ID: 1102043342

View in Genome Browser
Species Human (GRCh38)
Location 12:109814765-109814787
Sequence TCCAGCGAAGGCCCCCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102043342_1102043354 25 Left 1102043342 12:109814765-109814787 CCCGCGCGGGGGCCTTCGCTGGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1102043354 12:109814813-109814835 TCTGCACTGCTCAGCCTGCAAGG 0: 1
1: 0
2: 5
3: 33
4: 264
1102043342_1102043345 -2 Left 1102043342 12:109814765-109814787 CCCGCGCGGGGGCCTTCGCTGGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1102043345 12:109814786-109814808 GAATCCGCCATGCCTGCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
1102043342_1102043355 26 Left 1102043342 12:109814765-109814787 CCCGCGCGGGGGCCTTCGCTGGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1102043355 12:109814814-109814836 CTGCACTGCTCAGCCTGCAAGGG 0: 1
1: 0
2: 2
3: 38
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102043342 Original CRISPR TCCAGCGAAGGCCCCCGCGC GGG (reversed) Exonic
900215291 1:1478414-1478436 GCCTGCGAAGGCCCCCGGGGAGG - Intronic
900341997 1:2193937-2193959 CCCAGCGATGGCTCCCGCCCTGG + Intronic
900648531 1:3719818-3719840 TCCAGGGCAGGCGCCCGCACAGG + Intronic
900949919 1:5852856-5852878 TGCAGAGAAGGCCCTCGCTCTGG + Intergenic
901065111 1:6490687-6490709 TCCCAGGAAGGGCCCCGCGCCGG + Intronic
901075859 1:6554376-6554398 ACCAGCGCAGGCTCCCGAGCCGG + Exonic
903059854 1:20661947-20661969 TCCAGCGTGGGCCACCGAGCTGG - Intergenic
904039233 1:27574894-27574916 TCCAGAGAAGGGCCCCGGGATGG - Intronic
905924137 1:41737930-41737952 TACAGCAAAGGCCCCAGCACAGG - Intronic
913680062 1:121181330-121181352 TCCAGTGAAGTCCACTGCGCTGG + Exonic
914031896 1:143968983-143969005 TCCAGTGAAGTCCACTGCGCTGG + Exonic
914157548 1:145098984-145099006 TCCAGTGAAGTCCACTGCGCTGG - Exonic
920467372 1:206199866-206199888 TCCAGTGAAGTCCACTGCGCTGG + Exonic
1065903353 10:30227376-30227398 TTCAGCGAAGGGCCCAGCCCTGG - Intergenic
1069846785 10:71377536-71377558 ACTACCGACGGCCCCCGCGCGGG - Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077046606 11:549483-549505 TCCAGCGAAGCCCCCCACATCGG + Intronic
1077877235 11:6319251-6319273 TCCAGCGTGGGCTCCAGCGCAGG + Exonic
1078464849 11:11542432-11542454 TCCAGCAAAGGCCACAGTGCTGG + Intronic
1084262912 11:67990707-67990729 TCCAGCGACCACCCCCGCGTCGG - Intergenic
1085596852 11:77819508-77819530 TCCACATAAGGCCACCGCGCGGG - Intronic
1095005997 12:36815688-36815710 TCCAACGAAGGCCCCAAAGCAGG - Intergenic
1097284270 12:57865468-57865490 CCCCGCGAGGGCCCCAGCGCTGG - Intergenic
1102043342 12:109814765-109814787 TCCAGCGAAGGCCCCCGCGCGGG - Exonic
1102044002 12:109818262-109818284 CCCAGCAAAGGCCCCTGTGCAGG - Intronic
1103606166 12:122087527-122087549 TCCAGCGAAGGCCTCTGCCTGGG - Intronic
1121692992 14:95891235-95891257 TCCAGGGAAAACCCCCGAGCAGG - Intergenic
1126852503 15:52805784-52805806 TCCCGCCAGGGCCCGCGCGCAGG - Intergenic
1131825702 15:96321638-96321660 CCCAGCCAAGGGCCCCGGGCGGG + Intergenic
1138104874 16:54282564-54282586 TCCTGCTAAGGCCCCGGCGCGGG - Intergenic
1142955462 17:3518534-3518556 TCCCGTGGAGGCCCCCACGCTGG + Intronic
1142980270 17:3667564-3667586 TCAAGCGAAAGTCCCCGCCCTGG - Intronic
1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG + Intronic
1149891341 17:60392421-60392443 GCCAGCGGAGGCGCCCGGGCGGG - Intronic
1152654262 17:81512703-81512725 TCCAGCTCAGGCCCCGGGGCGGG + Exonic
1160357215 18:78238757-78238779 TCCAGCGAACGCCCCCACCCGGG - Intergenic
1162648190 19:12065114-12065136 TCCAGAGAGGGCTCCCGGGCTGG - Intronic
1162915665 19:13873229-13873251 ACCAGCCAAGGCCCCAGCCCAGG - Intronic
1163573580 19:18097827-18097849 TCCAGGTGAGGCCCCTGCGCGGG + Exonic
1166358572 19:42242218-42242240 GGCAGCGGAGGCCCCGGCGCAGG - Exonic
1166984105 19:46649449-46649471 TCCAACGAGGGCTCCCGCGCGGG + Exonic
925030975 2:649618-649640 GCCTGGGAAGGCCCCCGCGGCGG + Intergenic
925036580 2:692044-692066 TCCAGCTGGGGCCCCGGCGCGGG - Intergenic
932426143 2:71636656-71636678 TCCAGGGAAGGCACCCAGGCTGG + Intronic
937989731 2:127655430-127655452 GCCAGCGAGGGCCCCTGTGCTGG + Intronic
942046400 2:172101716-172101738 TCAAGCCAAGTCCCCCCCGCCGG - Intronic
942279197 2:174343740-174343762 TCGGGCGCAGTCCCCCGCGCGGG - Intergenic
948243546 2:236458640-236458662 GCCAGCGAATGCCCCCTTGCTGG - Intronic
1169164223 20:3408028-3408050 TCCAGCGAAGTCTTCCGCTCCGG + Intergenic
1173699531 20:45056005-45056027 ACCAGCGTGAGCCCCCGCGCCGG + Intronic
1173827824 20:46058591-46058613 CCCAGCGAAGGCACCGGGGCGGG - Intronic
1174820812 20:53725124-53725146 TCCAGGGAAGGCCACCACGGAGG - Intergenic
1176005928 20:62862087-62862109 TCCAGCGCAGCCGCCCTCGCCGG - Intergenic
1179582588 21:42352769-42352791 TCCTGCTCAGGCCCCCACGCAGG + Intergenic
1181534248 22:23533521-23533543 TCCAGCCGAGGCCCCAGCGGCGG + Intergenic
1185085365 22:48737955-48737977 CCCAGGGAAGGCCCCCACACAGG - Intronic
953654975 3:44843606-44843628 TCCAGGGAAAGCCCCTGGGCAGG + Intronic
956677939 3:71753430-71753452 TCCGGCGGCGGCGCCCGCGCTGG - Intronic
957078347 3:75618650-75618672 TCCAGCGACCACCCCCGCGTCGG - Intergenic
964876415 3:161372698-161372720 TCCAGGGAAGGTGCTCGCGCTGG - Exonic
965287931 3:166842486-166842508 TCCAGCAAAGGCACCCACACAGG + Intergenic
968512684 4:1002541-1002563 TCCTGCGAAGGCCCCGCTGCGGG + Intronic
973292439 4:48483679-48483701 TCCAGCGCCGGCCCCGGCCCTGG + Exonic
979033154 4:115678449-115678471 TCCACCTAGGGCCCCAGCGCGGG - Intergenic
985754676 5:1706259-1706281 TCCAGGGAAGGCGCCCGCGGAGG - Intergenic
991601962 5:68360376-68360398 TCCAGTCAAGGCCCCCTCTCAGG - Intergenic
1002991861 6:2245723-2245745 TCCGCCGACGGCCACCGCGCGGG + Intergenic
1008030404 6:46688150-46688172 GCCAGCGAGGCCCCCGGCGCCGG - Exonic
1011195125 6:84773378-84773400 TCCAGTGTAAGCCCCCGCTCCGG + Intergenic
1012131365 6:95497356-95497378 TCCACCCATGGCCCCGGCGCGGG + Intergenic
1012237635 6:96837269-96837291 TCAAGCGAAGGGCAGCGCGCGGG + Exonic
1013459004 6:110357957-110357979 TCCGGCGGGGGCGCCCGCGCGGG + Exonic
1020308840 7:6854652-6854674 TCCAGCGACCACCCCCGCGTCGG - Intergenic
1023038585 7:36153564-36153586 TCCAGCCTAGGCGTCCGCGCGGG - Exonic
1026858226 7:73768924-73768946 TCCAGCCAAGGCCGCCCCGAGGG + Intergenic
1029524203 7:101085353-101085375 TCCCGCCAAGGCCCCCACCCCGG - Intergenic
1032013564 7:128361647-128361669 CCCGGCGAAGCCGCCCGCGCCGG + Exonic
1035302360 7:157905999-157906021 TCCACCCAGGGCCCCCGTGCAGG + Intronic
1041304637 8:56446748-56446770 TCCCGCGAAGGCGTCGGCGCGGG - Intergenic
1049525900 8:143126869-143126891 TGCAGCGAGGGCCCCAGCACGGG - Intergenic
1058851050 9:109012909-109012931 ACCAGCGAGGGGCCCCGCGGGGG + Intronic
1187105577 X:16237991-16238013 TCCAGAGAAGGCCCACCTGCTGG - Intergenic
1197981256 X:132219427-132219449 TCCAGCGAAGTCCCCAGCTCTGG + Intronic
1201232572 Y:11879506-11879528 TCCATCGGAGGCCCCGGCGCAGG - Intergenic