ID: 1102060254

View in Genome Browser
Species Human (GRCh38)
Location 12:109926225-109926247
Sequence AGCCTTACCCCTTCTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102060249_1102060254 -7 Left 1102060249 12:109926209-109926231 CCATGGAGCCACTAGGAGCCTTA 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1102060254 12:109926225-109926247 AGCCTTACCCCTTCTGGGTTGGG 0: 1
1: 0
2: 3
3: 43
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102060254 Original CRISPR AGCCTTACCCCTTCTGGGTT GGG Intronic
901691040 1:10973668-10973690 AGCCCCGCCCCTTCTGAGTTGGG + Intronic
903082213 1:20820025-20820047 AGCCCTGCCCCTTCTGAGTTGGG + Intronic
906082561 1:43102711-43102733 AACCTCACCCCTTCCGAGTTGGG - Intergenic
907505984 1:54918587-54918609 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
907602867 1:55787976-55787998 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
907603525 1:55793827-55793849 AGCTCTGCCCCTTCTGAGTTGGG + Intergenic
909754334 1:79204681-79204703 AGCCTTACCTAGTCTGGCTTTGG - Intergenic
911663088 1:100525468-100525490 AGCCTTTCTCACTCTGGGTTTGG + Intergenic
915167123 1:153954177-153954199 GGAGTTGCCCCTTCTGGGTTGGG - Intronic
918070944 1:181133003-181133025 ACTCTTACCTCTTCTGGGGTGGG - Intergenic
918893229 1:190303593-190303615 AGCCTTACTTATTCTGGTTTAGG + Intronic
919165448 1:193885647-193885669 AGTCCTGCCCCTTCTGAGTTGGG - Intergenic
920269403 1:204752045-204752067 AGCCCCGCCCCTTCTGAGTTGGG + Intergenic
920425995 1:205875598-205875620 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
921902165 1:220462896-220462918 AGCCCCGCCCCTTCTGAGTTGGG + Intergenic
922132591 1:222794836-222794858 AGCCCCACCCATTCTGAGTTGGG + Intergenic
922596018 1:226813672-226813694 TCCCTGACCCCTTTTGGGTTGGG + Intergenic
922615859 1:226960878-226960900 AGCCTCAGCCCCTGTGGGTTTGG + Intronic
924672892 1:246147526-246147548 AGCCTCACCCATTCTGGGTTGGG + Intronic
1062771652 10:105538-105560 AGCCCTACCCCTTCCAAGTTGGG - Intergenic
1066101654 10:32123083-32123105 AGCCTCATCCCTTCTAAGTTGGG - Intergenic
1067405659 10:46021401-46021423 AATCTTACCCCTTCTGGCTGTGG - Intronic
1068060792 10:52064736-52064758 ACCCCCACCCCTTCTGAGTTGGG - Intronic
1070205358 10:74253527-74253549 ACCCTTGCCCCTACTGAGTTAGG - Intronic
1070801426 10:79246562-79246584 ATCCTTCTCCCTGCTGGGTTCGG - Intronic
1071300509 10:84252927-84252949 AGCTCTGCCCCTTCTGGGTTGGG + Exonic
1071327318 10:84530097-84530119 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1072335700 10:94395962-94395984 AGCCCCACCCCTTCTGAGCTGGG - Intergenic
1075558075 10:123447674-123447696 GCCCTAAGCCCTTCTGGGTTTGG - Intergenic
1076427728 10:130379528-130379550 TTCCTTCCCACTTCTGGGTTCGG + Intergenic
1080267279 11:30414811-30414833 AGTCTTACCCCTTGTGGTTCCGG + Intronic
1081090734 11:38863114-38863136 AGTCTTTCACCTTCTTGGTTAGG + Intergenic
1084149120 11:67279943-67279965 AGCCATACCCCTTCTGAGAGCGG - Intronic
1084991012 11:72925804-72925826 AGCCCTGCCCCTTCTGAGTTGGG + Intronic
1085055521 11:73401366-73401388 GGCCTTACCCCCCCTGGGTAAGG + Intronic
1085100448 11:73796114-73796136 AGCCCTGCCCCTTCCGAGTTGGG + Intronic
1085150831 11:74251798-74251820 TGCCTTACCCCTGCCTGGTTTGG + Intronic
1087465186 11:98495254-98495276 GTCCTTTCCCCTTCTGGGTAGGG + Intergenic
1088179865 11:107097060-107097082 AGCCTTTCACCTCCTTGGTTAGG - Intergenic
1088513089 11:110598774-110598796 AGCCCTGCCCCTTCTGAGTTGGG + Intronic
1089505951 11:118961858-118961880 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1090239880 11:125174589-125174611 AGCCTTCCCACTGCTGGGCTAGG - Intronic
1093493196 12:19726924-19726946 AGCCTGGCCCCTTCTGAGTTGGG - Intergenic
1095138662 12:38637201-38637223 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1095283554 12:40384597-40384619 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1096032239 12:48429600-48429622 GGCCTTTCACCTTCTTGGTTAGG - Intergenic
1096172096 12:49479615-49479637 AGCCCTACCCCTTCTGAGTTGGG - Intronic
1096602711 12:52741938-52741960 AGCCCCACCTCTTCTGAGTTGGG + Intergenic
1097076391 12:56397682-56397704 AGCCCTGCCCCTTCTGAATTGGG - Intergenic
1097465994 12:59925256-59925278 AGTCTTTCACCTTCTTGGTTAGG + Intergenic
1098454952 12:70661649-70661671 ACCCTCACCCGTGCTGGGTTTGG - Intronic
1098597999 12:72295259-72295281 AGCCCTGCCCCTTCTGAGCTGGG - Intronic
1098644400 12:72880500-72880522 AGGCTTAACACCTCTGGGTTTGG + Intergenic
1099104609 12:78483127-78483149 AGGCTAACCCCTTTTGGCTTTGG - Intergenic
1100847737 12:98678404-98678426 AACCCTACCCCTTCTGAATTGGG + Intronic
1101764138 12:107682793-107682815 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1102060254 12:109926225-109926247 AGCCTTACCCCTTCTGGGTTGGG + Intronic
1103024492 12:117562637-117562659 AGCCTTACCTGTTCTGTCTTGGG - Intronic
1104851875 12:131879993-131880015 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1107662704 13:42655937-42655959 AGTCTTACCACTTGTGGCTTTGG + Intergenic
1108088188 13:46818112-46818134 AGCCCTGTCCCTTCTGAGTTGGG + Intergenic
1110008049 13:70297098-70297120 AGCACTACCCCTTCTGAGTTGGG + Intergenic
1114383947 14:22237327-22237349 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1115507539 14:34106885-34106907 AGATTTTCCCCCTCTGGGTTTGG + Intronic
1116009403 14:39333326-39333348 AGCCTTTTCCCTTCTGTGGTGGG + Intronic
1116044614 14:39729291-39729313 AGTCTTTCACCTTCTTGGTTAGG + Intergenic
1119828007 14:77674080-77674102 AGGCCTTCCCCTTCTGGATTTGG + Exonic
1121889414 14:97574923-97574945 AGCCTTCTGGCTTCTGGGTTGGG - Intergenic
1122634226 14:103122759-103122781 AGCCTTTCCCCCTCTGGGGCTGG - Intergenic
1122742435 14:103880081-103880103 AGCCTTTCCCCTCCTGCTTTGGG + Intergenic
1124219247 15:27835174-27835196 TGCTTTAGCCATTCTGGGTTGGG - Intronic
1124937411 15:34186282-34186304 AGCCCCGCCCCTTCTGAGTTGGG + Intronic
1126185889 15:45829976-45829998 AGCCCCGCCCCTTCTGAGTTGGG - Intergenic
1127284912 15:57524048-57524070 GCCTTTACCCCTTCTGGGTATGG - Intronic
1127616577 15:60691837-60691859 ACCTTTACAGCTTCTGGGTTGGG - Intronic
1128847729 15:70916723-70916745 AGCCCTGCCCCTTCCGAGTTGGG + Intronic
1129708458 15:77808033-77808055 AGCCTTACCCATGCAGGCTTGGG + Intronic
1129713340 15:77832676-77832698 GGCCTTGCCCCTTCTGAGCTGGG - Intergenic
1131204231 15:90427894-90427916 AGCCTTACTCATTCTGAGTTTGG - Intronic
1131420219 15:92298859-92298881 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
1132461775 16:58966-58988 AGCCTTACCTCTGCTCGGTATGG + Exonic
1134896895 16:17896282-17896304 AGCCTTTCCCAGTCTGGGCTGGG - Intergenic
1137698589 16:50479048-50479070 AGCCCCGCCCCTTCTGAGTTGGG - Intergenic
1137825396 16:51490046-51490068 AGCCCCATCCCTTCTGAGTTGGG - Intergenic
1141821693 16:86450689-86450711 AGCCTTACCTCTTCTGTGAACGG + Intergenic
1148327391 17:46791123-46791145 AGCCTTTTCCCTACTGGGTTGGG + Intronic
1148754079 17:49963396-49963418 AGCCTTACCTCTGCTGGTTTGGG - Intergenic
1149554775 17:57565566-57565588 AGCCTTACCAGTTTTGTGTTGGG + Intronic
1150387723 17:64774356-64774378 GGCCTTCCCACTTCTGGGTGGGG + Intergenic
1150901026 17:69277086-69277108 AGCTTTAGCCCTTCTCAGTTAGG - Intronic
1150952647 17:69821106-69821128 AGCCCCGCCCCTTCTGTGTTAGG + Intergenic
1154507849 18:15060542-15060564 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1155224803 18:23719890-23719912 AGCCATCCACCTTCTGGATTGGG - Intronic
1157344002 18:46807062-46807084 AGCCTTACCACTTTTCAGTTTGG + Intergenic
1157768351 18:50322342-50322364 AGCCTTGACCTTTCTGGGCTTGG + Intergenic
1158025359 18:52890253-52890275 AGGCTTAACCCTTATGAGTTGGG + Intronic
1158773684 18:60552628-60552650 AGCCCTGCCCCTTCTGAGTTGGG + Intergenic
1160136527 18:76276232-76276254 AGCCTGGCCCCTTCTGGGAGAGG - Intergenic
1160906829 19:1455601-1455623 AGTCTTATGCCTCCTGGGTTGGG + Intronic
1161980229 19:7626443-7626465 AGCCTTGGCCCCACTGGGTTAGG + Intronic
1164056979 19:21630076-21630098 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1164173191 19:22745627-22745649 AGCCTTAGCCCTATTGGGATTGG - Intergenic
1164729180 19:30489140-30489162 AGCCTTGTCCCCTTTGGGTTTGG - Intronic
1167234923 19:48308655-48308677 AGCCCTGACCCTTCTGAGTTGGG + Intronic
1168084407 19:54034813-54034835 AGCCCTGCCCCTTCCGAGTTGGG + Intergenic
1168303272 19:55419290-55419312 AGCCCCGCCCCTTCTGAGTTGGG + Intergenic
925608280 2:5681602-5681624 TGCATTACCCCTTTTGGCTTTGG - Intergenic
926859419 2:17292373-17292395 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
927072771 2:19547974-19547996 AGCCTCGCCCCTTCTGAGTTGGG + Intergenic
927177352 2:20419976-20419998 AGCCTTCCTGCTTGTGGGTTAGG + Intergenic
928476119 2:31629568-31629590 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
931065810 2:58585623-58585645 AGACTTACCACTTCTGGCTTAGG + Intergenic
931499900 2:62854864-62854886 AGCCCCGCCCCTTCTGAGTTGGG + Intronic
935748447 2:106209899-106209921 AACCCCAACCCTTCTGGGTTGGG + Intergenic
937295451 2:120807248-120807270 TGCCCTGCCCCTTCTCGGTTGGG + Intronic
937361258 2:121231599-121231621 CTCCTTACCCCTCCTGGGCTGGG - Intronic
937912205 2:127081169-127081191 ACCCTTCCTCCTTCTGGGTTCGG - Intronic
938180791 2:129179781-129179803 AGCCCCATCCCTTCTGAGTTGGG - Intergenic
940298424 2:152154151-152154173 AGCCTTACCCCTGCAGGGAGAGG - Intronic
941007287 2:160261144-160261166 CTCCTTACCCCTTCAGGCTTAGG - Intronic
941298136 2:163766364-163766386 AGCCAAACCCCTTTTGGGTCTGG - Intergenic
942103869 2:172613782-172613804 AGCCCTTCTCCTTCTGAGTTGGG + Intergenic
943023144 2:182599046-182599068 AGCTCTGCCCCTTCTGAGTTGGG + Intergenic
943023563 2:182602263-182602285 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
943961066 2:194264673-194264695 AGCCCTGCCCCTTCTGAGTTAGG + Intergenic
945089253 2:206163474-206163496 AGCCCTCCCTCCTCTGGGTTAGG - Intergenic
948476220 2:238221457-238221479 AGCCCTGCCCCTTCTGAGCTGGG - Intergenic
1170878940 20:20277694-20277716 ATCCTTATCTCTTCTGGCTTTGG + Intronic
1172676543 20:36676868-36676890 AGCCCCGCCCCTTCCGGGTTGGG + Intronic
1174477865 20:50809811-50809833 AGTCTTTCACCTCCTGGGTTAGG + Intronic
1175675755 20:60945539-60945561 AGCCCCATCCCTTCTGAGTTGGG + Intergenic
1176790233 21:13311257-13311279 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1177263882 21:18759593-18759615 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1177528069 21:22323287-22323309 AGTCTTTCACCTTCTTGGTTAGG - Intergenic
1177895827 21:26855375-26855397 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1177989406 21:28019466-28019488 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1178684012 21:34697278-34697300 GGCCTTTCCCCTCCTGGCTTTGG - Intronic
1182895408 22:33855455-33855477 CGCCTGATCCTTTCTGGGTTGGG - Intronic
1184613491 22:45622013-45622035 GGCCCTGCCCCTTCTGAGTTGGG + Intergenic
950178838 3:10896588-10896610 AGCCATTTCCCTTCTGGGTAAGG - Intronic
952015979 3:28958543-28958565 AGCCCCACCCCTTCGGAGTTGGG + Intergenic
952922602 3:38296332-38296354 ACCCCCAACCCTTCTGGGTTGGG - Intronic
954274895 3:49535749-49535771 AGCCTTACCATTTCTGTGCTGGG + Intergenic
954590178 3:51776335-51776357 AGCCTTACCCCTACTGAGGAGGG + Intergenic
955391760 3:58527089-58527111 AGCCCTAACCCTTGAGGGTTAGG - Intronic
955423914 3:58767992-58768014 ACCCTTACCCCTTATGGCTAAGG + Intronic
956736050 3:72239100-72239122 AGCCTGGCCCCTTAGGGGTTTGG - Intergenic
958016642 3:87945648-87945670 ACCCCCAGCCCTTCTGGGTTGGG - Intergenic
960634403 3:119768774-119768796 AGCCCCGCCCCTTCTGAGTTGGG - Intergenic
961493467 3:127273963-127273985 AGCTCCACCCCTTCTGAGTTGGG + Intergenic
962105408 3:132383683-132383705 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
962240962 3:133750510-133750532 AGCTTTCCCTCTTCTGGGTTTGG + Intronic
966491321 3:180531474-180531496 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
968391521 4:196748-196770 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
968538847 4:1151935-1151957 AGCCCTGCCCCTTCCGAGTTGGG - Intergenic
969260322 4:6029259-6029281 AGCCTCACGTCTTCTGGGATGGG + Intronic
969362070 4:6671263-6671285 CGCCTTACCCCTTCTGCTGTGGG - Intergenic
969514026 4:7636628-7636650 ACCCTTATCCCGGCTGGGTTTGG - Intronic
969720679 4:8891795-8891817 ATCCTTGCCCCATGTGGGTTGGG + Intergenic
975739024 4:77410332-77410354 AGCCTTAGTCCTTGTGGATTAGG + Intronic
976128232 4:81855971-81855993 AGCTTTAGTCCTTCTGTGTTAGG + Intronic
976189382 4:82474222-82474244 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
977618338 4:99109231-99109253 AGCCCCAACCCTTCTGGGTTGGG - Intergenic
978964692 4:114726046-114726068 AGCCCTGTCCCTTCTGAGTTGGG - Intergenic
980443907 4:132882985-132883007 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
981525159 4:145700994-145701016 AGCCTAAACCCTTCTGATTTGGG - Intronic
983667341 4:170196377-170196399 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
986298569 5:6460149-6460171 CGCCTTACCCCTTCTGAGTGTGG + Intronic
989688103 5:44112058-44112080 ACCCTCAACACTTCTGGGTTGGG + Intergenic
995040068 5:107577586-107577608 AGGCTTACCCCTTCGTGTTTTGG + Intronic
995465262 5:112444648-112444670 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
995617802 5:113986248-113986270 AGCCTAAAGCCTTCTGGTTTGGG - Intergenic
996279776 5:121715117-121715139 GGTCTTACCCCTTCTTGGTTAGG - Intergenic
997960281 5:138315912-138315934 AGCCCTTCCCCTTCTGAGTTGGG + Intronic
1000250084 5:159485914-159485936 AGCCTTCCCCAGCCTGGGTTAGG - Intergenic
1000442843 5:161283524-161283546 AGCTTTTCCCATTCTGGCTTTGG - Intergenic
1001785118 5:174405233-174405255 ATCCTTGCCCCTTGTCGGTTCGG + Intergenic
1002693829 5:181070762-181070784 AGCCCTGTCCCTTCTGAGTTGGG - Intergenic
1004236450 6:13879031-13879053 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1004553215 6:16669982-16670004 TGGCTTACCCTTTCTTGGTTGGG - Intronic
1004696894 6:18042584-18042606 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1005324038 6:24682081-24682103 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1006275371 6:33001188-33001210 GGCCTTTCCTCTTCTGGCTTTGG + Intergenic
1006467297 6:34203193-34203215 AGCCCCGCCCCTTCTGAGTTGGG - Intergenic
1006753652 6:36396291-36396313 AGCCCAGCCCCTTCTGAGTTGGG + Intronic
1007285187 6:40742553-40742575 AGCCTCAGCCCTCCTGGGATTGG - Intergenic
1011190234 6:84720200-84720222 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1012847983 6:104413639-104413661 AGCCCTCCTCCTTCTGGGGTTGG + Intergenic
1013021859 6:106228846-106228868 ACCCTCAACCCTTCTGGGTTGGG + Intronic
1015270796 6:131336800-131336822 AGCCTTAGTCCTTCTTGATTTGG - Intergenic
1015663564 6:135603008-135603030 AGCCCTGCCCCTTCTGAGTTGGG + Intergenic
1018760661 6:166891854-166891876 ACCCCCAACCCTTCTGGGTTGGG + Intronic
1021561562 7:21972691-21972713 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1021946828 7:25735969-25735991 TGCATTACCTTTTCTGGGTTTGG - Intergenic
1023500835 7:40847758-40847780 ACCCTTGTCCCTTCGGGGTTGGG - Intronic
1023563715 7:41502355-41502377 AGCCTTTTCCCTTTTGGGTCAGG - Intergenic
1023788977 7:43737206-43737228 ACCCCTGCCCCTTCTGAGTTGGG + Intergenic
1024233231 7:47378658-47378680 ATCCATACCCCTTCTGGGTTTGG - Intronic
1024254648 7:47531766-47531788 AGCTCCACCCCTTCTGAGTTGGG + Intronic
1024417393 7:49122689-49122711 AGTCTTTCTCCTCCTGGGTTAGG - Intergenic
1024557878 7:50619144-50619166 AGTCTTACCTCTTCAGGTTTGGG - Intronic
1026412466 7:70139045-70139067 AGCCTCAGCCTTTCTGGGCTCGG + Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1027457745 7:78414738-78414760 AGCCCTATGCCTCCTGGGTTTGG + Intronic
1028233176 7:88330006-88330028 AGCCCTGCCCCTTCTGAATTGGG + Intergenic
1028588989 7:92477201-92477223 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1028818665 7:95179811-95179833 GGTCTTTCCCCTTCTTGGTTAGG - Intronic
1029439595 7:100579667-100579689 AGCCTTCCTCATGCTGGGTTAGG - Intronic
1029973933 7:104815175-104815197 AGCCCCACCCCTTCTAAGTTGGG - Intronic
1030336919 7:108338026-108338048 ACCCCCAACCCTTCTGGGTTGGG + Intronic
1031312597 7:120217193-120217215 AGCTCTACCCCTTCTTGGCTGGG + Intergenic
1035434695 7:158850440-158850462 AGCCACATCCCTTCTGAGTTGGG - Intergenic
1036106919 8:5851039-5851061 ACCCTTACCCATTCTGGCTGAGG - Intergenic
1041345277 8:56890537-56890559 ACCCTTACCCCTTTGGGGATGGG + Intergenic
1044008917 8:86967441-86967463 AGCCCCGCCCCTTCTGAGTTGGG - Intronic
1049823858 8:144654649-144654671 AGCCCCGCCCCTTCTGAGTTGGG + Intergenic
1050635570 9:7608707-7608729 ACCATTACCAGTTCTGGGTTAGG + Intergenic
1051001674 9:12290411-12290433 AGCCCCACCCCTTCTGAATTGGG + Intergenic
1051211881 9:14753710-14753732 ATCCTTGCCTCTTCTGGGTCTGG - Intronic
1053617238 9:39781233-39781255 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1053875420 9:42540598-42540620 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1053897222 9:42754037-42754059 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1054236280 9:62561126-62561148 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1054266928 9:62926204-62926226 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1054550421 9:66595658-66595680 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1055572508 9:77631904-77631926 ATCCTCGCCCCTTCTGAGTTGGG + Intronic
1056985988 9:91364178-91364200 AGACCCACCCCTTCTGAGTTGGG + Intergenic
1057548360 9:96034679-96034701 AGCCCTGCCCCTTCTGAGTTTGG + Intergenic
1058070721 9:100598451-100598473 CGCTTTACCCCTTCTTGGCTGGG - Intergenic
1059121662 9:111644919-111644941 AGGTTTACCCTTTCTAGGTTAGG + Intronic
1059565389 9:115379477-115379499 AGCCCTGCCCCTTCTGAATTGGG + Intronic
1059566223 9:115385538-115385560 AGCCTTGCTCCTTTTGAGTTGGG + Intronic
1185861651 X:3584940-3584962 AGGATTTCCCTTTCTGGGTTTGG - Intergenic
1189360028 X:40343354-40343376 AGCCCTGCCCCTTCTGAGTTGGG + Intergenic
1190445027 X:50515276-50515298 AGCCCCCCCCCTTCTGAGTTGGG - Intergenic
1190454899 X:50617877-50617899 AGCCCTTCCCCTTCTGGAGTTGG - Intronic
1191221080 X:57989360-57989382 AGCTTTGCCCCTTCTAAGTTGGG + Intergenic
1192940280 X:75904352-75904374 AACCCCAACCCTTCTGGGTTGGG - Intergenic
1193172287 X:78349797-78349819 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1193306342 X:79956631-79956653 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1194205223 X:91003298-91003320 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1194379206 X:93174487-93174509 AGCCCTGCCCCTTCTGAATTGGG + Intergenic
1194630609 X:96278564-96278586 GGCCTTTCACCTTCTTGGTTAGG - Intergenic
1195584699 X:106551952-106551974 ACCCCCAACCCTTCTGGGTTAGG + Intergenic
1195795140 X:108638860-108638882 AGTCTTCCACCTTCTTGGTTAGG - Intronic
1196883840 X:120224149-120224171 AGCCCCACCCCTTCCAGGTTGGG - Intergenic
1198699620 X:139382750-139382772 AGCCTCGCCCCTTCTGAGTTGGG - Intergenic
1199360169 X:146907796-146907818 AGCCCTGTCCCTTCTGAGTTGGG - Intergenic
1200551042 Y:4578435-4578457 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic