ID: 1102035165

View in Genome Browser
Species Human (GRCh38)
Location 12:109766793-109766815
Sequence AGATGCCCCTGCCCGGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102035165_1102035171 6 Left 1102035165 12:109766793-109766815 CCCGAAGCCGGGCAGGGGCATCT 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1102035171 12:109766822-109766844 TGACCTAGAAATTCCATTCCTGG 0: 1
1: 9
2: 104
3: 1295
4: 9044
1102035165_1102035172 7 Left 1102035165 12:109766793-109766815 CCCGAAGCCGGGCAGGGGCATCT 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1102035172 12:109766823-109766845 GACCTAGAAATTCCATTCCTGGG 0: 1
1: 31
2: 308
3: 2067
4: 10928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102035165 Original CRISPR AGATGCCCCTGCCCGGCTTC GGG (reversed) Intronic
902713294 1:18255288-18255310 TGATGCCCCTGCTGGGCTTGTGG + Intronic
903034974 1:20487039-20487061 AGATGCGCCTCCCAGGCCTCTGG - Intergenic
904277252 1:29392552-29392574 CCATCCCCCTGCCCAGCTTCAGG + Intergenic
905419295 1:37828755-37828777 TGAAGCCCCTGCCAAGCTTCAGG + Intronic
905901427 1:41584218-41584240 AGATGTACTTGCCTGGCTTCTGG + Exonic
906480447 1:46196038-46196060 GGATGCCCCGGCCCTGCTCCCGG + Exonic
912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG + Exonic
913209708 1:116571974-116571996 AGTTGCCCCTGCCCAGCTGAGGG + Intergenic
913305519 1:117426923-117426945 AGAGCCCCCTGCCCCACTTCTGG + Intronic
919912869 1:202122792-202122814 AGAGGGCCCTGCCCGGCCTGTGG + Intergenic
920526129 1:206667914-206667936 TCATGCCACTGCCCTGCTTCAGG - Intronic
923023889 1:230189015-230189037 AGCTGCCCCTGCTCCTCTTCCGG - Intronic
924742409 1:246802792-246802814 AGAAGCCCCTGCCCTGCTCCAGG + Intergenic
1064228432 10:13507723-13507745 AGATGCTTCTGCACTGCTTCTGG - Intronic
1075718281 10:124569632-124569654 AGATCCCCCAGCCCTGGTTCAGG - Intronic
1075923071 10:126229155-126229177 GGAAGCCCCTGCCCGCCTCCTGG - Intronic
1077413263 11:2413269-2413291 AGAGGCGCCTGCCTGGCTCCAGG + Intronic
1079733229 11:23962144-23962166 AGATGCCCATGTCCTGCATCTGG - Intergenic
1081789029 11:45769742-45769764 AGATTCACCTGCCCCGCATCTGG + Intergenic
1082173931 11:49040142-49040164 ATATGCACCTGCTAGGCTTCAGG - Intergenic
1083424181 11:62574524-62574546 TCATGTCCCTGCCCTGCTTCGGG - Exonic
1084195748 11:67523037-67523059 AGCTGCCCCATCCCGGCTGCAGG - Intronic
1084648621 11:70475075-70475097 TGAAGCCCCTGCCCGTCTGCTGG + Intronic
1087262182 11:96023460-96023482 AGCTGCTCCTGCCTGGCTACCGG - Intronic
1088815084 11:113415273-113415295 ATCTGCCCTTGCCCGGCTCCTGG + Intronic
1095967630 12:47879512-47879534 AGAAGCCCCTGACCTGGTTCAGG - Intronic
1101250647 12:102931415-102931437 AGATGCCCCTGACTGCCTTGAGG + Intronic
1102035165 12:109766793-109766815 AGATGCCCCTGCCCGGCTTCGGG - Intronic
1102554826 12:113719915-113719937 ACATGCCCCTGCCAGCCTCCTGG - Intergenic
1104304746 12:127599638-127599660 ATATGGTGCTGCCCGGCTTCCGG - Intergenic
1104437013 12:128764670-128764692 AGCTGCCCATGCCTGGCTTGAGG + Intergenic
1104626559 12:130360677-130360699 ACATGCCCCTGCCCCAATTCTGG - Intronic
1106555589 13:30805721-30805743 AAATGCTCTTGCCTGGCTTCCGG - Intergenic
1107726682 13:43306288-43306310 AGATGCTCCTGCCTGGCCTTGGG - Intronic
1107728719 13:43326750-43326772 AGATGCCCTTGCCCTTCTCCCGG - Intronic
1115941044 14:38609989-38610011 CCATGCCCCTGCCTGGCTTTGGG - Intergenic
1119649745 14:76375233-76375255 TCATGCCCCAGCCCTGCTTCTGG - Intronic
1120267425 14:82268970-82268992 AGATGCCTTTGCCCTTCTTCTGG - Intergenic
1122790387 14:104181891-104181913 AGGTGCCCCTCCCTGGCTCCAGG + Intergenic
1202905409 14_GL000194v1_random:68793-68815 AGCTGCCCCTGTCCGCCTCCTGG + Intergenic
1124142569 15:27089587-27089609 AGCAGCCCCTGCCAGGCCTCAGG + Intronic
1127543978 15:59972445-59972467 AGATGCCCCTGCAGAGCCTCTGG + Intergenic
1127896886 15:63308695-63308717 TGATGACCCAGCCAGGCTTCAGG - Exonic
1128780050 15:70353360-70353382 ACATGCCCCTGCCCAGCTCCAGG - Intergenic
1129392770 15:75228849-75228871 AGAGGCCCCTGCTCCTCTTCAGG - Intergenic
1131054905 15:89369319-89369341 AAGGGACCCTGCCCGGCTTCAGG + Intergenic
1132589724 16:721393-721415 TGCTGCTCCAGCCCGGCTTCCGG + Exonic
1132701642 16:1224692-1224714 AGAGGCCCCTGCCAGGCCTCAGG + Intronic
1132865139 16:2089594-2089616 AGATGCCCCTGCCTGCTCTCTGG + Exonic
1132878545 16:2150819-2150841 AGATGGCCCTGCCTGGTTCCCGG + Intronic
1132936083 16:2482021-2482043 AGATGCCTGTGCTCTGCTTCAGG + Intronic
1138134852 16:54512649-54512671 AAATGGCCCGGCCCGGCTCCTGG - Intergenic
1140760226 16:78102918-78102940 AGATGCACATGACCCGCTTCCGG + Intronic
1141630092 16:85282997-85283019 AGATCCCCCTGCCCGACCCCAGG - Intergenic
1141697276 16:85626049-85626071 TGATGGCCCTGGCCGGTTTCTGG + Intronic
1146218685 17:30999498-30999520 ATAGGCCCCTGCCTGGCTCCTGG + Exonic
1146654392 17:34626640-34626662 AGCTGCCCCTGGCCTGGTTCGGG + Intronic
1147683387 17:42270102-42270124 AGATTCTCCTGCCCAGCCTCCGG - Intronic
1149610546 17:57955413-57955435 AGCTGTCCCTGCGCGGCTGCCGG + Intergenic
1151569216 17:74917761-74917783 CGATGCCCCTGCCCTCCCTCTGG + Exonic
1151724772 17:75877614-75877636 ATAGACCCCGGCCCGGCTTCAGG + Intronic
1152634847 17:81426728-81426750 TGTTGCCCCTGCCCTGCCTCAGG + Intronic
1152701815 17:81823218-81823240 CGGTGCCCCTCCCCGGCCTCCGG - Exonic
1152715543 17:81898821-81898843 AGACACCCCAGGCCGGCTTCGGG + Intronic
1152740380 17:82016047-82016069 AGATTCCCCCTCCCGGCTCCAGG - Intronic
1152745985 17:82039512-82039534 AGGTGCCCCTGGCCGGATGCTGG - Intergenic
1154315410 18:13300136-13300158 CCATGCCCCAGCCTGGCTTCCGG + Intronic
1157607195 18:48933304-48933326 AGCTGCCCCTGCCTGCCTCCAGG + Intronic
1162478276 19:10913855-10913877 ACATGGCCCTGCCCGCCTGCAGG + Exonic
1163055602 19:14715392-14715414 ACGTGACCCTGCCTGGCTTCAGG + Exonic
1165450360 19:35878841-35878863 AGAAGCCAGTGCCAGGCTTCTGG + Intronic
1165595303 19:37007749-37007771 AGAAGCCTCTGCCTGACTTCCGG + Intergenic
1166774186 19:45302604-45302626 AGCTGCCCCGGCCAGGCTTGCGG + Exonic
1166919717 19:46221040-46221062 AGATGCCCCAGGCTGGCCTCAGG - Intergenic
1167504445 19:49863709-49863731 ACATGCCCGTCACCGGCTTCCGG + Exonic
1168330401 19:55564481-55564503 ACCTCCCCCTGCCCGGCTCCCGG - Intergenic
925650728 2:6086461-6086483 AGCTGCCTCTGCCTGGCTCCTGG - Intergenic
926225715 2:10965528-10965550 AGATGCCCTTACCCAGCTCCTGG - Intergenic
927148313 2:20181017-20181039 AGATTCACCTGCCCAGCCTCAGG + Intergenic
927151101 2:20196689-20196711 AGGTGCCCAGGCCCGGCGTCTGG - Intergenic
927853709 2:26515116-26515138 AAATCCCCCTGCCCTGCTGCTGG - Intronic
931264283 2:60646698-60646720 AGCTGCCCCTGCACATCTTCAGG + Intergenic
937638432 2:124184291-124184313 ATATGCCCCTCCCCAGCTTTGGG + Intronic
938380344 2:130832859-130832881 AGGTGCCCCTGCCCTGGCTCTGG + Intergenic
944007328 2:194925788-194925810 AGAGGCCGCTGCACGGCTCCTGG + Intergenic
946812537 2:223541114-223541136 AGATGCCAGTGCCATGCTTCTGG + Intergenic
948545642 2:238726808-238726830 ACATGAGCCTGGCCGGCTTCTGG + Intergenic
1170613026 20:17929545-17929567 AGATGCCCCTGCCTGTCCCCTGG + Intergenic
1172010943 20:31845272-31845294 AGCTGCCCTTGCCTGGCTTGCGG + Exonic
1172794501 20:37527630-37527652 GGGCGCCCCTGTCCGGCTTCAGG - Intronic
1175774262 20:61643135-61643157 AGATGCATCTGGCCGGCTTCAGG + Intronic
1176093336 20:63328610-63328632 AGATGCCACTGTCCAGCCTCTGG + Intronic
1176654906 21:9579626-9579648 AAAGGCTCCTGCCCGGCGTCCGG - Intergenic
1178349398 21:31861572-31861594 AACTGCACCTGCCTGGCTTCTGG - Intergenic
1178765780 21:35449923-35449945 ATATGCATCTGCCTGGCTTCTGG + Intronic
953172887 3:40523906-40523928 AGCTGCCACTGGCTGGCTTCGGG + Intergenic
954107886 3:48419111-48419133 AGATCCCCCAGCACAGCTTCTGG + Intronic
954926004 3:54235348-54235370 AGCTGCATCTGCTCGGCTTCTGG + Intronic
966836420 3:184052880-184052902 AGATGCACCTTCCGGGCTCCAGG - Intergenic
969198577 4:5582957-5582979 TGATGCATCTGCCCAGCTTCTGG - Intronic
969852974 4:9976700-9976722 AGCTGCCCATGCCCACCTTCTGG - Intronic
973236844 4:47914647-47914669 AGAAGCCCCCGCCCGCGTTCCGG + Intronic
975494741 4:75025209-75025231 AGATTCCCCAGCCTGGCCTCTGG + Intronic
982437868 4:155399019-155399041 AGCTCCCCCTGCACGGCTTCAGG + Intergenic
985709458 5:1420087-1420109 GGATGCCCCTGGGCGGCTTTGGG + Intronic
985731224 5:1550142-1550164 AGAAGCCCCTGCCCAGCGTGTGG + Intergenic
988156524 5:27458805-27458827 AGATGCCTGTGCCATGCTTCTGG - Intergenic
988882613 5:35519954-35519976 ACATGCCCCTGCCTGGGGTCCGG + Intergenic
989322819 5:40156786-40156808 AGATGGACTTGCCAGGCTTCAGG - Intergenic
990787040 5:59433331-59433353 AGGAGCCCCTGCCAGGCTTTTGG - Intronic
997411015 5:133690911-133690933 AGATGCCCCTGCCAGGGTGGAGG - Intergenic
998225516 5:140323419-140323441 AGATGTCCCCACCCGGCTGCTGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998342528 5:141430987-141431009 AGCTGCCGCTGCGCGGATTCAGG - Exonic
999105574 5:149068026-149068048 AGAAGCCCCTGCTAGGCTTTGGG + Intergenic
1002190553 5:177475170-177475192 TGCTGCCCCTCCCCGGCTGCAGG - Intergenic
1002304207 5:178273852-178273874 AGATGCACCTACCTGGCTTGGGG + Intronic
1006334035 6:33411175-33411197 GTCTGCCCCTGCCCGGCTCCCGG + Exonic
1007533572 6:42564405-42564427 AGACGCACCCGCCCGGGTTCCGG - Intronic
1007581094 6:42960643-42960665 ACACGCCCCTGCCGGGCTTTGGG - Intergenic
1010354186 6:74911151-74911173 AAAAGCCCCTGCCAGGCATCAGG + Intergenic
1013248714 6:108313255-108313277 AGATGCCACTTCCTGGCTTTGGG + Intronic
1017559301 6:155609883-155609905 AGAGGCCCCTCCCCTGCATCAGG + Intergenic
1017814358 6:158005948-158005970 AGATGCCCATGGCCTGCTCCAGG + Intronic
1019178961 6:170175568-170175590 AGCTGCCCCTGCCTGACATCCGG - Intergenic
1022662594 7:32380713-32380735 ACATGCACCTCCCCGGTTTCTGG + Intergenic
1023545694 7:41315941-41315963 AGATGCCCCTGGCCAGCTGAGGG + Intergenic
1023672137 7:42588187-42588209 AGATGCTGCTGCCATGCTTCTGG + Intergenic
1024076969 7:45826101-45826123 CGATGCCCTGGCCCTGCTTCTGG + Intergenic
1024117548 7:46208310-46208332 GGCTGCCCCTGCCCAGCTTTGGG - Intergenic
1024326613 7:48114231-48114253 AGGTGCCTCTGCAGGGCTTCTGG - Intergenic
1024527371 7:50360218-50360240 AGAAGCCCAGGCCCTGCTTCAGG - Intronic
1026000446 7:66556635-66556657 AGAAGCCCCCGCCCAGGTTCAGG + Intergenic
1027261936 7:76471016-76471038 AGATGCTACTGCCCGGCTCAAGG - Intronic
1027313318 7:76969115-76969137 AGATGCTACTGCCCGGCTCAAGG - Intergenic
1030310371 7:108062973-108062995 GGATGCTCCTGCCATGCTTCCGG - Exonic
1031087318 7:117315604-117315626 AGATGGCCTTGCCCAGCTCCTGG + Intronic
1034158656 7:148976227-148976249 TCATGCCCCTGCCCAGCTTCAGG - Intergenic
1036153971 8:6325000-6325022 AGATTTCCCTGCAAGGCTTCAGG - Intergenic
1037967868 8:23147569-23147591 TGATGCCCCCACCCGGCTGCAGG + Intronic
1041805365 8:61843599-61843621 GCATGCCCCTACCCTGCTTCAGG + Intergenic
1044583999 8:93852024-93852046 AGATGCCAATGCCATGCTTCTGG - Intergenic
1047734607 8:127754346-127754368 AGAGGGCCCTGCCAGGCTCCTGG - Intergenic
1048943877 8:139426765-139426787 AGATCCACCTCTCCGGCTTCTGG + Intergenic
1049686301 8:143940567-143940589 AGCTGCCTCTGGCCAGCTTCTGG + Intronic
1049697741 8:143991798-143991820 AGATGCCCCTACCCACCTTGCGG - Exonic
1052802896 9:32986605-32986627 CGATGCTCCTGCCCAGCCTCTGG + Intronic
1056725261 9:89108929-89108951 AGATCCCACTGCCCTGCATCTGG + Intronic
1057699202 9:97350468-97350490 AGGTGTCCCTGCGCAGCTTCCGG + Exonic
1060728745 9:126023710-126023732 AGAGACCCCAGCCCTGCTTCAGG - Intergenic
1061392910 9:130327633-130327655 AGAGGCCCCTTCCAGGCTTCTGG - Intronic
1061841032 9:133358703-133358725 AGGTGTCCCTGCCAAGCTTCAGG - Intronic
1061896505 9:133651335-133651357 AGATGAACCTGTCAGGCTTCAGG + Intronic
1203561783 Un_KI270744v1:63993-64015 AGCTGCCCCTGTCCGCCTCCTGG - Intergenic
1203632631 Un_KI270750v1:83079-83101 AAAGGCTCCTGCCCGGCGTCCGG - Intergenic
1186239067 X:7546829-7546851 ATTTGCTCCTGCCAGGCTTCCGG + Intergenic
1187505443 X:19875019-19875041 AGAGCCCCCTGCCCGCTTTCTGG + Intronic
1191229265 X:58081253-58081275 AGAGACCCCTGACCGACTTCAGG + Intergenic
1192362076 X:70446494-70446516 AGCTGCCCCTTGCCGGCTCCAGG - Intronic
1194073050 X:89351006-89351028 AGATCCCCCTGCCAGGTTGCAGG + Intergenic
1200727287 Y:6686746-6686768 AGATCCCCCTGCCAGGTTGCAGG + Intergenic
1200728439 Y:6702521-6702543 AGATCCCCCTGCCAGGTTGCAGG + Intergenic
1201161288 Y:11168974-11168996 AGCTGCCCCTGTCCGCCTCCTGG + Intergenic
1201244193 Y:11986883-11986905 AAATGTCCCTGCCCAGCTGCAGG - Intergenic
1202107145 Y:21383728-21383750 AGAGGTTCCTGCCCGGCCTCCGG + Exonic