAGGG + Intergenic
1135357332 16:21780469-21780491 CTGGGGCAGGAGTGGGTCCAGGG - Intergenic
1135416874 16:22275128-22275150 CTGGGGAAGCACATCATGCATGG + Intronic
1135455836 16:22596585-22596607 CTGGGGCAGGAGTGGGTCCAGGG - Intergenic
1137441860 16:48504769-48504791 CTGCGGAAGCTGGTGGGGCAGGG + Intergenic
1138793735 16:59942220-59942242 CTGAGGAAGTAAGTGGTGCAAGG + Intergenic
1139488285 16:67271601-67271623 CTGGGGAGGGAGTTGGGGCAGGG - Exonic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140333121 16:74076780-74076802 CTGGGGAAGGAGTGGGGGCTAGG - Intergenic
1140707647 16:77645498-77645520 CTGGGGACTCAGTTGTTGCATGG + Intergenic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1142124375 16:88402849-88402871 CTGGGGCAGCGGTTGGCCCAGGG + Intergenic
1142442305 16:90106660-90106682 CTGGGGAAGCTGTGGCTTCATGG + Intergenic
1142764557 17:2057954-2057976 CTGGGGAAGCCCTTGCCGCACGG - Exonic
1143205882 17:5139053-5139075 ATGGGGAAGCCGTTGGGGCATGG - Intronic
1144730148 17:17521352-17521374 CTGGGGATGCAGGCTGTGCAGGG - Intronic
1145242932 17:21250179-21250201 CATGGGGAGCAGGTGGTGCAGGG - Intronic
1145831654 17:27921228-27921250 CATGGGAGGCAGGTGGTGCATGG - Intergenic
1146802965 17:35842010-35842032 CTGGGGAAGGAGATGGTGTCAGG - Intronic
1147258435 17:39195561-39195583 CTGGGGAGGGAGTAGGGGCATGG + Intronic
1147479466 17:40745446-40745468 CTGGGGACCAAGTTGGTGCAAGG + Intergenic
1147661868 17:42121142-42121164 CTGGGGCTGCAGCTGGGGCAGGG + Exonic
1148136125 17:45293047-45293069 CTGGGGAGGCACTGTGTGCAGGG - Intronic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148520139 17:48265837-48265859 CAGGGGAGGCATTTGGAGCATGG - Intronic
1149591334 17:57831936-57831958 ATGGGGAGGCAGTGGGTGCCAGG - Intergenic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1151199235 17:72455646-72455668 CTTGGGAGGCAGATGCTGCAAGG - Intergenic
1151229198 17:72670835-72670857 TTGGGGAAGTAGTTGATTCAAGG - Intronic
1151465592 17:74282918-74282940 CCGGGGGAGCAGTTGGTCCTGGG - Intronic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152091240 17:78249073-78249095 CTGGGGAAGCCCTCGGTGGACGG - Intergenic
1152120424 17:78415005-78415027 CTGGTGAAGCTGCTGCTGCAGGG - Exonic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152450060 17:80373082-80373104 CGGGGGATGGAGTTCGTGCAGGG + Exonic
1152612530 17:81322792-81322814 CGGTGGCAGCAGCTGGTGCAGGG - Intronic
1153476809 18:5506115-5506137 CTGGGCAAGCAGTTACTGGATGG - Intronic
1154024833 18:10697280-10697302 CTGGGGATGGAAGTGGTGCATGG - Intronic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1156526431 18:37772010-37772032 CTGGGGAATCCGTGTGTGCAAGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157318754 18:46618241-46618263 CTGGTGATGTAATTGGTGCAGGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1161281418 19:3447778-3447800 TGGGGGAAGCAGGTGGTCCAGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1163655361 19:18542653-18542675 CTGGGGAAGGATTTGGGCCAGGG - Intronic
1163765218 19:19160042-19160064 CCTGGGAAGCAGTGGTTGCAGGG - Intronic
1166643310 19:44512801-44512823 CTGGGGAAGAGGCTGGTGCTGGG - Intronic
1167550327 19:50155834-50155856 CGTGGGAACCAGATGGTGCAGGG - Intronic
1167799073 19:51728646-51728668 CTGGGGAACCAGTGAGGGCAAGG + Intergenic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
928282873 2:29964261-29964283 CTGGAGAAGCAGTTGCTGCTTGG - Intergenic
928856997 2:35814233-35814255 GTGGGAAAGGGGTTGGTGCATGG - Intergenic
929342951 2:40845102-40845124 CTGGGGAAGTTGTTGTTGAATGG - Intergenic
931784624 2:65608083-65608105 CTGGTGATGCAGGTGGGGCAGGG - Intergenic
931788031 2:65639252-65639274 CTGGGGCAGCTGGTGGAGCAGGG - Intergenic
932149469 2:69356495-69356517 CCGGGCAAGCAGTTGGCACAAGG - Exonic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
933240296 2:79913428-79913450 CTGAGGCATCAGTCGGTGCAGGG + Intronic
934789362 2:97045592-97045614 ATGGGGGAGCAGTTGATGCCTGG + Intergenic
934817117 2:97336948-97336970 ATGGGGGAGCAGTTGATGCCTGG - Intergenic
934820579 2:97371536-97371558 ATGGGGGAGCAGTTGATGCCTGG + Intergenic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
936027884 2:109047207-109047229 TTGGGGAAGCAATGGGAGCAGGG - Intergenic
936634912 2:114244916-114244938 CTGGGAAAGCAGCTGGGGCTAGG - Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
940205406 2:151196525-151196547 TTGGGAAAGAAGTTGGGGCATGG - Intergenic
941167873 2:162103013-162103035 CTGAGGAAGCTGATGCTGCATGG - Intergenic
941666395 2:168247391-168247413 CTGGGGAAGCTGGACGTGCACGG + Exonic
942167398 2:173255184-173255206 GCAGGGAAGCAGTTGCTGCAGGG + Intronic
944706363 2:202292865-202292887 TTGGGGAATTAGTTGGAGCACGG + Exonic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
948310870 2:236985676-236985698 CTGGGGAAGGAGTGGGGGCTGGG - Intergenic
948356841 2:237384847-237384869 CTGGAGAAGCAGCTGCTGTAGGG - Intronic
948578976 2:238971378-238971400 CTGGTGCAGCACTTGGTGTATGG + Intergenic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1170084190 20:12510711-12510733 ATGGGGAGGAAGTGGGTGCAAGG + Intergenic
1170681921 20:18533588-18533610 CAGGTGAAGCAGTTAGTGCCTGG + Intronic
1172091500 20:32436031-32436053 CTTGTGATGCAGTTGCTGCAGGG + Exonic
1173023260 20:39285316-39285338 CTTGGGAAAGAGTTGGGGCATGG + Intergenic
1173142286 20:40494800-40494822 GGAGGGAAGCAGTTGGTGCTGGG - Intergenic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1174294390 20:49534566-49534588 CTGGGGAAGCAATCAGTGCTAGG + Intronic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175744853 20:61449065-61449087 CTGGGGAAGCAGTTGGGGATGGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176373630 21:6076794-6076816 CTGGCGGAGCGGTTGGTGGAGGG + Intergenic
1177120625 21:17132969-17132991 CTGGTGATGCAGTTGGTCAAAGG - Intergenic
1178594499 21:33940864-33940886 CAGGGGAGGCAGCTGGTGCCAGG + Intergenic
1179276244 21:39894251-39894273 CTGGGGAAGCAGGTAGTAGAGGG - Intronic
1179407659 21:41138797-41138819 CTCGGGAAGGATGTGGTGCAGGG - Intergenic
1179749847 21:43461449-43461471 CTGGCGGAGCGGTTGGTGGAGGG - Intergenic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1181014487 22:20061375-20061397 ATGGGGAAGGAGCTGGAGCATGG + Intronic
1181099585 22:20530534-20530556 ATGGGAAAGCAGTTGGACCAGGG + Intronic
1181235629 22:21446231-21446253 CTGGGGAAGCCCTTGGCGCAGGG - Exonic
1181631000 22:24151338-24151360 ATGGGGAAGCAATGGGGGCAGGG - Intronic
1182024128 22:27104136-27104158 CTGGGGAAGCAGTTTGCCCTGGG + Intergenic
1182752211 22:32650908-32650930 CTGGGGAAGCAGCTGTTATAAGG - Intronic
1183481338 22:38067181-38067203 CTGGGGAATCAGTGGGGACAGGG - Intronic
1184111930 22:42400728-42400750 CTCAAGAAGCAGGTGGTGCAGGG - Intronic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185196481 22:49473583-49473605 CCTGGGAGGGAGTTGGTGCAGGG + Intronic
949465457 3:4339061-4339083 CTGAGGAAGTAGTTTGTGGAAGG - Intronic
949826185 3:8168335-8168357 CTGGGGAAGGAGTTGGATCAGGG - Intergenic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
952409540 3:33034703-33034725 CTGAGGAAGCAGTTGGTTGATGG + Intronic
952485004 3:33800827-33800849 CTTCAGAAGCACTTGGTGCATGG + Intronic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
956788698 3:72663680-72663702 CTGGGGAAGCAGCTGGCATAAGG + Intergenic
958957896 3:100480993-100481015 GTTGGGAAGAAGTTGGTCCAAGG - Intergenic
961841495 3:129717080-129717102 CTGGGGAAGTAACTGGTGAAGGG - Intronic
963246849 3:143071769-143071791 CTGGGGAAGACGTTGGTGTGAGG + Intergenic
964325485 3:155541529-155541551 ATGGGGAATCAGGTGGTTCATGG + Intronic
965350961 3:167610417-167610439 CTGGGGTAGCAGTGGCTACAGGG + Intronic
965404198 3:168249823-168249845 GTCGGGCAGAAGTTGGTGCAGGG - Intergenic
966738284 3:183207786-183207808 CTAGGCAAGCTGTTGCTGCACGG - Exonic
968362577 3:198157624-198157646 CTGGGGAAGCTGTGGCTTCATGG + Intergenic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969462089 4:7334281-7334303 CTGGGGAAGGAGGAGGTCCAAGG - Intronic
969582961 4:8076476-8076498 CTGAGGAAGGCCTTGGTGCAGGG - Intronic
972681194 4:41308580-41308602 GTGGTGAAGCAGTCTGTGCACGG - Intergenic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
976048623 4:80983686-80983708 CTTAGGAAGGAGTTGGTGCTGGG - Intergenic
976833454 4:89342300-89342322 CTGGGGAAGATGTTGGTCAAAGG - Intergenic
976842755 4:89451109-89451131 CAGAGGCAGCAGTTGGTGCAAGG + Intergenic
976931374 4:90570455-90570477 CTGGTGATGCAGTGGGTTCAAGG - Intronic
977594059 4:98859052-98859074 TTGGGGAAGCAGTTGTTGCTGGG - Intergenic
982961871 4:161849296-161849318 CTGTGGTATCAGTTGGTACAAGG + Intronic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985746693 5:1652168-1652190 CTGGGGAAGAAGGGGGTGCCTGG + Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986827536 5:11538130-11538152 CTAGAGAAGCAGTTGGTTTATGG - Intronic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
993001720 5:82387831-82387853 CTGGGGGAGCTGACGGTGCATGG - Intergenic
996422532 5:123278239-123278261 CGGGGAAAGCAGGTGGTTCAGGG + Intergenic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998174477 5:139893528-139893550 CTGGGGAAGGAGCTGCTGCAGGG - Intronic
1000040922 5:157484709-157484731 CTGGGGAAGGTGGTGGTGAAGGG - Intronic
1001648043 5:173296868-173296890 CTAGGGTAGCAGGTGGAGCAGGG + Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002182825 5:177440392-177440414 CTGGGTATGCAGTTGGGGCGGGG - Intronic
1002583590 5:180226513-180226535 CTGGGGAAGCAGTTCCAACAGGG - Intergenic
1002862564 6:1093370-1093392 CTGGGGAGGTAGGTGGAGCAAGG - Intergenic
1003560843 6:7178511-7178533 AAGGGGAAGAAGCTGGTGCAAGG - Intronic
1004167183 6:13267052-13267074 ATGGTGAGGCACTTGGTGCAGGG - Exonic
1004753399 6:18586260-18586282 CTGGGGAAGCAGTAGGCACCTGG + Intergenic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1006166932 6:32070687-32070709 CTGGGGAAGCAGTCTGTGAGAGG - Intronic
1006303329 6:33205377-33205399 CTGGGGAGGGAGTTGGAGGAGGG + Intronic
1006474369 6:34245185-34245207 GTGGGGACGCAGCAGGTGCAGGG - Exonic
1006630041 6:35424380-35424402 GTGTGGAAGCAGTTGGTGAATGG + Exonic
1007105189 6:39279015-39279037 CTGGGGAAATAGGTGGTGCCAGG - Intergenic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1008793038 6:55262227-55262249 TTGGGGAAACAGTTGGTGTTTGG - Intronic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1014752405 6:125269946-125269968 CTGGTGAAGCTGGTGCTGCAAGG + Intronic
1015738513 6:136427398-136427420 ATGGGGAAGCAGCTGCTTCATGG + Intronic
1018342236 6:162863105-162863127 CTGTGGATGCAGTGTGTGCAGGG - Intronic
1018557016 6:165060521-165060543 ATGGGGAGGCACTTTGTGCAGGG + Intergenic
1019143837 6:169964128-169964150 CCGTGGAGGCACTTGGTGCACGG - Intergenic
1019253105 7:31083-31105 CTGGGGAAGCTGTGGCTTCATGG - Intergenic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023717190 7:43056326-43056348 CAGGGGAAGCATCTGGAGCATGG - Intergenic
1024020341 7:45362640-45362662 CTAGAGAAGCAGATGCTGCAAGG + Intergenic
1024160150 7:46665817-46665839 TTGGGGAAGCAGATGGTGTTTGG + Intergenic
1024208243 7:47182030-47182052 CTTGGGAAGCTGCTGGGGCATGG - Intergenic
1024852787 7:53741026-53741048 CTGTGGCATCAGTAGGTGCAGGG - Intergenic
1024954162 7:54898736-54898758 CTGGAGAAGCAGGTCGTGCTCGG - Intergenic
1025300828 7:57818746-57818768 CTGGGGAAGGGGTTGGGGCTGGG + Intergenic
1026361451 7:69604599-69604621 ATGGGGAAGGAGTTGGAGCTAGG + Intronic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1027411484 7:77924612-77924634 TTGGGGAAGTATTTTGTGCATGG + Intronic
1028131553 7:87181547-87181569 CTGAGGAAGCATCTGGTGAATGG - Intronic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1031658366 7:124387723-124387745 CTTGGGAAGCAGTGGTTGCCAGG + Intergenic
1032284958 7:130532832-130532854 CTGGTGGAGCAGTGGGTGCGGGG + Intronic
1032285753 7:130537369-130537391 CTGGTGGAGCAGTGGGTGCGGGG + Intronic
1032286516 7:130541795-130541817 CTGGTGGAGCAGTGGGTGCGGGG + Intronic
1033652159 7:143351785-143351807 CTGGGGAAGGAGATGGCACAGGG - Exonic
1033657983 7:143386186-143386208 CCGGGGAAGCAGGTGATGGAGGG + Intronic
1034526784 7:151669136-151669158 CTGGGGAAAGAGTGAGTGCAGGG - Intronic
1034532315 7:151703659-151703681 CTGAGGAGGCAGGTGGTGCCTGG - Intronic
1034979517 7:155467204-155467226 CCGGGGCAGCAGTGTGTGCAGGG - Intergenic
1035216386 7:157370808-157370830 CTGGGGAAGCTGCTGCTCCATGG + Intronic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1038056364 8:23861985-23862007 TGGGGGAAGGAGTTGGAGCAAGG - Intergenic
1038892033 8:31736226-31736248 CACTGGAAGCAGTTAGTGCAAGG - Intronic
1039168945 8:34718671-34718693 TGGGGGCAGCAGTTGGTGAATGG - Intergenic
1039361043 8:36877167-36877189 CTGGGCTAGCAGTTGGGGTAAGG + Intronic
1040385865 8:46914650-46914672 CTGGGGCAGGAGTGTGTGCAGGG - Intergenic
1042242791 8:66681698-66681720 CTGGGGAGGCGGTGGTTGCAGGG - Intronic
1042721196 8:71828377-71828399 CCGGGGAAGCAGATGCTGCCCGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044423411 8:92024664-92024686 CTGGGGATGCAAATGGTTCAAGG - Intronic
1044952993 8:97451695-97451717 CTGGTGAAGCAGTGTGTCCAGGG - Intergenic
1047174154 8:122524567-122524589 TTAGGGAAGGAGTTGGTACAGGG - Intergenic
1050050847 9:1599911-1599933 CTGGGGAGGCAAGTGGTGTATGG + Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1056332536 9:85533240-85533262 CTGGGGAAGTATTTGGTAAAAGG + Intergenic
1056365537 9:85900760-85900782 TTGGGGAAGAAGTAGGTGAATGG - Intergenic
1056515592 9:87346248-87346270 GTGGGGCAGCAGTTGGTGAGTGG - Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057718816 9:97516458-97516480 CATGGGAAGCAGTTGGAGCTTGG + Intronic
1059307410 9:113365573-113365595 CTGGAGAAGCAGCTGATTCAGGG - Intronic
1059576231 9:115491733-115491755 CAGGAGGAGCAGTTGGTGAAGGG + Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1060397721 9:123327677-123327699 CTGGGGAAGCTGGTAGTGAAGGG + Intergenic
1060796500 9:126515730-126515752 CTGGCCCAGCAGTTGGGGCAGGG - Intergenic
1061325564 9:129861806-129861828 CTGGGGAAGTTGTACGTGCAAGG + Intronic
1061390487 9:130314953-130314975 CTGGGGGAGCAGCAGGCGCAGGG + Intronic
1061483254 9:130907440-130907462 CTGGTGAAGGAGTTGGATCAGGG - Intronic
1061908682 9:133711711-133711733 CTGGGGAGGCAGTAGGTGGGTGG - Intronic
1062725985 9:138073846-138073868 CTGGGGCATCACTTGGTGGAGGG + Intronic
1062747265 9:138221283-138221305 CTGGGGAAGCTGTGGCTTCATGG + Intergenic
1185767426 X:2736990-2737012 CTGGGGAAGCTCTTAGTGCTCGG + Intronic
1187639366 X:21271853-21271875 CTGAGGCAGCAGGTGGTACATGG - Intergenic
1188156480 X:26748656-26748678 GTGGGGACGCAGTAGGTGCCGGG - Intergenic
1189245241 X:39558240-39558262 CTGGGGAACAGGTTGCTGCAGGG + Intergenic
1190409730 X:50124646-50124668 TTGTGGAAGCAGTTGTTGAAGGG - Intergenic
1192185198 X:68941938-68941960 CTGGAGATGCAGTAAGTGCAAGG + Intergenic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1195268187 X:103204229-103204251 ATTGGGAAGCTGTTGGTTCAGGG + Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1196950810 X:120874792-120874814 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196951652 X:120931194-120931216 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196952336 X:120936055-120936077 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196953021 X:120940916-120940938 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196953706 X:120945776-120945798 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196954391 X:120950637-120950659 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196955074 X:120955497-120955519 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196955762 X:120960380-120960402 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196956443 X:120965241-120965263 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196957125 X:120970101-120970123 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196957807 X:120974961-120974983 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196958489 X:120979821-120979843 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196959170 X:120984681-120984703 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1197488424 X:127084093-127084115 CTGGGGAGGTAGTTGGATCATGG - Intergenic
1198885534 X:141332243-141332265 CTAGGTAAGCATTTAGTGCATGG - Intergenic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic