ID: 1102061351

View in Genome Browser
Species Human (GRCh38)
Location 12:109934217-109934239
Sequence CCACACCACCAGAGGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102061345_1102061351 16 Left 1102061345 12:109934178-109934200 CCTTCATGAAGGGGCTAGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 191
Right 1102061351 12:109934217-109934239 CCACACCACCAGAGGGCACATGG 0: 1
1: 1
2: 0
3: 23
4: 204
1102061344_1102061351 17 Left 1102061344 12:109934177-109934199 CCCTTCATGAAGGGGCTAGGGCT 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1102061351 12:109934217-109934239 CCACACCACCAGAGGGCACATGG 0: 1
1: 1
2: 0
3: 23
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102061351 Original CRISPR CCACACCACCAGAGGGCACA TGG Intronic
900517628 1:3090549-3090571 CCACACCTGGAGAGAGCACAGGG - Intronic
900742558 1:4339520-4339542 CCACAGGTCCAGAGGGCCCAGGG + Intergenic
901020207 1:6251522-6251544 GCTCACCACCTGTGGGCACAGGG + Exonic
901756889 1:11446842-11446864 CCTCCCCACCAGAGGCCACCTGG - Intergenic
902562293 1:17285071-17285093 CCACACCAACCTAGAGCACAGGG - Intergenic
902668357 1:17954723-17954745 CCATATCACCTGGGGGCACAGGG - Intergenic
902913978 1:19624633-19624655 CCACACCTCCAAAGGGAAGAGGG + Intronic
903161288 1:21490990-21491012 CTCCACCAGCAGAGGGCAGAGGG - Intergenic
903745565 1:25584492-25584514 CCACACCAGCAGAGGTCCCCAGG + Intergenic
904253857 1:29242228-29242250 GGACACCACCATAGGTCACAAGG - Intronic
904995997 1:34631844-34631866 CAACCCCAGCTGAGGGCACATGG + Intergenic
905012772 1:34758514-34758536 CCGCACAACCAGAGGGCACCTGG - Intronic
908509760 1:64842445-64842467 CCACCCCACCCCAGGGCCCACGG - Intronic
908927226 1:69270260-69270282 CCACCCCTCCAGAAGGCACAGGG - Intergenic
910127221 1:83856186-83856208 CCACACCACAAGGGTTCACAAGG + Intergenic
910203639 1:84725509-84725531 CCCCATCCTCAGAGGGCACAAGG + Intergenic
915065501 1:153221109-153221131 CCACAGCCACAGAGGCCACAGGG + Intergenic
916237170 1:162602173-162602195 CCACACCACCAGCTTGCAGAGGG - Intergenic
918044454 1:180933350-180933372 CCAACCCAGAAGAGGGCACAGGG - Intronic
918526775 1:185473471-185473493 CCAGACCACCACACGGCACCCGG + Intergenic
919857890 1:201718227-201718249 ACACACAACCAGAGGCCTCATGG + Intronic
920101848 1:203521858-203521880 CCTCAGCACCAGCAGGCACAGGG + Intergenic
920754022 1:208710215-208710237 CCAGCCAAACAGAGGGCACAAGG - Intergenic
922880476 1:228976645-228976667 CCACACCACAAGACACCACAGGG - Intergenic
924516249 1:244768567-244768589 CCACAGTAGCACAGGGCACAAGG - Intergenic
1063355407 10:5394242-5394264 CCACTCCACCACAGAGCACACGG - Exonic
1063446045 10:6118055-6118077 ACACACCAGCAGAGGTGACAAGG - Intergenic
1064996833 10:21303392-21303414 CCACACCCCCAGACAGTACAGGG + Intergenic
1065972308 10:30815298-30815320 CCACACAAGCAGAGGGCTCCTGG - Intergenic
1067552416 10:47245149-47245171 CCACCCCACCAGAGGGCACAGGG - Intergenic
1070779096 10:79127222-79127244 CCACACCTGGAGAGGGCACCAGG - Intronic
1070782269 10:79144520-79144542 CCACCCCACAAGCAGGCACAGGG + Intronic
1074917666 10:117972770-117972792 CCACAGAACCAGAGAGCAGAAGG - Intergenic
1076373286 10:129968139-129968161 CCGCACCATCGGAGGGCCCATGG + Intergenic
1076572609 10:131442483-131442505 CCACAACACCAGCAGGGACAGGG - Intergenic
1077107598 11:848780-848802 CAGCCCCACCACAGGGCACAAGG - Intronic
1077232619 11:1464833-1464855 CCACACCACTGGAGGGCAGGAGG - Intergenic
1077458004 11:2692523-2692545 CCCTACCACCAGAGGGCCCTTGG + Intronic
1077760687 11:5093206-5093228 CCACACCAACTGTGAGCACATGG + Intergenic
1078485905 11:11723024-11723046 GGTCGCCACCAGAGGGCACAGGG + Intergenic
1081461831 11:43279308-43279330 CCACACAACCAGATGGCGGAGGG - Intergenic
1082834194 11:57639867-57639889 TCACACCAACAGGGGGCAGAGGG - Intergenic
1087034110 11:93739253-93739275 CCACAGCATCAGATGTCACATGG + Exonic
1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG + Intergenic
1089270293 11:117297176-117297198 GCAGACCTGCAGAGGGCACAGGG - Intronic
1089665107 11:120013410-120013432 CCCCACCACCAGACGGTGCATGG - Intergenic
1090843068 11:130509301-130509323 CCACACCAGCAAAGGCCAGAGGG - Intergenic
1092126900 12:6080905-6080927 CCACAGGAAAAGAGGGCACACGG - Intronic
1094371672 12:29745273-29745295 CCAGAACACCAAAGGGCACAGGG + Intronic
1097235818 12:57538762-57538784 CCTCACCACCAGAGGGAAAAGGG - Intronic
1101515865 12:105434631-105434653 CCACAGCCCTAGAGGGCTCAAGG - Intergenic
1101995552 12:109522781-109522803 CCAAATCACTGGAGGGCACAAGG - Intronic
1102061351 12:109934217-109934239 CCACACCACCAGAGGGCACATGG + Intronic
1102156398 12:110732749-110732771 CCACACCACCAGAGCACTTAGGG + Intronic
1102569949 12:113821335-113821357 CCACACCACCAGAGCCAGCAGGG - Intronic
1102953121 12:117043138-117043160 CCACACACCCACAGGGCAGATGG - Intronic
1104521607 12:129480862-129480884 ACAGAGGACCAGAGGGCACATGG + Intronic
1108166422 13:47698045-47698067 CCACACCACAATAGAGAACATGG + Intergenic
1108485492 13:50919466-50919488 CCACACAGCCAGGGGGCAGAAGG - Intronic
1112353983 13:98659409-98659431 CCACATCAAATGAGGGCACACGG + Intergenic
1112575290 13:100629872-100629894 ACACACCACGTGAGGACACAGGG + Intronic
1112595102 13:100800580-100800602 GCAAACCTTCAGAGGGCACAGGG - Intergenic
1113349378 13:109513571-109513593 CCACTCCACCTGTGGGCTCAGGG + Intergenic
1113598944 13:111554726-111554748 GCAAACCTCCAGAGGGCAGAGGG + Intergenic
1118895587 14:69942993-69943015 CCCCACCACCAGCAGCCACAGGG - Intronic
1119435149 14:74593797-74593819 CCACTCCCCCAGAGGCCAGATGG + Intronic
1121456779 14:94043425-94043447 CCATACCCCCTGAGGGCACCAGG + Intronic
1121492976 14:94372949-94372971 CCAGATCAGCAGTGGGCACAGGG + Intergenic
1122531484 14:102430644-102430666 ACACGACACCACAGGGCACAAGG - Intronic
1122809660 14:104281696-104281718 GCACACCAGCAGAGGGGAGAGGG - Intergenic
1124045360 15:26144562-26144584 TAACACCATCACAGGGCACAGGG - Intergenic
1124348315 15:28937111-28937133 CGAGACCACCACCGGGCACATGG - Intronic
1125920551 15:43523015-43523037 CCCAACCATCAGTGGGCACAGGG + Exonic
1128707257 15:69845702-69845724 CCACACATACACAGGGCACAGGG - Intergenic
1129885292 15:79032844-79032866 CCATAGCACCATAGGGCACGGGG - Intronic
1131035672 15:89220541-89220563 CCACACCCCCAGCAAGCACAGGG + Intronic
1131232179 15:90667250-90667272 TCACACAACCACAGGGCAGAGGG - Intergenic
1132561155 16:594725-594747 CAACACCAACAGTAGGCACAGGG - Intronic
1132748182 16:1445600-1445622 CCTCACCACCTGAGGGCCCCTGG - Exonic
1133160929 16:3911199-3911221 CCACACCTCCAGCGTGCAGATGG - Intergenic
1134275077 16:12768766-12768788 TCACACCAACAGAGATCACATGG + Intronic
1138090358 16:54168750-54168772 CCACACCACCAAGGGGCATCTGG + Intergenic
1138712739 16:58987188-58987210 GCACACCACCCAAGGGCCCAAGG + Intergenic
1138735372 16:59244792-59244814 TCACACCCCCAGAGGACACTTGG + Intergenic
1141805831 16:86340885-86340907 CCTCACCACCAGGGGGCGCAGGG + Intergenic
1141995916 16:87636223-87636245 CCACCCCACCCCAGGGCACGTGG - Intronic
1145906149 17:28517331-28517353 ACACACCTCCACAGGGTACAGGG + Intronic
1146282169 17:31551674-31551696 CCACCCCAGCGGAGGGCAGAGGG + Intergenic
1146734092 17:35222468-35222490 CCCCACCTGCAGAGGCCACATGG + Intergenic
1146950342 17:36900994-36901016 ACACACCACCAGAAGGAATAAGG - Intergenic
1147667297 17:42156706-42156728 TCACACCACCAGGGGCCCCAGGG - Intergenic
1147948059 17:44091657-44091679 CCTCAACACCAGAGGGAAGATGG + Intronic
1148674565 17:49437907-49437929 TAACACCACCACAGGCCACAGGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150294711 17:64001600-64001622 AAACCCCACCAGAGGGCACAGGG - Intronic
1150454900 17:65299501-65299523 CCACAACACCTGAGGTAACAGGG - Intergenic
1153331324 18:3878538-3878560 CCCCACCTCCTCAGGGCACAGGG + Intronic
1154310671 18:13264087-13264109 CCAATCCACCAGAGGGGACAGGG - Intronic
1154386628 18:13898243-13898265 CAACATCACCAAAGGCCACAGGG - Intronic
1155501322 18:26490138-26490160 CCACACCACCATGGTGCCCATGG + Intronic
1159248657 18:65843969-65843991 CGACACCTCCATAGGGTACAAGG - Exonic
1161067123 19:2244171-2244193 CCACGCCAGCAGTAGGCACAAGG - Intronic
1161678623 19:5667590-5667612 CCAGACCACCAGAGAGCAGGCGG - Intronic
1164679261 19:30122946-30122968 CCTCACCGCGGGAGGGCACATGG + Intergenic
1166515965 19:43447196-43447218 CCAAGCCGCCAGAGGGCGCATGG + Intergenic
1166752876 19:45173022-45173044 CCACACCCCGAGAGTGCACTTGG - Intronic
925559082 2:5168392-5168414 TCACACCAGCAGAGGGTACATGG + Intergenic
928181609 2:29072260-29072282 CAACACCACCAGCAGGCTCAAGG - Exonic
928443698 2:31314680-31314702 CCATACTCCAAGAGGGCACAGGG + Intergenic
928757879 2:34547518-34547540 ACACACCACCAGAGGGCCTAAGG - Intergenic
930290821 2:49490961-49490983 CCCCACCACTAGAGGGAGCATGG - Intergenic
930818421 2:55621714-55621736 CTCCACCAGCAGAGGGCAAAGGG - Intergenic
933920316 2:87039344-87039366 TCCCAACACCAGAGGGCAAAGGG - Intergenic
933931308 2:87154442-87154464 TCCCAACACCAGAGGGCAAAGGG + Intergenic
934002681 2:87730555-87730577 TCCCAACACCAGAGGGCAAAGGG + Intergenic
934623557 2:95831315-95831337 CCAAACCAACTGAGGGCAGAAGG + Intergenic
934810192 2:97270780-97270802 CCAAACCAACTGAGGGCAGAAGG - Intergenic
934827500 2:97437159-97437181 CCAAACCAACTGAGGGCAGAAGG + Intergenic
934993818 2:98939300-98939322 CCTCACTGCCAGAGGCCACAGGG + Intergenic
935900643 2:107788595-107788617 CCACACCACCACTGGGCACTGGG - Intergenic
936361812 2:111810989-111811011 TCCCAACACCAGAGGGCAAAGGG - Intronic
942226813 2:173823728-173823750 CCTCAGCACCTGAGTGCACAAGG + Intergenic
943923345 2:193738712-193738734 CACCACCACCACAGGCCACAGGG - Intergenic
946196378 2:218034906-218034928 TCTCGCCACCAGGGGGCACAGGG - Intergenic
946200636 2:218068961-218068983 TCTCACCACCAGGGGGCAGAGGG - Intronic
946484063 2:220084184-220084206 CCACACAGCAAGAGGCCACATGG - Intergenic
947531376 2:230910666-230910688 GCACTCCACCAGGGTGCACAGGG + Exonic
947666068 2:231906241-231906263 CTTCACCACCAGAGGGCACCAGG + Intergenic
1170497591 20:16941225-16941247 GCAAACCTCCAGAGGGCAAAGGG + Intergenic
1171079753 20:22166792-22166814 CCACACATTCAGAAGGCACAGGG - Intergenic
1175809625 20:61851022-61851044 CCACACGCCCAGAGGTCACAGGG - Intronic
1175857483 20:62130122-62130144 CCCCACCACCATGGGGCACGCGG - Intronic
1175969918 20:62680169-62680191 ATACACCAGCAGAGGGCACTGGG - Intronic
1178020440 21:28402129-28402151 CCACAGCATCTGAGGGCCCACGG + Intergenic
1179711158 21:43263985-43264007 ACCCACCACCAGAGGCCTCAGGG - Intergenic
1181580391 22:23824918-23824940 CCCCACCAGCACAGGGCACAGGG + Intronic
1181782448 22:25202826-25202848 CCACACTCCCAGAAGGCTCAGGG - Intronic
1182147973 22:28008864-28008886 CCCCACCACCCCAAGGCACAAGG - Intronic
1182420677 22:30247171-30247193 CCCCCCAACCAGGGGGCACAGGG - Intergenic
1183318059 22:37147839-37147861 CCCCAATAGCAGAGGGCACAGGG + Intronic
1183357233 22:37366369-37366391 CCACACTCCCAGGGGCCACAGGG + Intergenic
1183545808 22:38454492-38454514 CCACACGACCCCAGGGCGCAGGG - Intronic
1183709683 22:39495598-39495620 AGACACCACCAGAGGGCAGCAGG + Intergenic
1184108247 22:42381116-42381138 CCACCCTAGCAGAGGGCCCATGG - Exonic
1184554451 22:45225600-45225622 CGACCACACCACAGGGCACAGGG + Intronic
950137139 3:10589392-10589414 ACAGACCACCAGAGGAGACAGGG + Intronic
950288531 3:11764428-11764450 CCACACAACCTGAAGGCCCAGGG + Intergenic
954660634 3:52225012-52225034 CCAAACCCCCAGAGGGGACGAGG - Intronic
954687713 3:52379638-52379660 CCAGACACCCAGAGGGCACTTGG + Intronic
959724979 3:109533013-109533035 CACCACCACCACAGGCCACAGGG + Intergenic
961365651 3:126397870-126397892 CCCCTCAACCAGAGGGCCCAGGG + Intronic
961707782 3:128802410-128802432 GCACAGGAACAGAGGGCACAGGG + Intronic
962378850 3:134880613-134880635 GCCCATCACCAGAGGCCACAAGG + Intronic
963786610 3:149541354-149541376 CCTGACCCACAGAGGGCACACGG + Intronic
966318978 3:178679718-178679740 CAACACCACCAGAGGTCAAAGGG - Intronic
968134193 3:196209580-196209602 CCACGGCATCACAGGGCACAAGG + Intronic
968598258 4:1496336-1496358 CCACCCCACCGCAGGGCAGAGGG + Intergenic
970591676 4:17565465-17565487 CCACACCACCAGACATCAGACGG + Intergenic
973650715 4:52994585-52994607 CCACACCACCTGAGAGTCCAAGG - Intronic
974784285 4:66597473-66597495 GCACACCAACTGAGGGCACGAGG + Intergenic
976507573 4:85866727-85866749 CCAATCCACCAAAAGGCACAGGG - Intronic
984940714 4:184929846-184929868 ACACATCACCAGTGGGCAGATGG + Intergenic
985242036 4:187940753-187940775 CCAAACCACCAAAAGGCAAAGGG + Intergenic
986272996 5:6250303-6250325 CCGCACCAGCAGTGGACACACGG + Intergenic
987965618 5:24868423-24868445 CGAAACCACCAGAGGACTCAAGG - Intergenic
988583579 5:32489879-32489901 CTCCACCACGAGAGGGCGCATGG + Intergenic
988633955 5:32961405-32961427 CTACAACATCAGAGGGCACTTGG + Intergenic
989327904 5:40221657-40221679 CCATACCACCAAGGAGCACATGG + Intergenic
991018618 5:61957870-61957892 CACCACCACCACAGGCCACAGGG + Intergenic
991162240 5:63517469-63517491 CAACATCACCATAGGGCAAATGG - Intergenic
991603855 5:68380672-68380694 CTACCCCACCAGAGGCTACATGG + Intergenic
993184535 5:84600601-84600623 CCACACCACCAGTGGGGCCTCGG + Intergenic
993761640 5:91802930-91802952 CTTCACCAGCAGAGGGCAAAGGG - Intergenic
993844395 5:92922527-92922549 AGACACCACCAGAGGCAACAAGG + Intergenic
996171145 5:120293193-120293215 CCACACCACAACAGGCCCCAGGG + Intergenic
999358157 5:150956781-150956803 CAACACCAGCACAGGCCACATGG - Intergenic
1001145743 5:169182922-169182944 CAACCCCACCACAGGTCACAGGG + Intronic
1001380128 5:171300474-171300496 CCACACTGCCAGAGGTCACCTGG + Intergenic
1003158522 6:3616726-3616748 CCACACAAACAGGTGGCACAAGG + Intergenic
1003955548 6:11162113-11162135 CCACACCAAGAGAGGGCATTGGG + Intergenic
1004423593 6:15492702-15492724 GCCCACCACGAGAGGCCACAGGG - Intronic
1005114141 6:22317906-22317928 CCACACCAGCAGAGGCAACCTGG - Intergenic
1005707591 6:28470646-28470668 CCACACCATGGCAGGGCACAGGG + Intergenic
1006780816 6:36631228-36631250 CCACACTGCCAGTGGGGACAGGG - Intergenic
1007706563 6:43794936-43794958 CCTCACCATCAGGGAGCACACGG - Intergenic
1009162698 6:60303010-60303032 CCACACATTCAGAGGGAACATGG - Intergenic
1011025923 6:82868950-82868972 CCTCATCCCCAGAGTGCACAAGG - Intergenic
1012486199 6:99724992-99725014 CACCACCACCAAAGGCCACAGGG + Intergenic
1013420417 6:109961943-109961965 CCAAACCAGCAGAGCACACAGGG + Intergenic
1015871437 6:137780169-137780191 CCACCACAGCAGAGGCCACACGG - Intergenic
1016851075 6:148619629-148619651 CCAAACCAGGAGTGGGCACATGG - Intergenic
1017741993 6:157414650-157414672 CCAGGCCACCACTGGGCACAGGG + Intronic
1018630319 6:165816728-165816750 CAACACCACCAGAGTGCCCTGGG + Intronic
1019060834 6:169256266-169256288 CCTCACCCCCAGGGGGCCCAGGG - Intergenic
1019168146 6:170112656-170112678 CCAAACCAGCTGCGGGCACAGGG - Intergenic
1023994817 7:45152853-45152875 CCAAACCAACAGGGAGCACATGG + Intergenic
1025724353 7:64043778-64043800 CATCACCACCCGATGGCACAGGG - Intronic
1029438681 7:100575870-100575892 CCACAGCAGGGGAGGGCACATGG + Exonic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1032548259 7:132761586-132761608 CCACACCTCCAGAGTACACAGGG + Intergenic
1033208146 7:139439964-139439986 CGGCACCATCAGAGGGAACATGG - Intergenic
1035305678 7:157929807-157929829 GAACACCACCAGTGGGCACTGGG - Intronic
1036657046 8:10683440-10683462 CCCCAGCATCAGAGGGGACAAGG + Intronic
1037911309 8:22745264-22745286 CCTCCCCACCACAGTGCACAGGG - Intronic
1040447848 8:47513951-47513973 CCACAGCCCAAGAAGGCACATGG - Intronic
1043396484 8:79842628-79842650 CCAAACCACCTGGGGGCAGAAGG + Intergenic
1046499854 8:115061465-115061487 CCACACGACCAGAGACCACAAGG + Intergenic
1048737246 8:137515421-137515443 CCAAAACCCCAGAGGTCACAGGG - Intergenic
1048804888 8:138230761-138230783 CTACAGCACCAGAGGCCAAAGGG + Intronic
1049456516 8:142694081-142694103 CATCCCCAGCAGAGGGCACAAGG + Intergenic
1049481256 8:142824402-142824424 CATCCCCAGCAGAGGGCACAAGG - Intergenic
1049711027 8:144063383-144063405 CCCCACCACCAGAGAGCGCAGGG + Intronic
1049798547 8:144507317-144507339 CCCCACAACCAGAGGCCAGAGGG - Intergenic
1051121331 9:13755693-13755715 CCACCCCACCATGTGGCACAGGG - Intergenic
1052340221 9:27357650-27357672 CCACGCCACAAGAGAGCACATGG - Intronic
1055427035 9:76206930-76206952 CCACCCTACCAGAGGGTCCAGGG + Intronic
1057809710 9:98248439-98248461 CCCCACCACCAGTGGGAAGAAGG + Intronic
1058249117 9:102669224-102669246 CCACAGTAGGAGAGGGCACAAGG - Intergenic
1061481932 9:130901721-130901743 CCAGACCAGGAGAGGGCACATGG - Intergenic
1062460280 9:136660051-136660073 ACACACCACCAGAGCGGCCAGGG + Intronic
1186979780 X:14946337-14946359 TCAAACCTCCAGAGGGCACAGGG + Intergenic
1188549056 X:31342154-31342176 CCACAGCACAAGAGGGCTCCTGG + Intronic
1189619326 X:42818732-42818754 CTCCACCAGCAGAGGGCAGAGGG + Intergenic
1190487985 X:50948854-50948876 CCACACCCTCAGAGGGAAGATGG + Intergenic
1190614635 X:52217664-52217686 CAATACCACCACAGGCCACAGGG - Intergenic
1195543445 X:106088297-106088319 CCACCCCAGCAGAGGCCACATGG - Intergenic
1197075786 X:122350887-122350909 CCCCACCACCAGAGATCACAGGG - Intergenic
1197119642 X:122875253-122875275 CCACACCACCTGAATTCACAAGG + Intergenic
1199565434 X:149210927-149210949 CCAGACCACCAAAGGGGCCAGGG + Intergenic