ID: 1102038572

View in Genome Browser
Species Human (GRCh38)
Location 12:109786318-109786340
Sequence CCCCACTGTTTGGTAGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102038564_1102038572 14 Left 1102038564 12:109786281-109786303 CCTCAGCTTCCCATTTCACCGAG 0: 1
1: 0
2: 1
3: 13
4: 305
Right 1102038572 12:109786318-109786340 CCCCACTGTTTGGTAGATACAGG 0: 1
1: 0
2: 0
3: 4
4: 79
1102038568_1102038572 4 Left 1102038568 12:109786291-109786313 CCATTTCACCGAGGGCACTAGAG 0: 1
1: 0
2: 1
3: 2
4: 47
Right 1102038572 12:109786318-109786340 CCCCACTGTTTGGTAGATACAGG 0: 1
1: 0
2: 0
3: 4
4: 79
1102038569_1102038572 -4 Left 1102038569 12:109786299-109786321 CCGAGGGCACTAGAGCTCACCCC 0: 1
1: 0
2: 2
3: 14
4: 105
Right 1102038572 12:109786318-109786340 CCCCACTGTTTGGTAGATACAGG 0: 1
1: 0
2: 0
3: 4
4: 79
1102038567_1102038572 5 Left 1102038567 12:109786290-109786312 CCCATTTCACCGAGGGCACTAGA 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1102038572 12:109786318-109786340 CCCCACTGTTTGGTAGATACAGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102038572 Original CRISPR CCCCACTGTTTGGTAGATAC AGG Intronic
907121438 1:52011453-52011475 CCACTCTGTTTTGTAGAGACGGG + Intergenic
908018064 1:59867366-59867388 GACAACTGTGTGGTAGATACTGG - Intronic
908494137 1:64677836-64677858 CCCCAATGTTTGTTAGACTCTGG - Intronic
912863338 1:113234748-113234770 CTCCACTGAGTGGAAGATACTGG - Intergenic
1067259068 10:44670432-44670454 TCCCTCTCTTTGGTAGAGACAGG - Intergenic
1071100705 10:82034346-82034368 CTCCACTGTTTTGAACATACAGG - Intronic
1071468209 10:85960079-85960101 CACCATTTTTTGGTAGAGACAGG + Intronic
1074070567 10:110064426-110064448 CCACACTGGTAGGTAGATAGTGG + Intronic
1074191187 10:111139196-111139218 CCCCACTGTCTGGGAAATGCTGG + Intergenic
1074344244 10:112666536-112666558 CCCCACTGTGTGCCAGGTACAGG - Intronic
1090060175 11:123457885-123457907 CTCCACTTTTTTGTAGAGACAGG + Intergenic
1092810020 12:12263978-12264000 CCCCAATTTTTTGTAGATATGGG - Intronic
1102038572 12:109786318-109786340 CCCCACTGTTTGGTAGATACAGG + Intronic
1102840741 12:116117930-116117952 CCCCACTTTCTGGGAGTTACAGG + Intronic
1104973840 12:132543311-132543333 CCCCACTGCTTCGTGGACACTGG - Intronic
1105332328 13:19429515-19429537 ACCCACTGAGTGGTAGATGCAGG - Intronic
1111017011 13:82394382-82394404 TCCCACAGTTTGGTGAATACTGG - Intergenic
1111017045 13:82394659-82394681 TCCCACAGTTTGGTGAATACTGG - Intergenic
1119759902 14:77142819-77142841 CCCCACTGTTTGATACACATTGG - Intronic
1122660774 14:103293571-103293593 CCCCTCTGTCTGGGAGACACAGG - Intergenic
1128408733 15:67371021-67371043 CCCCACAGTTTGGTAAAGATGGG + Intronic
1131838558 15:96413958-96413980 GCCCATTGTTTGGTAGGTGCTGG + Intergenic
1132400460 15:101501929-101501951 CCCCACGGGTCGGTAGAAACAGG + Intronic
1136578673 16:31139282-31139304 TCCCACTGTCTGGGAGATCCAGG + Exonic
1138837717 16:60458717-60458739 CCCCACAGTTTGGGAGATTGAGG - Intergenic
1142198175 16:88748405-88748427 GCCCTCTGTTTGGAGGATACGGG + Intronic
1143145472 17:4772369-4772391 CCCCACTGTTGAGCAGATGCTGG + Intronic
1143734983 17:8905320-8905342 CCCCCCTGTCTGGTGAATACAGG + Intronic
1143815204 17:9507153-9507175 CCCGACTGTTTCATAGATCCGGG - Intronic
1147632634 17:41941900-41941922 GCCCACTGTGTGGCAGATGCTGG - Intronic
1150560515 17:66290271-66290293 CCCCACTGTCTGGTATATAGGGG + Intergenic
1156970042 18:43143189-43143211 CCCCAGTGTTTGGTAGACCAAGG + Intergenic
926818701 2:16828440-16828462 CCCCAGTGTCTGATAGCTACTGG + Intergenic
930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG + Intergenic
931947464 2:67325883-67325905 GCCCACTGTTTGATACACACTGG + Intergenic
932295164 2:70617968-70617990 CCCAACTGATTAGTAGAGACAGG - Intronic
934801605 2:97168335-97168357 CGTGACTCTTTGGTAGATACAGG + Intronic
936598152 2:113869101-113869123 TCCCACTATTTAGTAGAAACAGG + Intergenic
937826131 2:126370269-126370291 CCCCACTGTTGGCTAGAACCAGG + Intergenic
945026025 2:205620758-205620780 CACCATTGATTGGTAAATACAGG + Intergenic
946139225 2:217674315-217674337 CCCCACTCTATGTTGGATACTGG - Intronic
1169722298 20:8692019-8692041 CCCAACTATTTGGGAGATAATGG + Intronic
1172189416 20:33053255-33053277 ACCCACTGTCTGCTAGATGCTGG - Intergenic
1176524877 21:7858405-7858427 ACCCACTGTTTGGTGGGTCCTGG + Intergenic
1178239334 21:30881150-30881172 GCCCACTGGTTGGCAGACACTGG + Exonic
1178658897 21:34488418-34488440 ACCCACTGTTTGGTGGGTCCTGG + Intergenic
951089586 3:18556634-18556656 CTGCACTGTGTGGTAGAAACAGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
958591996 3:96170383-96170405 CCCCACTGTTTTATGGATAGAGG + Intergenic
960653458 3:119977953-119977975 GCCCAGTGTTTGGTACATAAAGG - Intronic
961789798 3:129367274-129367296 CCCCACTTCTGGGTATATACAGG - Intergenic
963161604 3:142156487-142156509 TCCCACAGTTTTATAGATACAGG - Intergenic
964444673 3:156746262-156746284 CCCCACTGCTTGCCAGAAACAGG - Intergenic
969981448 4:11160438-11160460 CCCCACTCCTTGTTAGTTACAGG - Intergenic
972508853 4:39748228-39748250 CCCCACTTTTTTTTAGAGACAGG + Intronic
976747720 4:88421289-88421311 TCCCACTCTTGGGTATATACGGG - Intronic
977307571 4:95343244-95343266 TCCCAGTGTTGGGTAGAGACAGG + Intronic
980441543 4:132853526-132853548 TCCTACTGTTTGATAGCTACTGG - Intergenic
981135725 4:141208764-141208786 TGCCACTGTTTTGTGGATACTGG + Intronic
981729216 4:147879838-147879860 TGCCACTGTTTGGAAGATAAAGG + Intronic
982081104 4:151791168-151791190 CCCCAATGTTTGATAGTCACTGG - Intergenic
987759768 5:22146574-22146596 TCCCTCTGTTTGGTAGCTAAAGG - Intronic
989651155 5:43691910-43691932 ATGCACTGTTTGGTAGACACAGG - Intronic
991894494 5:71380001-71380023 TCCCTCTGTTTGGTAGCTAAAGG - Intergenic
998661540 5:144244121-144244143 CCCCACTCTTTGGGGGATTCAGG + Intronic
1001021545 5:168187219-168187241 CCCCACTGTTTTGTTGATCCTGG - Intronic
1001457661 5:171877448-171877470 CCCAACTGCTTTGTAGATCCAGG + Intronic
1004854433 6:19734931-19734953 CAACCCTGTCTGGTAGATACTGG + Intergenic
1005763093 6:28985780-28985802 CCCCCCTTTTTGGTAGAAACGGG - Intergenic
1007309953 6:40937446-40937468 CCCCTCTGTTTGGTTCATATTGG + Intergenic
1008362542 6:50638356-50638378 CACAACTGTTTGGAAGATAGAGG + Intergenic
1018023318 6:159783656-159783678 ACCTACTGTTTGCTAGATACTGG - Intronic
1018604943 6:165586991-165587013 CCCCACAGTTTGCTAGGTGCTGG - Intronic
1019281966 7:205144-205166 CCCCATTGTTTTCTAGAAACAGG + Intronic
1021428287 7:20529185-20529207 TCCCACTGTTTGGCAGGTTCTGG - Intergenic
1021674585 7:23067556-23067578 TCCCACTCTGTGGTAGAAACAGG + Intergenic
1027057094 7:75057286-75057308 CTCCATTTTTTGGTAGAGACAGG + Intronic
1028859192 7:95628592-95628614 CTCCACTGATTGCTAGACACTGG + Intergenic
1037316263 8:17602253-17602275 CCCCACTTTTTGACAGATAAGGG + Intronic
1040691016 8:49938371-49938393 CCCCACTATTTTGTAGACAAAGG + Intronic
1042260090 8:66849747-66849769 CCACACTGTTTTGTAGAGATGGG + Intronic
1059589756 9:115645944-115645966 CTGCATTGTTTGGTAAATACAGG + Intergenic
1061050133 9:128190529-128190551 CCCCACTCTGTGGTAGACAGAGG + Intronic
1187004617 X:15219847-15219869 CCCCATTGTGGGGTAGTTACTGG + Intergenic