ID: 1102047232

View in Genome Browser
Species Human (GRCh38)
Location 12:109837074-109837096
Sequence GGGGCAGTCCAGGAGCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102047232_1102047242 16 Left 1102047232 12:109837074-109837096 CCACGTAGCTCCTGGACTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1102047242 12:109837113-109837135 CTCCCCTAAGAAAGGTTCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 118
1102047232_1102047246 28 Left 1102047232 12:109837074-109837096 CCACGTAGCTCCTGGACTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1102047246 12:109837125-109837147 AGGTTCCTGGGCAGCAGCCAAGG 0: 1
1: 0
2: 5
3: 46
4: 401
1102047232_1102047241 15 Left 1102047232 12:109837074-109837096 CCACGTAGCTCCTGGACTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1102047241 12:109837112-109837134 CCTCCCCTAAGAAAGGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1102047232_1102047239 8 Left 1102047232 12:109837074-109837096 CCACGTAGCTCCTGGACTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1102047239 12:109837105-109837127 TCAGCTACCTCCCCTAAGAAAGG 0: 1
1: 0
2: 0
3: 21
4: 152
1102047232_1102047247 29 Left 1102047232 12:109837074-109837096 CCACGTAGCTCCTGGACTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1102047247 12:109837126-109837148 GGTTCCTGGGCAGCAGCCAAGGG 0: 1
1: 0
2: 0
3: 29
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102047232 Original CRISPR GGGGCAGTCCAGGAGCTACG TGG (reversed) Intergenic
900634141 1:3653338-3653360 GAGGCGGCCCAGGAGCTAAGGGG - Intronic
903382790 1:22908573-22908595 TGGGCATTCCAGGAGCTCCAAGG - Intronic
903737989 1:25542559-25542581 GGAGCAGCCTGGGAGCTACGAGG + Intergenic
904192048 1:28753177-28753199 GGAGTAGTCCATGAGCTTCGGGG - Intronic
904677816 1:32209101-32209123 GTGGCAGTCCAGCAGCCAAGAGG + Exonic
911864718 1:103003221-103003243 GGGGAACTCCAGGAGCTCCAGGG - Exonic
912516179 1:110217879-110217901 GGGGCAGTCCCGGGGGTAAGAGG - Intronic
915516432 1:156415526-156415548 GGGGCCATCCAGGAGCTCCCAGG - Intronic
918354998 1:183699667-183699689 GGGGCAGGCCAGCAGCAGCGAGG - Intronic
920360830 1:205415022-205415044 GGGGCAGTCCAGTAACTCCAAGG + Intronic
920401806 1:205680676-205680698 AGGGCAGTCTGGGAGCCACGCGG - Intergenic
920933317 1:210408694-210408716 GGGGCAGTCCAAGAGTTGCTGGG + Intronic
922604842 1:226883566-226883588 GGAGCAGTCTATGAGCTACTAGG - Intronic
924261625 1:242237505-242237527 GGGACAGTGCAGGAGCAAGGGGG + Intronic
1063024939 10:2168477-2168499 GGGGCAGACCAGGGGCTGCAGGG - Intergenic
1064620846 10:17215622-17215644 GGGGTAGTGCAGGAGCAACTTGG - Intergenic
1067878605 10:50025050-50025072 GGGGGAGCCCAGGAGCTTCTCGG + Intergenic
1068125456 10:52836499-52836521 GGGTCAGTCCAGGATCCAAGAGG - Intergenic
1075822318 10:125325370-125325392 GTGGCAGTGAAGGAGCTAGGAGG + Intergenic
1076826923 10:132973849-132973871 GGGACAGTCCAGGTGCTGCAGGG - Intergenic
1078363841 11:10691045-10691067 GGGGCAGTCCAGGCTCTGTGAGG + Intronic
1080805308 11:35647822-35647844 GGGGCAGGGCAGGAGGTAGGGGG + Intergenic
1081569031 11:44278321-44278343 AGGGCAGGCCAGGAGCTGAGAGG - Intronic
1083656584 11:64232696-64232718 GGGGGTGTCCAGGAGCTGCTGGG - Exonic
1083721206 11:64604463-64604485 GGGGCAGTCCAGGAGTTGGAAGG - Intergenic
1088649868 11:111948115-111948137 GGGACAGTCCAGGAACTGGGAGG - Intronic
1089565345 11:119368411-119368433 GGGGCTGTCCTGGAGCTCCTAGG - Intronic
1091918441 12:4285857-4285879 GGGGCAGCCCTGGTGCCACGGGG + Intronic
1093113853 12:15185462-15185484 GGGGCATTCCAGGAGATCCAGGG - Intronic
1093769990 12:23007127-23007149 AGGGCATTTCAGGAGCTACTTGG - Intergenic
1094008831 12:25785015-25785037 GTGGGCGTCCAGGAGCTAAGAGG - Intergenic
1095633407 12:44403607-44403629 GGGGCTGTCCGGAAGCTATGGGG + Intergenic
1102047232 12:109837074-109837096 GGGGCAGTCCAGGAGCTACGTGG - Intergenic
1104418209 12:128613204-128613226 GGTGCTGTCCAGGAGCTGCATGG - Intronic
1110824649 13:79958240-79958262 CTGGCATTCCAGGAGCTACTGGG - Intergenic
1111396754 13:87675755-87675777 GGGGCTTTCCATGGGCTACGGGG + Exonic
1113219778 13:108086818-108086840 CTGGCAGTCCAGGAGCTCCGTGG + Intergenic
1113766915 13:112887643-112887665 GGGGCATTCCGGGGGCTCCGTGG - Intergenic
1113941637 13:114021408-114021430 GCGGCAGTCCAGCTCCTACGAGG - Exonic
1115651268 14:35404267-35404289 GGGGCGGTGCAGGAGCCCCGGGG + Intronic
1121473880 14:94175802-94175824 GCTGCAGTCCAGGAGCTAGAAGG + Intronic
1121544101 14:94751018-94751040 GAGGCAGGCCAGGGGCTACCAGG + Intergenic
1122855080 14:104556220-104556242 GAGCCTCTCCAGGAGCTACGAGG + Intronic
1123097552 14:105773663-105773685 GGGGCAGTCCTGGAGCTCAGGGG - Intergenic
1127931363 15:63599675-63599697 GGGGCAGTCACGGAGCTGCGGGG + Intronic
1129540101 15:76341780-76341802 GGGGGTGTCCGGGAGCTGCGAGG - Exonic
1130512514 15:84601146-84601168 GAGGCAGGCCTGGAGCCACGCGG + Exonic
1132152865 15:99474971-99474993 GGGGCACTCCAGGCTCTGCGGGG - Intergenic
1132618843 16:854995-855017 GGGGAAGGCCAGGAGCTTCACGG + Intronic
1132805710 16:1774175-1774197 TGGGCAGTCCAGCAGCAAAGCGG - Intronic
1134112903 16:11527039-11527061 GGGGCAGTCCAGATGCGCCGGGG - Intergenic
1135565097 16:23505876-23505898 GGCTCAGTCCAGGAGCTCCACGG - Intronic
1136293682 16:29290258-29290280 AGGGCAGGGCAGGAGCCACGGGG - Intergenic
1138061569 16:53896796-53896818 GGTTCAGTCCAGGAGCTAAAGGG + Intronic
1138780216 16:59775711-59775733 GGGGCAGTGCAGGAATTATGGGG + Intergenic
1141147205 16:81539609-81539631 GGAGCAGTTAAGGAGCTCCGAGG - Intronic
1141841986 16:86579301-86579323 GGGGCCGTCCAGGAGGGGCGAGG - Exonic
1141886263 16:86894448-86894470 GGTGAGGTCCGGGAGCTACGTGG + Intergenic
1142099565 16:88264264-88264286 AGGGCAGGGCAGGAGCCACGGGG - Intergenic
1142180023 16:88663789-88663811 GGGGCCGTCCAAGAGCTTCAAGG - Intergenic
1142727862 17:1829813-1829835 GGGGCGCGCCAGGAGCTGCGCGG - Exonic
1147421588 17:40324531-40324553 GGGGCAGTCCAGGTTCTAGGAGG - Intronic
1147508932 17:41048538-41048560 GGGGCAGTTCAGGAACTACATGG + Intergenic
1147767379 17:42845866-42845888 GGGGCAGTCCAGCTGCTTCCAGG + Exonic
1147999803 17:44380949-44380971 GGGGCTGTCCAGGACCTGGGAGG + Exonic
1150388562 17:64778425-64778447 GAGGCCATCCAGGAGGTACGCGG - Intergenic
1150456997 17:65314179-65314201 GGGGAAGTCCAGGAGGTCCTGGG - Intergenic
1152073692 17:78146346-78146368 GGGGGAGGCCAGGAACTAGGAGG + Exonic
1152144445 17:78559834-78559856 GGTGCAGTCCAGGAGCAGCAAGG - Intronic
1152722929 17:81931663-81931685 CTGGCAGTGCAGGAGCTAAGCGG - Intergenic
1154152014 18:11913772-11913794 GGGGCAGTCCTGGAGCTGACGGG - Intergenic
1157096244 18:44687870-44687892 TGGGCAGACCAGGTGCTATGGGG - Intronic
1157363004 18:47035616-47035638 GGGGCAGCCCAAGAGCTAAGAGG - Exonic
1157766637 18:50302477-50302499 GGGGCACAGCAGGAGCTGCGGGG - Intergenic
1158590853 18:58777596-58777618 GGGGCTGTCCTGGAGCTGTGAGG + Intergenic
1160047995 18:75405799-75405821 GGGGAAGGCCAGGTGCTATGTGG + Intergenic
1160917284 19:1503346-1503368 GGGGCAGCCCAGGGGGTCCGTGG + Intergenic
1161273639 19:3404011-3404033 GGGGCAGGCCAGGGGCTGGGGGG - Intronic
1161277231 19:3425306-3425328 GGGCCTGTCCAGGGGCTACCAGG + Intronic
1162216777 19:9140882-9140904 GGGGCAGTTCAGGAGATTGGGGG + Intronic
1168298864 19:55391894-55391916 GGGGCAGACCTGGAGCCACCAGG - Intronic
1168580449 19:57551538-57551560 GGTGGAGTCCAGGAGCTATGTGG + Intronic
925337969 2:3112420-3112442 GAGGGAGTCCAGGAGCTCAGAGG - Intergenic
927854427 2:26518976-26518998 GGGAAAGTCCAGGAACTCCGTGG + Intronic
928632535 2:33208649-33208671 AGGGCAGCCAAGGAGCTACGTGG - Intronic
931202049 2:60106882-60106904 GGAGGAGTCCAGGAGCTTCCAGG - Intergenic
937173552 2:119902980-119903002 GGGGAAATGCAGGAGCTACTGGG - Intronic
937313992 2:120919621-120919643 GGGACAGTGCTGGAGCCACGTGG - Intronic
938746230 2:134280983-134281005 AGGGCTGTCCAGAAGCTACTTGG + Intronic
948206081 2:236163565-236163587 GGGGCACTCCAGGATCTGCGGGG + Intergenic
948210657 2:236190981-236191003 GGGGCAGATCAGGAGGTACTTGG - Intergenic
1168841468 20:912585-912607 GGGGCTTTCCAGGAGCGAGGAGG + Intronic
1169130504 20:3164275-3164297 GGGGCAGTGCTGGAGCTAGGAGG + Exonic
1170377567 20:15717646-15717668 GGAGCAGGCCAGGAGCTAGGAGG + Intronic
1172179792 20:32995674-32995696 GGGGAAATCCAGGACCTCCGAGG - Exonic
1173681422 20:44885325-44885347 GGGCCAGTCCCGGAGATTCGAGG - Intergenic
1178708065 21:34890247-34890269 GGGGCGTTCCGGGAGCTCCGGGG - Intronic
1180062120 21:45390862-45390884 GGGGCAGGACAGGAGCTCAGAGG + Intergenic
1181030613 22:20147452-20147474 GGGGCAGTCCCAGAGCTGTGGGG + Exonic
1182802668 22:33044352-33044374 CAGGCAGTCCAAGAGCCACGTGG - Intronic
1183617231 22:38953302-38953324 GGGGCAGCCCAGGCCCTCCGGGG + Intronic
1185182026 22:49369148-49369170 GGTGCTGTCCAGGAGCCACGTGG - Intergenic
949392724 3:3580328-3580350 GTGGCAGTCCAGAAGCAACAGGG - Intergenic
950091832 3:10301212-10301234 GGGGCAGTCCTGGAGCTGGCGGG + Exonic
954129026 3:48550368-48550390 GGGCCACTCCAGGAGCTGTGTGG - Intronic
954378007 3:50205129-50205151 GGGGCAGGCCGGGAGCAAAGGGG - Intergenic
963235004 3:142947560-142947582 GGGGCAGTCCCTGAGCTCCTCGG - Intergenic
968660126 4:1795398-1795420 GGGGCGTTCCAGGAGCGACTGGG - Intronic
969373744 4:6749876-6749898 GGGCGAGTCCAGGAGCTGCCTGG - Intergenic
982349119 4:154395471-154395493 GGAGCAATCCAGGAGATAGGAGG - Intronic
985549245 5:524730-524752 CGGGCATCCCAGGAGCTGCGCGG - Intergenic
986748448 5:10763779-10763801 AGGGCAGTCCAGGGGCCACCAGG - Intergenic
997756041 5:136400334-136400356 GGGGAAGTCCAGGAGATCCCAGG - Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
998320325 5:141224271-141224293 GTGGCAATCCAGGAGCCAAGGGG - Exonic
998402120 5:141853471-141853493 GGGCCAGTCCAGGAGCAGCACGG + Exonic
999384709 5:151145978-151146000 GGGGCAGTAAAGGAGCTCTGGGG - Intronic
1000385536 5:160671518-160671540 TGGGCAGTCCAGGAATTAGGAGG + Intronic
1002811775 6:638141-638163 GAGGTAGTCATGGAGCTACGTGG - Intronic
1002980118 6:2127743-2127765 GGGGGACTCCAGGAGAGACGTGG + Intronic
1004148110 6:13089148-13089170 GGGGCAAACCAAGAGCTAAGGGG - Intronic
1004754880 6:18600635-18600657 GGGGCAGTCATGGAGCTGGGTGG + Intergenic
1007776858 6:44228776-44228798 AGGGCAGGCCAGGAGGTATGGGG - Intronic
1011431457 6:87291515-87291537 GGAGCAGTCCAGGATCTTCTAGG - Intronic
1018928439 6:168223037-168223059 GGACCAGTGCAGGAGCTATGGGG + Intergenic
1021653645 7:22854317-22854339 GGGGTAGCCCCGGAGCCACGTGG - Intergenic
1024226394 7:47329331-47329353 GAGGCAGCCCAGGAGGAACGGGG - Intronic
1026973375 7:74481038-74481060 GGGGCAGTCCAGGAAGTACAGGG - Intronic
1027360186 7:77400270-77400292 GTGGGAGTCCAGGATCCACGTGG - Intronic
1032429485 7:131849339-131849361 GGGGCAGGCCAGGAGCACTGGGG - Intergenic
1038176843 8:25187944-25187966 GGCACAGTCCAGGAACTGCGAGG - Intronic
1040342579 8:46448392-46448414 GGGGCGGCCCAGGAGCTTCTGGG + Intergenic
1044408493 8:91858617-91858639 GGGATAGTACAGGAGCTATGTGG - Intergenic
1044503117 8:92985373-92985395 GGTGGAATCCAGGAGCTAGGAGG - Intronic
1048531004 8:135250527-135250549 GGGCCTGTCCAGGGGCTAGGGGG + Intergenic
1049222166 8:141433138-141433160 GGGGCTCTCCAGGAGCTGTGTGG + Intergenic
1049526213 8:143128034-143128056 GGGCCAGGCCAGGAGGTCCGCGG - Intergenic
1057906302 9:98986075-98986097 TGGGCAATGCAGGAGCTACAGGG + Exonic
1061534116 9:131237039-131237061 GTGGCAGTCCAGAAGCCAAGTGG - Intergenic
1062656178 9:137605511-137605533 GCGGCAGTCCGCGGGCTACGGGG + Intergenic
1062726893 9:138079347-138079369 GGAGCAGTCCAGGAGGCAGGTGG + Intronic
1186836457 X:13443258-13443280 GGGGCAGGCCAGGATCTCCATGG - Intergenic
1190248322 X:48705224-48705246 GGGGGAGTACTGGAGCTACCTGG + Intronic
1192210532 X:69125064-69125086 GGAGCAGTCCAGGAGGGGCGAGG - Intergenic
1196795964 X:119502118-119502140 GGGGCTGTCCAGGAGGCACTTGG + Intergenic
1197729194 X:129795561-129795583 GGAGCTGTCCAGGATCTAAGAGG + Intergenic
1198936991 X:141908868-141908890 GGGGCAGTCGAGTTTCTACGTGG + Exonic
1200428173 Y:3045612-3045634 GGGGCAGTCCAAGTGTTACTAGG - Intergenic