ID: 1102056520

View in Genome Browser
Species Human (GRCh38)
Location 12:109900476-109900498
Sequence CGCAGGCGGCCCGCGCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102056509_1102056520 3 Left 1102056509 12:109900450-109900472 CCGGATCCGGCGTTAGGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG 0: 1
1: 0
2: 2
3: 25
4: 289
1102056512_1102056520 -3 Left 1102056512 12:109900456-109900478 CCGGCGTTAGGGCGGGGGCCCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG 0: 1
1: 0
2: 2
3: 25
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102056520 Original CRISPR CGCAGGCGGCCCGCGCGGGC GGG Intronic
900117339 1:1034239-1034261 CGCTGGCGGCCAGCCCGGGGAGG + Intronic
900227566 1:1540231-1540253 GCCAGGCGGCGCGCGCGGGCGGG + Intronic
900237477 1:1599705-1599727 CGCACGCGGCGCGCGGCGGCCGG + Exonic
900307739 1:2019349-2019371 CACAGGCGGCACAGGCGGGCGGG - Exonic
900393490 1:2443798-2443820 CGCGGGCCGCCCGAGCTGGCGGG + Intronic
900412676 1:2520031-2520053 GGCAGGAGGCACGCGCGGGCAGG + Intronic
901055982 1:6448814-6448836 GGCAGCCGGCGCGCGCGGGCTGG - Exonic
901055983 1:6448818-6448840 CGCGGGCAGCCGGCGCGCGCGGG - Exonic
902263821 1:15247244-15247266 CACAGGCCGGCCGGGCGGGCGGG + Intergenic
902478413 1:16699825-16699847 GGCAGCCGGCGGGCGCGGGCTGG + Intergenic
902917206 1:19645889-19645911 CGGAGGCTGCCGGAGCGGGCAGG + Intronic
903385259 1:22921953-22921975 AGCAGGAGGCCCGCGACGGCAGG + Intergenic
904037889 1:27568587-27568609 AGGGGGCGGGCCGCGCGGGCCGG + Intronic
904563392 1:31413324-31413346 AACGGGCGGCGCGCGCGGGCGGG - Intronic
905037944 1:34929688-34929710 CGGGGGCGGAGCGCGCGGGCGGG - Intergenic
905047330 1:35016176-35016198 CGCAGGCGGATCGCGAGGTCAGG - Intronic
905448968 1:38045321-38045343 CGCAGCCCGCCCGCGCGGCCTGG - Exonic
905912118 1:41662287-41662309 CGCTGGCGGCCCACGCGGCGCGG + Intronic
907357642 1:53889637-53889659 CCGCGGCGGCCCGGGCGGGCAGG + Intronic
907767275 1:57423864-57423886 CGCAGGTGCCCCGCGAGGACAGG - Intronic
908132036 1:61083283-61083305 TGCAGCCGGCCCGAGCGTGCGGG - Intronic
909399040 1:75205524-75205546 CTCAGGCGGCCAGCGGTGGCAGG + Exonic
913209456 1:116570865-116570887 CCCAGGGGCCCCGCGCCGGCCGG - Intronic
913300773 1:117367068-117367090 CGGAGGAGGCCCCCGCGGCCGGG + Intergenic
914338477 1:146738474-146738496 CACAGGCGTCCCGTGCAGGCTGG - Intergenic
915589008 1:156860207-156860229 CCCAGGCACCCAGCGCGGGCGGG + Intronic
917141634 1:171841461-171841483 CGCAGCGCGCCTGCGCGGGCGGG - Intergenic
918480686 1:184974156-184974178 CGCAGCCCGCCCGCGCGAGTCGG - Intronic
919486921 1:198157319-198157341 CGCAGGCGGCCCCTCCCGGCAGG - Intronic
922503092 1:226110771-226110793 CGCGGGTGGCCCGCGCGGCGCGG + Intergenic
922744850 1:228038066-228038088 GCCGGGCGGCCCGCGCGGCCGGG - Intronic
922777768 1:228224625-228224647 CACAGGCTGCACGCGCAGGCTGG + Exonic
922950909 1:229558236-229558258 CGCCGCCGGCCCGCGCCGCCAGG + Exonic
923161358 1:231317486-231317508 TGCACGCGGCGCCCGCGGGCCGG + Intergenic
923623107 1:235593941-235593963 AGCAGGCTGCCCGCGCCAGCTGG - Intronic
923744401 1:236686813-236686835 CGCGGGCCGCCCGCGCGTGGTGG + Intronic
924527228 1:244863567-244863589 GGCGGGAGGCCCGCGCGGGGTGG - Intronic
1067559943 10:47298315-47298337 CGCAGGAGGCCCGCACAAGCTGG - Intergenic
1068763039 10:60733503-60733525 CGCCAGGTGCCCGCGCGGGCCGG + Intergenic
1070835596 10:79445299-79445321 CGCCGGCGGTCGGCTCGGGCCGG + Exonic
1072757743 10:98031477-98031499 CGCAGGCGGCAGGAGCGGGTGGG - Intergenic
1073099018 10:100997524-100997546 CGCTGTGGGTCCGCGCGGGCCGG - Intronic
1074377494 10:112951641-112951663 GGCGGGCGGCGCGGGCGGGCGGG - Intronic
1076948755 10:133667610-133667632 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
1076949739 10:133670909-133670931 GGCAGGGCGCCCGCGCAGGCAGG + Intronic
1076950723 10:133674208-133674230 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076951713 10:133677518-133677540 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076952702 10:133680828-133680850 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076953686 10:133684127-133684149 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076955659 10:133743789-133743811 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076956649 10:133747099-133747121 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076957636 10:133750408-133750430 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076958621 10:133753707-133753729 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076959610 10:133757017-133757039 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1076960594 10:133760316-133760338 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
1077204646 11:1336673-1336695 CGCGGGCGCCCGGCGAGGGCGGG + Intergenic
1077227593 11:1445158-1445180 CGCAGGAGGCCTCCCCGGGCTGG + Intronic
1078023560 11:7673871-7673893 CGCGGGCGGACCCCGCAGGCTGG + Exonic
1078175205 11:8964737-8964759 CTCTGGCGACCCGTGCGGGCCGG + Exonic
1078528621 11:12119633-12119655 CGCAGGCGGCCTATGAGGGCGGG - Intronic
1079353724 11:19713780-19713802 GGCTGGGGGCCCGCCCGGGCCGG - Exonic
1083997052 11:66277961-66277983 CGCACTCGGCCCCCTCGGGCGGG - Intergenic
1084183143 11:67456456-67456478 CGCAGGCTGCCCGGGCGGGCGGG - Intronic
1085011058 11:73142103-73142125 CCCGGGCGGCCCGGGCGGCCCGG + Exonic
1087014638 11:93543275-93543297 CGGCGGCGGCGCCCGCGGGCAGG - Exonic
1088710068 11:112499809-112499831 CGGAGGCGGCCACCGCGTGCAGG + Intergenic
1089262419 11:117232189-117232211 CGTAGGCCGCCCGCGGGAGCCGG - Exonic
1089262423 11:117232197-117232219 CGCGGGCGGCCTACGCAGGCAGG + Exonic
1089796540 11:120985844-120985866 CGCAGGGGGCCCACGGGGGCTGG + Intronic
1091585887 12:1816439-1816461 GGCAGGAGGCCCGCTGGGGCAGG - Intronic
1091616191 12:2052900-2052922 GGCGGGCGGGCGGCGCGGGCAGG + Intronic
1091725420 12:2843291-2843313 CGCAGGCAGCCCGTGCTGCCAGG + Intronic
1092768133 12:11871417-11871439 CGCAGGCGGATCGCGAGGTCAGG - Intronic
1093736367 12:22625125-22625147 CGCTGGCGTCACGCGCGGGGCGG - Exonic
1095465515 12:42484110-42484132 GGCAGGCGCCGCCCGCGGGCGGG - Intronic
1096178650 12:49538999-49539021 TGCAGGCGGCGGGCGCGGGAGGG + Intergenic
1096221128 12:49828573-49828595 CGGAAGCGGCGCGCGCCGGCCGG - Intronic
1096460913 12:51821146-51821168 CGCAGGCTGCCCGGGTAGGCGGG + Intergenic
1098161438 12:67649959-67649981 CGCGGGCGGCCCGGGCGGTGGGG + Intronic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1103325359 12:120116657-120116679 CGGGGGCGGTGCGCGCGGGCGGG + Exonic
1103565268 12:121812133-121812155 AGCAGGGGGCGCCCGCGGGCCGG - Intronic
1103623755 12:122204052-122204074 CGCGGGCGGCCCAGGCTGGCGGG - Intronic
1103905394 12:124325085-124325107 CGCAGGCGGCCAGGGCGGCCAGG - Exonic
1104458292 12:128933273-128933295 CGCAGGCGGCGCCCGTGCGCAGG + Intronic
1104854341 12:131894977-131894999 CGCAGGCGGGCCGGGGGCGCGGG - Exonic
1105512440 13:21061624-21061646 CGCAGGCGCCCCGCCCGGACTGG - Intergenic
1106108963 13:26760536-26760558 GACAGGCGGCCCGCGGGGGCGGG + Intronic
1111708920 13:91786222-91786244 CGCAGGCGGATCGCGAGGTCAGG - Intronic
1113120119 13:106917047-106917069 CGCAGGAGGCCTCCGCGGGCTGG + Intergenic
1113546263 13:111153601-111153623 CGAAGACGTCCCGCGCGGGCCGG + Intronic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1116886973 14:50231420-50231442 CGGAGGCGGCGCCGGCGGGCTGG + Exonic
1119296564 14:73537833-73537855 CGCACCCGGCCCGCGCGCACCGG - Exonic
1121226207 14:92323531-92323553 CGCTGGCGGCCCGGGCTCGCAGG - Intronic
1121473446 14:94174245-94174267 CGCGGGCGGGCTGCGGGGGCGGG - Intronic
1122606658 14:102951154-102951176 GGGAGGCGGCCCGGGCTGGCAGG - Intronic
1122688774 14:103521991-103522013 TGCGGGCGGGCCGGGCGGGCGGG - Intronic
1127867463 15:63043662-63043684 CGCGGGCGGCCGGCACGGACCGG - Intronic
1128987432 15:72231345-72231367 CGGCGGCGGAACGCGCGGGCAGG + Exonic
1129453028 15:75661288-75661310 GGCAGGCGGGCAGGGCGGGCTGG - Exonic
1129612264 15:77070615-77070637 CGCGCTCGGCCCACGCGGGCTGG - Intronic
1129763964 15:78149459-78149481 GGCAGGCAGGCCGCGAGGGCTGG + Intronic
1131108575 15:89750569-89750591 CGCAGGCGGGTCGCGCGGCTCGG + Exonic
1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG + Intronic
1131517616 15:93089327-93089349 GGCGGGGGGCGCGCGCGGGCGGG + Intergenic
1132527858 16:426287-426309 CGCAAGCTGCCCCCGCGGGCCGG - Exonic
1132719682 16:1309611-1309633 CGCGGGCGGGGCGCGCGGGGCGG - Intronic
1132850002 16:2020628-2020650 CGGAGGCGCCACGGGCGGGCGGG - Exonic
1132873235 16:2124760-2124782 GTGAGGCGGCCAGCGCGGGCGGG - Intronic
1132873254 16:2124803-2124825 CGCAGGCGGCCCCTCCGAGCCGG - Intronic
1132882935 16:2170403-2170425 CCCAGGCCGCCCAGGCGGGCAGG + Intronic
1132903071 16:2268701-2268723 GGCAGGCGGGCTGTGCGGGCAGG + Intergenic
1132925970 16:2429318-2429340 CGGCGGCGGCCCCCCCGGGCAGG + Intergenic
1133136818 16:3717785-3717807 CGCAGCCGGCCAGCGTGGGCCGG - Intergenic
1133188295 16:4115864-4115886 CGCAGGCGGCTCGCGGGGCTGGG - Exonic
1133226898 16:4345130-4345152 CGCAGGGGGGTGGCGCGGGCTGG + Intronic
1134070176 16:11255830-11255852 AGCAGGCGGCGGGCGCGGGGCGG - Intronic
1134134133 16:11668554-11668576 GGCAGGCCGCGCGCTCGGGCCGG + Intronic
1134552323 16:15143939-15143961 GTGAGGCGGCCAGCGCGGGCAGG - Intergenic
1139995801 16:70978880-70978902 CACAGGCGTCCCGTGCAGGCTGG + Intronic
1141608806 16:85170082-85170104 TGGCGGCGTCCCGCGCGGGCGGG - Intergenic
1141830141 16:86505793-86505815 CCCAGGCCGGCCGCGCGGGCGGG - Intergenic
1141981005 16:87550569-87550591 AGCAGGTGGCGCGCCCGGGCAGG + Intergenic
1142240176 16:88941366-88941388 CGGAGGCGGAGCGCGCGGGGCGG - Intronic
1142299206 16:89247051-89247073 CGAGGGCGGCCCGCGCCGGTTGG - Intergenic
1142350364 16:89576715-89576737 CGCTGGCGCCCCGCGCGGACTGG - Intronic
1142429750 16:90019575-90019597 AGCAGGGGGCGCGCGCGGGCCGG - Intronic
1142666649 17:1467451-1467473 CGCGGGCGGCCCCCGGGGACAGG - Intronic
1142695301 17:1629678-1629700 TGAAGGTGGCCAGCGCGGGCAGG - Intergenic
1143116617 17:4584930-4584952 CCCAGGCGGGGCGCGCGGTCGGG - Exonic
1144787615 17:17840594-17840616 GGCAGGCGTCCAGCACGGGCAGG + Intergenic
1147259041 17:39197860-39197882 TGCAGGCGGCCCGCTGGGGCGGG + Intergenic
1147811247 17:43171274-43171296 GGCAGGCGCCCCCCGGGGGCGGG + Intronic
1148150817 17:45395717-45395739 GCCGGGCGGCCCGCGCGGGAAGG - Intronic
1148323535 17:46771214-46771236 CGCAGGCGCGGGGCGCGGGCGGG - Intronic
1149038377 17:52158890-52158912 GGCAGGAGGCCCGGGCGGGGAGG + Intronic
1152586399 17:81191370-81191392 CGGAGCCGGCCCGCGGGGCCAGG + Intronic
1152708938 17:81860592-81860614 CGCGGCCAGCGCGCGCGGGCGGG - Exonic
1153238820 18:3013039-3013061 CGCAGGCGTCCCTCCGGGGCTGG - Intronic
1154416662 18:14179046-14179068 CGGAGGTGGCACGCGCTGGCAGG - Intergenic
1155392203 18:25349891-25349913 CGGAGGAGGGGCGCGCGGGCAGG - Intronic
1155508139 18:26550515-26550537 CGGAGGCGGCCCGCGAGGCAGGG - Intronic
1157464207 18:47930538-47930560 GGCCGGCGGCCCGGGCGCGCGGG + Exonic
1158695040 18:59696754-59696776 CGGAGGCGGGCAGCGCGCGCTGG + Intronic
1160791691 19:926327-926349 GGAAGGCGGCCCTGGCGGGCTGG + Intronic
1160869273 19:1269591-1269613 CGCCGGCGGCCCGGACCGGCGGG - Intronic
1161108748 19:2456841-2456863 CGCTGCCCGGCCGCGCGGGCGGG - Exonic
1161197264 19:2993781-2993803 CGGAGGCGGACCGCGCCGGTGGG - Intronic
1161228971 19:3163036-3163058 GGCAGGCGGCACCGGCGGGCGGG + Exonic
1161248973 19:3270504-3270526 CTCGGGCGGGCAGCGCGGGCAGG + Intronic
1161770267 19:6227143-6227165 GGCAGGGGGCCCACACGGGCCGG + Intronic
1162555672 19:11384135-11384157 CCCAGGCGGCCCCAGCGAGCAGG + Exonic
1162778603 19:12995419-12995441 AGCGGGCGGGCGGCGCGGGCGGG - Intergenic
1163663945 19:18594472-18594494 GGCAGGGGGTGCGCGCGGGCAGG + Intronic
1163807055 19:19405831-19405853 GGCCGGCGGCGCGGGCGGGCGGG + Intronic
1165058544 19:33194205-33194227 CGGAGGCGGCTGGGGCGGGCCGG - Intronic
1165227479 19:34365142-34365164 CGCAGGCGCCCGGCCCGGCCCGG - Intronic
1165307192 19:35010025-35010047 CTCAGCCGGCGCCCGCGGGCTGG - Intronic
1165311351 19:35030868-35030890 CGCGGGGGGCGCGCGCGGCCGGG + Intronic
1165349300 19:35267703-35267725 CGCAGGCGTCCCGAGAGCGCAGG + Exonic
1165479499 19:36054294-36054316 GGCAGGCGGCGAGCGCGGGTGGG - Exonic
1166094445 19:40530420-40530442 GGCAGGGGGCGCACGCGGGCGGG + Intronic
1166245377 19:41522076-41522098 CGGAGGGGGCCCGGGCGGGCCGG - Intergenic
1167080825 19:47275152-47275174 GACAGGCGGCACGCCCGGGCGGG - Exonic
1167638669 19:50668643-50668665 CGGCCGCGGCCCGAGCGGGCGGG + Exonic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
1168218616 19:54944533-54944555 CTCAGGAGACCCGCGCCGGCCGG - Intronic
1202712432 1_KI270714v1_random:25656-25678 GGCAGCCGGCGGGCGCGGGCTGG + Intergenic
926069261 2:9872096-9872118 CGCAGGCGGATCACGAGGGCAGG + Intronic
927125962 2:20012600-20012622 GGGAGGCGGCGCGCGGGGGCCGG + Exonic
929523316 2:42675361-42675383 CGCAGGCGGACCACGAGGTCAGG - Intronic
930096774 2:47571444-47571466 CGCCGGCCGCCCGCTCGGTCGGG - Intergenic
931321564 2:61178038-61178060 CGCAGGCGCCTCCCGCGAGCCGG + Exonic
932761699 2:74442124-74442146 CGCTCGCGACCCGCGCGGGCAGG - Intronic
934500548 2:94857485-94857507 CCCTGGCGGCGCGCGCCGGCAGG + Intergenic
934951269 2:98577157-98577179 GGCAGGCGGGGCGCGCGGCCTGG - Intronic
935265159 2:101387420-101387442 GGCCGGCGGCCGGCGCGGCCGGG - Exonic
936452885 2:112646337-112646359 CGCGGAGGGCGCGCGCGGGCTGG + Intronic
937953774 2:127408065-127408087 CGCAGACGGCGCGGGCGGGGAGG - Intergenic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
938771227 2:134502847-134502869 CCCAGGGGGCCAGCGCTGGCAGG + Intronic
940918871 2:159286494-159286516 CTCAGACGCCCCGCGCGAGCAGG + Exonic
941384944 2:164841396-164841418 CGGCGGCGGCGCCCGCGGGCTGG - Exonic
941846796 2:170141696-170141718 CTCAGGCGGCCCCAGCAGGCTGG + Intergenic
942681391 2:178480763-178480785 CGGAGGGGGCCCGGGCGGGCCGG + Exonic
947588750 2:231372539-231372561 CGCAGGCCTCCCCCGCGGGATGG - Intronic
949004226 2:241636593-241636615 GGCCGACGGCCCGCGCGGTCCGG + Intronic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1169081570 20:2800539-2800561 CGAAGGCGGCCAGGGCGAGCAGG + Exonic
1169204543 20:3732535-3732557 CGGCGGAGGCCCGCGCAGGCAGG + Intergenic
1170524756 20:17226836-17226858 CGGAGGCGGCCGGGCCGGGCCGG + Intronic
1172277219 20:33686267-33686289 CGCTCACGGCCCGCGCGGCCCGG + Exonic
1172409093 20:34709271-34709293 GGAGGGCGGCCCGCGGGGGCAGG - Exonic
1172855678 20:38000468-38000490 CGCTGGCCGCCCACGCGGGAGGG - Intronic
1174204343 20:48828025-48828047 CGGAGGCAGCGCGCGGGGGCCGG + Intergenic
1175198468 20:57262634-57262656 GGCAGGCGGCCTGCGTGCGCGGG - Intronic
1175847209 20:62065303-62065325 CGCGGGCGGCCAGCGCGGCGGGG + Exonic
1176160177 20:63643694-63643716 CGGAGGCGGCCCACGGGGACAGG - Intronic
1176234443 20:64047950-64047972 CGCAGGGGCCCCCCGAGGGCAGG + Exonic
1176856673 21:13980214-13980236 CGGAGGCGGCACGCACTGGCAGG + Intergenic
1177637581 21:23807037-23807059 CGCAAGCGCCCCGCGCAGCCCGG - Intergenic
1178416978 21:32412391-32412413 GGCACCCGGCCAGCGCGGGCAGG + Exonic
1180285575 22:10741893-10741915 CCCTGGCGGCCCCCGCGGCCTGG - Intergenic
1180871661 22:19150163-19150185 GGCAGGCGGCCCGGGCCGGGAGG + Exonic
1182729386 22:32474974-32474996 GGCAGGCGGCCCGAGGGGCCTGG - Exonic
1183994347 22:41621563-41621585 CGCAGGCGGGCCGCAAGCGCAGG - Exonic
1184680914 22:46071712-46071734 CGCGGCCGGCGCGCTCGGGCGGG + Intronic
1184759454 22:46536626-46536648 CGCAGGCGGACCGAGCCGCCCGG + Exonic
1185281513 22:49971899-49971921 CCCAGGCGGGCTGCGGGGGCAGG + Intergenic
1185292647 22:50034915-50034937 CACAGGAGGCCTGCACGGGCCGG - Intronic
950549103 3:13655551-13655573 GGCAGGCGGCCGGCGCGGATGGG - Intergenic
951558809 3:23945842-23945864 CGCACGTGGCTCGCGCGGCCGGG - Intronic
953099230 3:39809399-39809421 CGCGGGCGGCACGCGCCGGGAGG - Intronic
956604952 3:71064864-71064886 CTCGGGGCGCCCGCGCGGGCCGG + Intronic
956659451 3:71583636-71583658 CGCGGGGTGCGCGCGCGGGCGGG - Intronic
960884927 3:122384151-122384173 CGCAGGCGGCGCCGGGGGGCGGG - Intergenic
961665081 3:128489487-128489509 AGCAGGCGGCTCGGGCAGGCGGG - Intronic
961827525 3:129606753-129606775 CGGGGGCGGCTGGCGCGGGCAGG - Exonic
962106619 3:132396515-132396537 CGCAGCCGGCCAGCGCCTGCTGG + Intergenic
966726900 3:183116351-183116373 CGCAGCCAGTCCGCACGGGCAGG - Intergenic
966743514 3:183254444-183254466 CGCTGGCCACCCGCGCGGGCAGG - Intronic
968230770 3:197003388-197003410 AGCAGGCGGGCGGCGAGGGCGGG + Exonic
968471916 4:786354-786376 GGGAGGCGGCGGGCGCGGGCAGG + Exonic
968729273 4:2262026-2262048 CGGAGCCGGCCGGAGCGGGCCGG - Exonic
968942420 4:3645768-3645790 CACAGGCGGCCCTGGCAGGCAGG - Intergenic
968946930 4:3669770-3669792 AGGAGGCGGCCCACGCCGGCGGG + Intergenic
971405622 4:26319473-26319495 GGCGGGCGGCGGGCGCGGGCGGG - Intronic
975633058 4:76421187-76421209 CCCACGCGGCTCGCGCGGACTGG - Intronic
979523824 4:121697061-121697083 CGCAGGCCGGCCGCGCCAGCCGG + Exonic
981577099 4:146216960-146216982 TGCAGGCTGCCCTCGTGGGCTGG + Intergenic
985446163 4:190022184-190022206 GGCAGGGCGCCCGCGCAGGCAGG - Intergenic
985452209 4:190068394-190068416 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
985453193 4:190071691-190071713 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
985454183 4:190074984-190075006 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
985455171 4:190078277-190078299 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
985456159 4:190081577-190081599 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
985457143 4:190084871-190084893 GGCAGGGCGCCCGCGCAGGCAGG + Intergenic
985458130 4:190088164-190088186 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
985459119 4:190091464-190091486 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
985463372 4:190174233-190174255 GGCAGGGCGCCCGCGCAGGCAGG + Exonic
985539765 5:482490-482512 CCCAGGCTCCCCTCGCGGGCGGG + Intronic
985696756 5:1345185-1345207 CCCAGGAGGGCGGCGCGGGCGGG - Intergenic
986606631 5:9529359-9529381 GGCAGGCTGCCCACGAGGGCTGG - Intronic
987543792 5:19287765-19287787 CGCAAGCGCCGCGCGCAGGCCGG - Intergenic
988825353 5:34929795-34929817 CGCCGGCCGCCCGCCCGGTCGGG + Exonic
990041501 5:51383085-51383107 CGCAGGCGGCGCGGCCGGGAAGG + Intergenic
991567605 5:68020743-68020765 CGCAAGCGCCGCGCGCGGTCCGG + Intergenic
992365409 5:76084558-76084580 CTTAGGCGGCGCGCGGGGGCGGG + Intronic
992690392 5:79236032-79236054 CGCACCCCGCCCGCGCGCGCCGG - Intronic
999079023 5:148826297-148826319 CGCAGGCGCCCAGGGCAGGCAGG + Exonic
1001401865 5:171450847-171450869 GGGAGGCGGCCCAGGCGGGCAGG - Intronic
1001470220 5:172006617-172006639 TGCCGGCGGCCCGGGCGGGCTGG - Exonic
1002139831 5:177132266-177132288 AGCAGGCGGCCCGCTCTGGGCGG + Intergenic
1002140438 5:177134196-177134218 CGCAGGCGGCCGGCGGGGCACGG - Intronic
1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG + Exonic
1004248482 6:14002672-14002694 CGCAGGAGCCCACCGCGGGCGGG - Intergenic
1007553597 6:42747624-42747646 CGCAGGCGGGGCGCGGGGGCAGG + Intronic
1013330312 6:109094576-109094598 AGCAGCCGGCCGGCGCCGGCAGG + Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1016738550 6:147506823-147506845 AGGCGGCGGCCCGCGCGGGGCGG + Intergenic
1017073831 6:150600134-150600156 CGCAGGGGGCCGGCGGGGCCCGG - Intronic
1017955074 6:159170258-159170280 GGCAGGAGGCCCGCGCGCCCGGG + Intronic
1018876576 6:167827022-167827044 CGGAGGCGGCCGGCGGGGGGTGG + Exonic
1019374747 7:683472-683494 CGCAGGAAGCCAGGGCGGGCTGG - Intronic
1019437278 7:1028600-1028622 GGCAGGGGCCCTGCGCGGGCGGG - Intronic
1019599819 7:1875561-1875583 AGCAGGTGGCCCACACGGGCTGG + Intronic
1019828199 7:3301165-3301187 CGCGGGCGGCGCGTGCGGCCGGG + Intergenic
1020278296 7:6637481-6637503 CGCGGGCGGCAGGTGCGGGCGGG + Intronic
1021868646 7:24981656-24981678 GGCAGGCGGCGGGCGAGGGCGGG + Intergenic
1023017536 7:35982717-35982739 CGGAGGTGGCCAGCGCGGGCGGG - Intergenic
1023938821 7:44757381-44757403 TGCAGGCGGCCCGGGGGGCCTGG + Exonic
1025217341 7:57070006-57070028 CCCAGGCGCCCAGGGCGGGCAGG - Intergenic
1025628258 7:63243659-63243681 CCCAGGCGCCCAGGGCGGGCAGG - Intergenic
1025654007 7:63500459-63500481 CCCAGGCGCCCAGGGCGGGCAGG + Intergenic
1027232960 7:76282663-76282685 TGCTGGCGGGCCGCGCGCGCGGG - Exonic
1027421184 7:78019588-78019610 CGGACGCGGCGCGGGCGGGCGGG - Exonic
1030093351 7:105876755-105876777 GGCGGGCGGCCCCGGCGGGCGGG - Intergenic
1032239949 7:130152994-130153016 CGCAGGCAGGCAGCACGGGCAGG + Intergenic
1032530449 7:132615439-132615461 CGCAGGCGGCCCGCAGTGCCCGG + Intronic
1037450720 8:19013794-19013816 CGAAGGCGGCGCAGGCGGGCCGG + Intronic
1037529223 8:19757338-19757360 CGGCGGCGGCTCGGGCGGGCGGG + Intronic
1037825258 8:22156682-22156704 CGCAGCCGGCGCCCGAGGGCAGG - Exonic
1037902168 8:22694675-22694697 CGCAGCCGGCCCGCGGGCGAGGG + Intergenic
1038798161 8:30727604-30727626 CGGGGGCGGCTCGGGCGGGCTGG - Exonic
1039467828 8:37796822-37796844 CGCGGAAGGCCCGGGCGGGCGGG + Intronic
1039843449 8:41309342-41309364 CGGAGGCGGCGCGGGCGGGGAGG + Exonic
1040595601 8:48834895-48834917 AGCAGGCGGCACCCCCGGGCAGG + Intergenic
1042695129 8:71547537-71547559 CGGAGGCTGCCCGGGCGGGCTGG + Exonic
1045098937 8:98825871-98825893 GGCTGGCGGCCGGCGCGGCCGGG - Intronic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1048553983 8:135457628-135457650 CGCCGGCGGCCCCCGCGCTCCGG - Exonic
1049237149 8:141518148-141518170 CGGGAGCGGCCCGCGCAGGCGGG - Intronic
1049419465 8:142510551-142510573 CGCCCCCGGCCCGCGCGGGAAGG - Intronic
1049452644 8:142670221-142670243 CGAAGGCGGGGCGCGCGGCCTGG + Intronic
1049724315 8:144138435-144138457 CCCAGGGCGCCCGCGCGGGCGGG + Intronic
1053139863 9:35675787-35675809 TGGAAGCGGCCCGCGCAGGCTGG - Exonic
1053906977 9:42852285-42852307 CCCTGGCGGCGCGCGCCGGCAGG - Intergenic
1054357043 9:64071510-64071532 CCCTGGCGGCGCGCGCTGGCAGG - Intergenic
1057075621 9:92136751-92136773 GGCAGGGGGCCAGCGTGGGCTGG + Intergenic
1057198161 9:93126621-93126643 TGCAGCCGGCCCGCTGGGGCTGG - Exonic
1057489641 9:95511127-95511149 CGCTGGCTGCCCGGGCGCGCTGG + Intronic
1058885893 9:109320853-109320875 CGCAGGCGCCCTGCTCCGGCTGG - Exonic
1059102442 9:111483674-111483696 CGCAGGCGGCGGCGGCGGGCGGG - Intronic
1060481281 9:124017990-124018012 CGCGGGAGTCCCGCGCGGACCGG + Intronic
1060634576 9:125189817-125189839 CGCAGGCGCCACTCACGGGCCGG - Exonic
1060832161 9:126723339-126723361 TTCAGGGAGCCCGCGCGGGCGGG + Intergenic
1060849265 9:126860889-126860911 GGCAGGCGGCCGGCGCGGGCGGG + Intronic
1061128195 9:128689715-128689737 CGCAGGCCGCCGGCGGGGCCCGG + Intronic
1061293428 9:129665278-129665300 CTCTGTCGGCCAGCGCGGGCGGG + Intergenic
1062428700 9:136517491-136517513 CGCAGGGGGCCCGTGGTGGCTGG - Intronic
1062573122 9:137194586-137194608 AGCAGGGGGGCCGCGGGGGCTGG + Intronic
1186496445 X:10015529-10015551 AGGAGGCGGCGCGCGCGGGGCGG + Intergenic
1194890455 X:99372151-99372173 CGCAGGCGCCCACCGCGGGGAGG + Intergenic
1194977316 X:100408670-100408692 AACAGGCGGCCCGAGCCGGCGGG - Exonic
1199772706 X:150984311-150984333 CCCGGGCGGCCCGGGCGGGGCGG + Intronic
1200231143 X:154444446-154444468 CGCGGGCGGCGCGCCGGGGCAGG + Intronic