ID: 1102061006

View in Genome Browser
Species Human (GRCh38)
Location 12:109931015-109931037
Sequence CTGTGAGTAGCATGGGAAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102061006_1102061010 11 Left 1102061006 12:109931015-109931037 CCCTTTTCCCATGCTACTCACAG 0: 1
1: 0
2: 1
3: 21
4: 248
Right 1102061010 12:109931049-109931071 GCGACAAAAGCATCCACACACGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102061006 Original CRISPR CTGTGAGTAGCATGGGAAAA GGG (reversed) Exonic
901008608 1:6184385-6184407 CTGGAAGTGCCATGGGAAAAGGG + Intronic
901334045 1:8433465-8433487 CTGGGACTAGCCTGGGAAACAGG - Intronic
902715149 1:18267580-18267602 CTTTGAGAAGCTTGGAAAAAGGG + Intronic
905033473 1:34902775-34902797 CTGTGAGGTGCATGTTAAAAAGG + Intronic
905095678 1:35468476-35468498 CTGTTAGTAGCTGGGGGAAAGGG - Intronic
907183207 1:52588803-52588825 CTGCATGTAGAATGGGAAAAGGG - Intergenic
908016832 1:59849429-59849451 CTGTCAGTTGCATGGGATCAAGG + Intronic
911681769 1:100724889-100724911 AGGTGAGTAGAATGTGAAAAAGG + Exonic
911908189 1:103595753-103595775 CTTTGAGTAGAATGGGAGGAAGG + Intergenic
911910552 1:103628791-103628813 CTTTGAGTAGAATGGGAGGAAGG + Intergenic
911914729 1:103683713-103683735 CTTTGAGTAGAATGGGAGGAAGG - Intronic
911917968 1:103722916-103722938 CTTTGAGTAGAATGGGAGGAAGG + Intronic
911921140 1:103762411-103762433 CTTTGAGTAGAATGGGAGGAAGG + Intergenic
911955243 1:104225308-104225330 CTGTAAGTAGCTTGAGCAAAAGG + Intergenic
913111004 1:115656955-115656977 GTGAGAGTAGCTGGGGAAAATGG + Intronic
914958183 1:152183528-152183550 CTGTGATTAGTATGGAGAAATGG - Intergenic
915976939 1:160397658-160397680 CTCTGAGCAGCATTGTAAAAAGG + Intergenic
916740463 1:167642866-167642888 CTGTGAGTAACATTGGAATTAGG + Intronic
916877666 1:168987257-168987279 CTGTGAGGAGCTTGGTATAATGG + Intergenic
916987948 1:170211862-170211884 CTGAGAATAGCATGGGTTAATGG + Intergenic
917023654 1:170616924-170616946 CTTTGAGAAGCATGGCAAATAGG - Intergenic
919011035 1:191963431-191963453 CTATGAGTAGCATGTGGTAAGGG + Intergenic
919400759 1:197113401-197113423 CTGAAGGTAGCATGGCAAAAGGG + Intronic
920746981 1:208638176-208638198 CTTTGAATAGCAAGGGAATAAGG - Intergenic
920904582 1:210150131-210150153 CTCTGAGTGTCATGGGAAAGAGG - Intronic
920959618 1:210652694-210652716 CTGTAAGAAGAATGGGGAAAGGG + Intronic
922047430 1:221960132-221960154 CTGTAACTAACATGGCAAAAAGG + Intergenic
923466641 1:234253550-234253572 CTGTTAGTAGGATGGGAAGAGGG + Intronic
923611637 1:235500984-235501006 CTGTGAGCACCTTGGGAGAAGGG + Intronic
923739988 1:236646276-236646298 ATGTGAGTGGGATGTGAAAAGGG - Intergenic
1065353833 10:24819971-24819993 CTCTGAGTAGCTTGGGACACAGG - Intergenic
1068326872 10:55501778-55501800 CTGTGAATTGCATGGTGAAATGG + Intronic
1069279326 10:66634673-66634695 GTGTGAGTAAGATAGGAAAAAGG - Intronic
1071095106 10:81964067-81964089 AAGGGATTAGCATGGGAAAATGG - Intronic
1072003768 10:91221913-91221935 CTGAGAATAGCATTGGAGAAGGG + Intronic
1075393664 10:122111906-122111928 CTGTGATAAGCATGTGAACAAGG + Intronic
1075455994 10:122585421-122585443 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075458121 10:122598124-122598146 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075816914 10:125271591-125271613 CTCTGAGGACCCTGGGAAAAGGG + Intergenic
1076342064 10:129756065-129756087 CCGTGACCAGCATGAGAAAAGGG + Intronic
1076781634 10:132727855-132727877 CAGTGAGTTGGATGGGAACACGG + Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080970145 11:37264412-37264434 GTGAGAGTAGGATGGGAAGATGG + Intergenic
1081278878 11:41184038-41184060 CTGTGTGCAGCCTGGGAACATGG - Intronic
1081492214 11:43577688-43577710 CTATGACTAGCATGCGAAAAGGG - Intronic
1083710620 11:64546236-64546258 CTTTGAGTAGCAAGGGTAGAGGG + Intergenic
1084171840 11:67404660-67404682 CTGTCTGTAGCTTGGGGAAAGGG - Intronic
1084639981 11:70419813-70419835 CTTTGAGTATCAAGGCAAAACGG + Exonic
1086680938 11:89671226-89671248 CTGTGATAAGCATTGGAAATGGG + Intergenic
1086720576 11:90116303-90116325 TCGTGAGTAGCTGGGGAAAAAGG + Intergenic
1086727944 11:90212247-90212269 ATGAGAACAGCATGGGAAAAAGG - Intronic
1086926368 11:92644548-92644570 CAGTGAGAAGTATGTGAAAAGGG - Intronic
1086948931 11:92871315-92871337 CTTTGAGTAGCAAGGGTTAAGGG - Intronic
1088114293 11:106298260-106298282 CTGTAAGTTGAATGGGAAGATGG + Intergenic
1088415731 11:109586905-109586927 CTGGGAGAAGCAAAGGAAAAAGG - Intergenic
1088597961 11:111453920-111453942 CTGTGAGTAGCAAGGATAGAAGG - Intronic
1090702538 11:129309544-129309566 CTGTGTGTCACATGGCAAAAGGG + Intergenic
1092757522 12:11777667-11777689 ATGTGATCAGCATGGGAAATGGG - Intronic
1092854388 12:12658999-12659021 ATGTGAGGAGGATGGGAAAAGGG + Intergenic
1093808359 12:23464149-23464171 CTGAGAGTCACATGGGAAAGGGG + Intergenic
1094342815 12:29431588-29431610 TAGTTAGTAGCATGGAAAAATGG - Intronic
1094469887 12:30794168-30794190 CTGTGTGTGGCATGGGAACTGGG - Intergenic
1095314547 12:40744128-40744150 CTGTCAGTAGCAGGGGTAGAGGG + Intronic
1102061006 12:109931015-109931037 CTGTGAGTAGCATGGGAAAAGGG - Exonic
1103692859 12:122789908-122789930 CTGTTAATAGCATGGCACAAGGG + Intronic
1104604068 12:130175197-130175219 GTGTCATTAACATGGGAAAATGG + Intergenic
1105465654 13:20637325-20637347 CTGTGAGTGTTATGGGAAAAGGG + Intronic
1105468428 13:20669028-20669050 CTGGGAGTAGGAGAGGAAAAAGG + Intronic
1106594979 13:31128036-31128058 CTCTGAGGAGCATGGGAAGGGGG + Intergenic
1106596278 13:31142135-31142157 CTGTAGGTAGGATGGTAAAACGG + Intronic
1107149098 13:37091277-37091299 CTGTGCTTACCATGGGAAAAAGG + Intergenic
1107221058 13:37980915-37980937 CACTGTGTAGAATGGGAAAATGG - Intergenic
1107424124 13:40275942-40275964 CTGAAAGTAGCTTGGGAACATGG + Intergenic
1108449709 13:50548953-50548975 CTGTGAGGAGCAGAGAAAAACGG + Intronic
1108812898 13:54251250-54251272 CTGTCAGTAGCCTTGCAAAAAGG - Intergenic
1109335872 13:60992897-60992919 CAGTGAGTAGCAATGGAACACGG + Intergenic
1109490021 13:63085487-63085509 GTGTTGGTAGCAAGGGAAAATGG + Intergenic
1110358440 13:74596122-74596144 CAGTCTGCAGCATGGGAAAATGG + Intergenic
1110882169 13:80585635-80585657 CTCTCATTAGCATGGGAAATTGG + Intergenic
1112142888 13:96665358-96665380 CTGTAAGTACCATGAGAACAAGG - Intronic
1112432783 13:99366794-99366816 CTGTGAGCAGCCTGGGAGACGGG - Intronic
1112827788 13:103412155-103412177 CTGTGAGGAGAATGGCAAAGGGG + Intergenic
1113179684 13:107611238-107611260 CTGTCGGTAGGATGGTAAAATGG + Intronic
1113429366 13:110236494-110236516 CTCTAAGTAGCCTGTGAAAAGGG + Intronic
1114454312 14:22845392-22845414 CTGAGAGAAGGATGGGAATAGGG + Intronic
1115066454 14:29267365-29267387 ATGTGAGAAGCATGTGAAAAAGG + Intergenic
1115476616 14:33820741-33820763 CTGTGGGAAGCATAGAAAAAAGG - Intergenic
1118857441 14:69634937-69634959 CTGAGAATAGAATGGGAAGAGGG - Intronic
1119081303 14:71696884-71696906 ATGTGAGTAGCAAAGGAAGAAGG + Intronic
1119869728 14:78006515-78006537 CTGTGAGTACCTTGAGGAAAAGG + Intergenic
1120713827 14:87819282-87819304 CAGTGAGTTGCATGGGAAGAAGG + Intergenic
1120923321 14:89774334-89774356 CTGTGAGTAACATGGAATAAGGG - Intergenic
1121562755 14:94887044-94887066 CTGTGAAGAGCATGAGAGAAAGG + Intergenic
1123980117 15:25594405-25594427 CTATGTGTTGAATGGGAAAAGGG + Intergenic
1125247081 15:37652989-37653011 CTGTGAGCTGCATGGGAGCAGGG + Intergenic
1126347316 15:47709674-47709696 CGGTGAGTTCCAAGGGAAAAGGG - Intronic
1132291016 15:100703984-100704006 CTGGGAGGGGCGTGGGAAAAAGG + Intergenic
1132306300 15:100816010-100816032 ATGTGAGCAGCAGGGGAAAGGGG + Intergenic
1134050304 16:11132632-11132654 CTATGAAGACCATGGGAAAACGG - Intronic
1135883258 16:26279750-26279772 CTGTGTGTTGCATGGGAGCATGG - Intergenic
1139680323 16:68556615-68556637 CTGTAAGTTCCATGGGAACAGGG - Intronic
1140932171 16:79637834-79637856 CTGTGTGCAGTTTGGGAAAAGGG + Intergenic
1141543130 16:84742343-84742365 CTGTGAATAGCTTTAGAAAAAGG - Intronic
1141938934 16:87261478-87261500 CTGGGAGCAGCATGGAGAAAGGG - Intronic
1145305438 17:21671742-21671764 GTGTGAATAGCATGGGACAGAGG - Intergenic
1145772121 17:27500796-27500818 CTGCGAGTAGCGGGGGCAAAGGG + Intronic
1146194511 17:30800110-30800132 CTGGGAGTGGTGTGGGAAAAAGG - Intronic
1148973464 17:51505527-51505549 CTGGAAGTGGGATGGGAAAAGGG - Intergenic
1149402518 17:56312769-56312791 CTGTGAGTTGCATGGGAGCAGGG - Intronic
1149738995 17:59025491-59025513 CTGTGATTAGCAGGAAAAAAAGG + Intronic
1150272657 17:63876640-63876662 CTGGGAGGAGCAGGGGAAAGTGG - Intronic
1152610244 17:81311796-81311818 CTGTGCGGGGCGTGGGAAAAAGG - Exonic
1152643985 17:81460507-81460529 CTGTGGATAGCATGGGCCAAGGG - Intronic
1153227338 18:2908854-2908876 TTGTGAGGAGCAGAGGAAAAAGG + Intronic
1155761586 18:29575122-29575144 CTGGTAGTAGAATGGGGAAAAGG + Intergenic
1157235659 18:45962958-45962980 CTCTGACTAGTATGAGAAAACGG - Intronic
1157407509 18:47435143-47435165 CTGTCAGTAGCATTGTAAATTGG - Intergenic
1157912939 18:51636399-51636421 CTTTGAGTAGAATGGGAGGAAGG - Intergenic
1158143943 18:54289385-54289407 CTTTGGGCAGTATGGGAAAATGG - Intronic
1158714036 18:59862289-59862311 CTGTGAGTGGCAGGGGCACATGG - Intergenic
1159849091 18:73504793-73504815 CTGTGATAAGAATGAGAAAAAGG + Intergenic
1159913701 18:74170102-74170124 CTGTGTGTAGCTTGGAAGAAAGG + Intergenic
1164451248 19:28367080-28367102 CTGTGAGCAGCATGGGTGGATGG + Intergenic
1164714489 19:30381479-30381501 CTGGGACTGGCATGGGAAGATGG + Intronic
1164741246 19:30576912-30576934 CTGTGAGGAGCATGTGAACCAGG - Intronic
1164829520 19:31309830-31309852 CCGTGAGCAGGATGGGAACATGG - Intronic
1165475349 19:36027046-36027068 CTGTGAGTACCAGGGGAGCAGGG + Intronic
1166313668 19:41976705-41976727 CTGGGAGAAGCAGGGGAGAAGGG + Intronic
1166315579 19:41987808-41987830 TTGTGAGTTAGATGGGAAAAAGG + Intronic
925748402 2:7064690-7064712 CTTTCAGGAGGATGGGAAAAGGG + Intronic
929536138 2:42785360-42785382 CTGTTAATAAAATGGGAAAATGG + Intronic
929761531 2:44811224-44811246 CACAGAGTAGCATGGGACAAAGG - Intergenic
931079203 2:58750816-58750838 CAGGGAGCAGCATGGGAAAATGG - Intergenic
933059265 2:77716256-77716278 TTGTGAGCATCATGGGAAGAAGG + Intergenic
933187522 2:79294567-79294589 TTGTTAGTACCATGTGAAAAAGG - Intronic
933434010 2:82221504-82221526 CTGTTAGTGGCAAGGTAAAATGG - Intergenic
933767948 2:85723555-85723577 CTGTGAGTAGCCAGAGAAACTGG - Intergenic
934017553 2:87904853-87904875 CTGACAGTAGCCTGGGGAAATGG + Intergenic
934155391 2:89194992-89195014 CTGCAAGTTTCATGGGAAAATGG - Intergenic
934211932 2:89987762-89987784 CTGCAAGTTTCATGGGAAAATGG + Intergenic
934931692 2:98430998-98431020 ATGAGAGTAGCAAGAGAAAATGG - Intergenic
934993648 2:98938024-98938046 TTGTGAATAGGTTGGGAAAATGG + Intergenic
935359012 2:102231961-102231983 CTGAGGGTAACATGGGTAAATGG + Intronic
936250544 2:110865062-110865084 CTTTCAGAAGCATGGAAAAACGG - Intronic
937779241 2:125818678-125818700 CTGCAAGTAGCATGGGACAGGGG - Intergenic
938996358 2:136683107-136683129 CTGTGGGCTGCATGGGAACAGGG + Intergenic
939385085 2:141485749-141485771 GGGTGAGAAGCATGGGATAATGG + Intronic
942500652 2:176587159-176587181 CTCTGAGAAGCATGGAAAAGTGG - Intergenic
946345487 2:219106949-219106971 CTTGGAGTAGAATGGGAAATAGG - Intronic
946603535 2:221377040-221377062 CTGTCACCAACATGGGAAAATGG - Intergenic
1170346524 20:15392968-15392990 GTTTGAGAAGCATGGGATAAGGG + Intronic
1170448056 20:16450646-16450668 CTGTGAGTTTCATGAGAAAAGGG + Intronic
1173365775 20:42383346-42383368 CTGTGAGTACCATGGGCTCATGG + Intronic
1173593365 20:44242309-44242331 CTGTGACTGGGATGGGAAAGGGG - Intergenic
1177562683 21:22776859-22776881 CTAACAGAAGCATGGGAAAAAGG + Intergenic
1177589156 21:23139441-23139463 CTTTGAATAGAATGGGAAACAGG + Intergenic
1178479266 21:32965280-32965302 TCGTGACTAGGATGGGAAAACGG - Intergenic
1182219020 22:28742958-28742980 CTGGGAGTAGAATGTGAAAGGGG + Intronic
949770382 3:7571048-7571070 CTGTGTGAAGCATAGGAAATTGG - Intronic
951465721 3:22998598-22998620 CTGGGAGTAGCCTGGGAAGAGGG - Intergenic
952139339 3:30460473-30460495 GTGGGAGCAGCAAGGGAAAATGG + Intergenic
955188932 3:56742071-56742093 CAGTGAGTATCATGGCACAAGGG - Intronic
956279917 3:67545384-67545406 ATGTGTGTATCATGGGAAAGTGG - Intronic
957150414 3:76479030-76479052 GTGTTTGTAGCATGGGAAAATGG + Intronic
958071420 3:88618455-88618477 CTGAGAGAAGCATGTGACAAAGG - Intergenic
959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG + Intronic
959688618 3:109174879-109174901 TTGTAAGTAGAATGGGAAAAGGG - Intergenic
960064332 3:113354480-113354502 CTGTGGGTTGCATGGGAGCAAGG + Intronic
960157738 3:114314166-114314188 CTGTGATTTGCATGTGGAAAAGG + Intergenic
966511854 3:180773060-180773082 CAGTGATAAGCATGGGAACAGGG + Intronic
967148293 3:186625332-186625354 CTGGAAGTAACATTGGAAAATGG + Intergenic
967867187 3:194199909-194199931 CTGTGATCAACATGGGAACAGGG - Intergenic
968769122 4:2492583-2492605 CTGTGAATGGTATGGGAAGATGG + Intronic
969861195 4:10036671-10036693 CTGTGTGTAGTATTGGAAAAAGG - Intronic
970998197 4:22291996-22292018 CTGTGAGTTGCAGAGAAAAAGGG - Intergenic
971144027 4:23957082-23957104 CTGTGATTAGCATGTGAACTTGG - Intergenic
975222232 4:71826016-71826038 CTGTTAGTAACATGGAAAATAGG - Intergenic
975591396 4:76003700-76003722 CTGTGAGAAGAAGGGGAAAAAGG + Intronic
975905131 4:79200771-79200793 CTGTGAGTTGCATGAGTGAAAGG - Intergenic
976876780 4:89862811-89862833 CTGAGAGTAGCATCTCAAAAGGG - Intergenic
977563529 4:98558280-98558302 GTGTTAGTAACAGGGGAAAATGG + Intronic
977725496 4:100291993-100292015 CTGTCAGTATCACAGGAAAATGG - Intergenic
978501277 4:109412350-109412372 AGGTGAGAAGCATGGAAAAAAGG + Intergenic
983268882 4:165538070-165538092 CTGTGCGTAGCAAGAGAAGAGGG - Intergenic
983774933 4:171594886-171594908 CTGGCAGCAGCAGGGGAAAAAGG + Intergenic
983900973 4:173133861-173133883 TTGTTAGCAGCATGGGGAAAGGG - Intergenic
983949510 4:173622721-173622743 TTGTGAAGACCATGGGAAAAGGG + Intergenic
984121361 4:175749062-175749084 CTGGGAGTTGGATAGGAAAATGG + Intronic
985552727 5:541623-541645 CTGTGAGGAGCAGGGGAAGGTGG - Intergenic
987005325 5:13704253-13704275 CTGGGGGTAGCAGGGGGAAAGGG + Intronic
987563552 5:19555459-19555481 CTGTGGGCTGCATGGGAACAAGG + Intronic
989742046 5:44784888-44784910 CTTTGAGTAGAATAGGAAACAGG - Intergenic
990851936 5:60214961-60214983 CTGAGAGTAGCATGGGAGAGAGG - Intronic
991925883 5:71704552-71704574 CTGTGGGGAGCTTGGGCAAAAGG + Intergenic
995830433 5:116348748-116348770 CTGTGAGGAACCTGGGATAAGGG - Intronic
995963089 5:117868943-117868965 ATGTGAGCAGCATGGGACATGGG - Intergenic
996331746 5:122337124-122337146 ATGGGATTAACATGGGAAAAGGG + Intronic
996412605 5:123174912-123174934 AAGTCAGTAGCCTGGGAAAAAGG - Intronic
996471395 5:123865121-123865143 CTGTGAGTGGCAAGGGACTAAGG - Intergenic
997198479 5:131995200-131995222 CTGTGAGAAGCACTGGAGAATGG + Intronic
997315376 5:132930041-132930063 CAGTTACAAGCATGGGAAAACGG + Intronic
997809990 5:136957643-136957665 CTATGAGTAGCAAGGCAAGAGGG + Intergenic
1000719859 5:164693236-164693258 CAGTCATTAGCAGGGGAAAATGG - Intergenic
1001616810 5:173049348-173049370 CTGTGAACACCATGGGAGAAGGG - Intergenic
1001649974 5:173309421-173309443 CTGGGAGCAGCCTGGGAAGAGGG - Intergenic
1001762424 5:174219294-174219316 CTGTGAGTAGCACCTGACAATGG - Intronic
1002948423 6:1784703-1784725 CACTGTGAAGCATGGGAAAATGG - Intronic
1004394966 6:15239632-15239654 CTGTGAGTAGGCAGGGAAAGGGG - Intergenic
1004798855 6:19122127-19122149 TTGGAAGTAGCATGAGAAAAAGG + Intergenic
1006145513 6:31956920-31956942 CTGTGAGTGACAGGGGAAATGGG - Exonic
1006878309 6:37317309-37317331 CTGGGAGTAGGAAGGGAGAAGGG + Intronic
1008930608 6:56935027-56935049 GTGTGTGTAGCTTAGGAAAACGG - Intronic
1010605099 6:77879608-77879630 CTTGGAGTAGCATGGAGAAAGGG - Intronic
1011670378 6:89677754-89677776 CTTTGAGTAGCAGGGGAGAGGGG - Intronic
1012657410 6:101841914-101841936 CTGCGAGTTGAATGGAAAAATGG + Intronic
1017752058 6:157497075-157497097 CTCGGAGTAGCATTGGATAAGGG + Intronic
1019366418 7:635638-635660 CTGTGAACAGCTTAGGAAAAAGG + Intronic
1019492089 7:1319025-1319047 GTGTGCTTAGCATGTGAAAATGG + Intergenic
1019497761 7:1348320-1348342 CTGTGAGCTCCATGGGAACAGGG + Intergenic
1021295480 7:18900860-18900882 CTCTTATTAGCATGAGAAAAGGG - Intronic
1023168175 7:37363614-37363636 CTGGGCGTAGAAAGGGAAAATGG - Intronic
1024189476 7:46991236-46991258 CTGTGAGTAGGATGCGAAAGCGG + Intergenic
1025283386 7:57644139-57644161 GTGTGAATAGCATGGGACAGAGG - Intergenic
1029014166 7:97297021-97297043 CTATGAGGAGCATGGGGATAGGG - Intergenic
1029665236 7:101990865-101990887 CTGTGAGTTGCAGGTGCAAAGGG - Intronic
1030988658 7:116273257-116273279 AGGTGAGTTGCATGAGAAAAGGG + Intergenic
1035383047 7:158452559-158452581 CTGTGAGTGGGAGGGGAAATCGG - Intronic
1036674808 8:10821697-10821719 CTGTGCTTTGCATTGGAAAATGG - Intronic
1038333119 8:26625066-26625088 CTGTGAGTGACATGGCAAGAGGG + Intronic
1038400746 8:27282802-27282824 CTTTCAGTAGCATGAGAAAATGG - Intergenic
1038739323 8:30203126-30203148 CTGTGAGGACCATGGCAAATGGG - Intergenic
1040547248 8:48408249-48408271 GTGAGAGAAGCACGGGAAAAAGG - Intergenic
1040744166 8:50619787-50619809 GTCTTAGTAGCATGGGTAAAAGG - Intronic
1040903146 8:52438186-52438208 CAATGAGTAGCTTTGGAAAATGG - Intronic
1044299431 8:90566713-90566735 GTGTGAGCAACATGGGAAGAAGG - Intergenic
1044299602 8:90568192-90568214 GTGTGAGCAACATGGGAAGAAGG - Intergenic
1044550841 8:93510794-93510816 CTGTGAGCATCCTGGGAGAAGGG + Intergenic
1044593953 8:93940693-93940715 CTGTAGGTAGTATTGGAAAAGGG + Intergenic
1044619402 8:94173997-94174019 CTGTGAGAAGTAGGGGAGAAGGG + Intronic
1045475867 8:102551685-102551707 CTGTGAGTACCTTTGGGAAATGG - Exonic
1045850041 8:106685245-106685267 TTGTAAGTCCCATGGGAAAATGG - Intronic
1046727995 8:117695171-117695193 CTGGGAGCAGCATGGCTAAACGG - Intergenic
1046941115 8:119932593-119932615 CTGTGCCTAGCATGTGGAAAGGG - Intronic
1047103003 8:121700971-121700993 GTGTTAGTAACATGGGGAAATGG - Intergenic
1047632722 8:126725817-126725839 TGGTGGGTAACATGGGAAAATGG + Intergenic
1047692385 8:127369250-127369272 CTGTGAGTAGCTTTGGCCAATGG - Intergenic
1047991295 8:130289236-130289258 ATGTAAATAACATGGGAAAATGG + Intronic
1049391196 8:142372566-142372588 ATGTGAGCAGCAGGGGCAAAGGG + Intronic
1050400440 9:5247949-5247971 CTGTGGGTTGCATGGGAGCAAGG + Intergenic
1051128960 9:13837288-13837310 CTGTGAGTAGGAATGTAAAATGG - Intergenic
1051695866 9:19767464-19767486 TTGTGAAGACCATGGGAAAAGGG + Intronic
1052049830 9:23831885-23831907 CTGTGAGGAGAAGTGGAAAAGGG + Intergenic
1052800901 9:32967247-32967269 CTGTGTGTAGTTTGGAAAAAAGG + Intergenic
1060413860 9:123417221-123417243 CTGTGGGTACCATGGGGAGATGG - Intronic
1060635382 9:125195880-125195902 CTGTGGGTAGCATAGAAAACTGG + Intergenic
1186051194 X:5597452-5597474 CTATGGGGAGCATGTGAAAACGG + Intergenic
1187041695 X:15603182-15603204 CTTTGAGAAGCAAGGGAAAAGGG + Intergenic
1190775360 X:53548175-53548197 CTGTGAGGAGCATGGGCTACAGG + Exonic
1191940424 X:66474397-66474419 CTGTGAGAAGCATGGGGAAATGG - Intergenic
1192184220 X:68935643-68935665 GTGTGTGTAGCATGTGAAATGGG + Intergenic
1192234046 X:69285043-69285065 CTGTGAGTTGCACTGGAAGAGGG - Intergenic
1192354079 X:70383418-70383440 TTTTCAGTAGGATGGGAAAATGG + Intronic
1192405898 X:70885983-70886005 CTGTTGGTAGGATGGTAAAATGG + Intronic
1193129375 X:77903536-77903558 CAATGGGTAGCATAGGAAAAAGG - Intronic
1194380904 X:93190722-93190744 CTGTGGGCTGCATGGGAAAGGGG + Intergenic
1194590122 X:95789993-95790015 CTATGAATGGCATGGGATAAGGG + Intergenic
1194824280 X:98541932-98541954 CTGGGAGTAGCTTTGGGAAAAGG - Intergenic
1195707802 X:107750648-107750670 GGGTGGGGAGCATGGGAAAATGG - Intronic
1199126930 X:144133692-144133714 CTGACAGTAGCCTGGGGAAATGG - Intergenic
1200107126 X:153720695-153720717 CGGTCAGCAGCATGGGCAAAGGG + Intronic
1201406350 Y:13653876-13653898 CTGGGAGAAGCATGGCAAAATGG - Intergenic