ID: 1102047086

View in Genome Browser
Species Human (GRCh38)
Location 12:109836039-109836061
Sequence AATCCTGCCCTGCCGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102047083_1102047086 2 Left 1102047083 12:109836014-109836036 CCTCTGCACCAGACACTGGGGTT 0: 1
1: 0
2: 1
3: 28
4: 240
Right 1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1102047084_1102047086 -6 Left 1102047084 12:109836022-109836044 CCAGACACTGGGGTTCAAATCCT 0: 1
1: 0
2: 2
3: 44
4: 214
Right 1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102047086 Original CRISPR AATCCTGCCCTGCCGCTGAT GGG Intergenic
907524308 1:55045301-55045323 AGTCCTGCCCAGCCCCTTATTGG + Intronic
907728269 1:57040866-57040888 AATCCTGTCATCCTGCTGATGGG - Intronic
909948511 1:81690994-81691016 AATTTTCCCCTGCTGCTGATTGG - Intronic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
921355666 1:214281863-214281885 AGTCCAGCCCTGCCTCAGATTGG + Intronic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
924325498 1:242890683-242890705 CCGCCTGGCCTGCCGCTGATGGG + Intergenic
1062929420 10:1342616-1342638 CATCCAGCCCTGCCTGTGATGGG + Intronic
1064026222 10:11850894-11850916 AATCCAGCCCAGCCCCTGAACGG - Intronic
1068669941 10:59712114-59712136 AATGCTCCCCTGCAGATGATGGG - Intronic
1073474942 10:103746689-103746711 AATCCTGCCCGGCCACAGAAGGG - Intronic
1074176549 10:111010718-111010740 AATCTAGCCCTGCTGCTTATTGG + Intronic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1077118977 11:898129-898151 AATCCTGCCCTACCCCTCATGGG + Intronic
1077323201 11:1951697-1951719 AGGCCTGCTCTGCGGCTGATGGG - Intronic
1078667849 11:13341039-13341061 CATCCTGCCCTGCCTCTCCTCGG + Intronic
1079082785 11:17425472-17425494 AAGCTTGCCCTTCTGCTGATTGG + Intronic
1079428365 11:20364507-20364529 AATACTGCCCTGCCAGTGGTGGG + Intronic
1079970725 11:27032093-27032115 CACCCTGCCCTGTCACTGATGGG + Intergenic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1083805573 11:65071883-65071905 AGTCCTGCTCTGCTGCTCATAGG + Intronic
1084592724 11:70099838-70099860 AATCCTGCCCTGCCCCTGTGTGG - Intronic
1085504508 11:77049439-77049461 CTCCCTGCCCTGCCGCAGATCGG - Intergenic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1090131120 11:124143042-124143064 AATCTGGCTCTGCCACTGATGGG - Intronic
1202806187 11_KI270721v1_random:6892-6914 AGGCCTGCTCTGCGGCTGATGGG - Intergenic
1091461690 12:647897-647919 AGTCCTGCCCTGCCGCTTCCAGG + Intronic
1098407452 12:70141209-70141231 CATCCGGCCCTGCCTCTGTTTGG + Intergenic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1103633510 12:122283035-122283057 AATCCTGCACTGGCACTGACAGG + Intronic
1118445938 14:65851315-65851337 AATCCTGCCCCGTCGCTAAGGGG + Intergenic
1122058475 14:99121158-99121180 AATCCTGCTGTGCCTCTTATTGG + Intergenic
1122158339 14:99764605-99764627 AAGCCTGCCCTGACGCTCCTTGG - Intronic
1124004313 15:25784239-25784261 AAGCCTGCCCCGCCGATGCTTGG - Intronic
1125948465 15:43730123-43730145 TATCGTGCCCAGCCGCAGATGGG - Intergenic
1126506173 15:49406678-49406700 CACCCTGCCCTGCCACTGCTGGG - Intronic
1127579897 15:60328493-60328515 ACTTCTGTCCTGCCACTGATTGG + Intergenic
1129266358 15:74395595-74395617 AGTCCTGCTCTGGCGCTGATGGG - Intergenic
1130227206 15:82068228-82068250 AAGCCTGCCCTGACTCTGAGAGG - Intergenic
1135397323 16:22141254-22141276 AATCATGCCCTGCCTCTTACTGG + Intronic
1135544329 16:23355579-23355601 AATCCTGCCCAGCCACTTACCGG + Intronic
1139910489 16:70394664-70394686 CACCATGCCCTGCCTCTGATGGG + Intronic
1141050240 16:80754991-80755013 AAGCCTGCCCTTCAGCTGAAGGG + Intronic
1141103786 16:81216477-81216499 ACGCCTGCTCTGCCGCTGCTGGG + Intergenic
1142576371 17:911199-911221 AATCATGCCCTGCCCCTGCTTGG + Exonic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1146552564 17:33794305-33794327 AATGCTGGGCTGCAGCTGATCGG + Intronic
1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG + Intronic
1147583755 17:41640845-41640867 CATCCTGCCCTGCCTGTGGTAGG + Intergenic
1148002627 17:44398631-44398653 AAGCCTGTCCTTCCACTGATAGG - Exonic
1151349677 17:73524408-73524430 ATTCCTGCCCTTCCCCTGGTGGG + Intronic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1161389841 19:4015255-4015277 AAGCCTGCCCTGCCGCTCCCAGG - Intronic
1163713727 19:18862172-18862194 CATGCTGCCCAGCCGCTCATCGG + Intronic
930529423 2:52571887-52571909 AATCCCGGCCTGCCGTCGATGGG + Intergenic
933275958 2:80284662-80284684 AATCCTGCCCTGCCTCTATTAGG - Intronic
945075184 2:206031675-206031697 AATCCAGTCCTGCCTCTCATCGG - Intronic
1171353423 20:24523165-24523187 AATCCAGCTCTGCAGCTTATAGG + Intronic
1172228437 20:33320890-33320912 AATTCTGAACTGCAGCTGATTGG + Intergenic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1175174223 20:57100954-57100976 AATCCTGCCCTGGGACTGCTAGG - Intergenic
1176221294 20:63970308-63970330 AATCCTGCGCTGCCGGTGCACGG - Intronic
1180055021 21:45353099-45353121 AATCCTACCCTGAGGCTGACAGG - Intergenic
1182117165 22:27763457-27763479 AATCCATCCCTGCCACTGTTGGG + Intronic
953661903 3:44897326-44897348 ACTCCAGCCCTGCCACTTATGGG + Intronic
953949473 3:47177578-47177600 TAACCTGCCCTGCAGCTGGTAGG - Intergenic
958795960 3:98706642-98706664 TATCTTGCCCTGTCGCTGATGGG - Intergenic
959457373 3:106579450-106579472 AATCCTGCCTTGCCCCTTACTGG - Intergenic
967129687 3:186458987-186459009 AATCCTGCTCTGCTGCTTACTGG - Intergenic
968044348 3:195615574-195615596 AACCCTGACCTGTCGCTAATAGG + Intergenic
968060133 3:195721633-195721655 AACCCTGACCTGTCGCTAATAGG + Intronic
969938688 4:10708455-10708477 ACTCCAGCTCTGCCACTGATGGG - Intergenic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
990341047 5:54823429-54823451 AATCCTGCCTTGCCTATGAAAGG + Intergenic
998565643 5:143213694-143213716 CAGCCTGCCCTCCCGCTGTTTGG + Intronic
998681071 5:144468013-144468035 AAAGCTGGGCTGCCGCTGATAGG - Intronic
999231502 5:150064847-150064869 AACCCTCCCCTGCCCCTGCTGGG + Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999432521 5:151536511-151536533 ATTCCTGCCCTGCTGCTGCAGGG - Intronic
1006284504 6:33082246-33082268 AATGCTGCCATGTCACTGATTGG - Intronic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1011237909 6:85238089-85238111 AAACCTGCCCTCCCAGTGATGGG + Intergenic
1017854729 6:158340400-158340422 CCTCCTGCCCTGACGCTGCTTGG + Intronic
1018949126 6:168367389-168367411 GGTCCGGCCCTGCCGCCGATGGG - Intergenic
1019548061 7:1587878-1587900 GTCCCTGCCCTGCCCCTGATGGG - Intergenic
1019818288 7:3217667-3217689 AATCCAGCTCTGCCACTGACTGG + Intergenic
1024517791 7:50274568-50274590 ACTCCTGCCTTGCTGCTGAGGGG - Intergenic
1031592316 7:123609003-123609025 ACTCTTGCCCTTCCTCTGATAGG + Exonic
1037935431 8:22912293-22912315 ACCCCTGCCCTGCCTGTGATGGG - Intronic
1044317295 8:90764711-90764733 AATCCTGCCCTTCCACACATAGG - Intronic
1047179898 8:122577053-122577075 AATCCTGCCCTCCCACAGCTGGG - Intergenic
1047726417 8:127687832-127687854 ATGCCTGCCCTGCCTCTTATTGG + Intergenic
1048345782 8:133573107-133573129 AATCCTGCACTGCCACTCAACGG + Intergenic
1048581145 8:135730800-135730822 GATCCTATCCTGCCCCTGATTGG + Intergenic
1054827242 9:69585601-69585623 AGTCCTGACCTGCTGCTGGTGGG + Intronic
1057044465 9:91874202-91874224 AATCCTGCTCTGAAGCAGATTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1197775750 X:130117744-130117766 AATGCTGCAATGCCTCTGATAGG - Intergenic
1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG + Intronic
1200055301 X:153456977-153456999 TATGCTGCCCGGCCCCTGATTGG + Intronic
1201223009 Y:11789676-11789698 CCGCCTGGCCTGCCGCTGATGGG + Intergenic