ID: 1102061899

View in Genome Browser
Species Human (GRCh38)
Location 12:109938854-109938876
Sequence TGCATTTGTACCCAAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102061899_1102061904 14 Left 1102061899 12:109938854-109938876 CCAACTCCTTGGGTACAAATGCA 0: 1
1: 0
2: 0
3: 39
4: 146
Right 1102061904 12:109938891-109938913 GTTGTCTTCATGATGAAGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 171
1102061899_1102061902 12 Left 1102061899 12:109938854-109938876 CCAACTCCTTGGGTACAAATGCA 0: 1
1: 0
2: 0
3: 39
4: 146
Right 1102061902 12:109938889-109938911 ATGTTGTCTTCATGATGAAGTGG 0: 1
1: 0
2: 2
3: 16
4: 268
1102061899_1102061903 13 Left 1102061899 12:109938854-109938876 CCAACTCCTTGGGTACAAATGCA 0: 1
1: 0
2: 0
3: 39
4: 146
Right 1102061903 12:109938890-109938912 TGTTGTCTTCATGATGAAGTGGG 0: 1
1: 0
2: 1
3: 25
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102061899 Original CRISPR TGCATTTGTACCCAAGGAGT TGG (reversed) Intronic
902687566 1:18088644-18088666 TGAATTTTTAGCCAAGGAGCAGG + Intergenic
905781976 1:40719537-40719559 TGCAGTTGCATCAAAGGAGTGGG - Intronic
907035257 1:51210739-51210761 AGCTTTTGTCCCCATGGAGTTGG + Intergenic
908038361 1:60080779-60080801 TTCATTTCTACCCAAGGAGCTGG + Intergenic
909003921 1:70253521-70253543 TCACTTTGAACCCAAGGAGTTGG + Intergenic
910656909 1:89629020-89629042 TGAATTTGTACCAGAGGAGATGG - Intergenic
914255637 1:145959933-145959955 TGCATTTGTTCAGAAGCAGTAGG - Exonic
914977822 1:152381661-152381683 TGCATTAGTACCTAACAAGTGGG - Intergenic
918993378 1:191727368-191727390 TGCAGTTGAACCCAAGGAAAAGG + Intergenic
919945482 1:202316356-202316378 TGGATTAGTTCCCTAGGAGTGGG - Intronic
922014829 1:221634704-221634726 TGGATTTATAGCCAAGGAGAAGG + Intergenic
923923969 1:238602355-238602377 TTTATTTGTACCCAAGTTGTTGG - Intergenic
924356335 1:243180554-243180576 TGCATGGGAACTCAAGGAGTAGG - Intronic
1065166572 10:22985331-22985353 TGAATTTATACCCAGTGAGTGGG - Intronic
1065671133 10:28119252-28119274 TGCTTTTGTACCCAAGAAAATGG + Intronic
1066216940 10:33297232-33297254 TGCATTTGGAACCTATGAGTTGG + Intronic
1068719179 10:60223300-60223322 GGAATTTATAGCCAAGGAGTAGG - Intronic
1070760568 10:79021684-79021706 TGCATTAGCACCCAAGGGATGGG - Intergenic
1071056654 10:81519447-81519469 TGCATTTCTCCCCAAGGATGTGG - Intergenic
1071586709 10:86830076-86830098 GGAATTTGTAGCCAAGGAGCTGG + Intronic
1071710261 10:88042777-88042799 TGCATCTGTACCCAAGGGCTAGG - Intergenic
1072557209 10:96529209-96529231 GGCATTAGTACCTTAGGAGTTGG - Intronic
1074918842 10:117986307-117986329 TGGTTTTGAACCCAAGGAATGGG + Intergenic
1078130480 11:8610201-8610223 TGCCATGGAACCCAAGGAGTCGG + Intergenic
1079169125 11:18075400-18075422 AGGATCTGTACCCAAGGAGGTGG - Intronic
1085932097 11:81096088-81096110 TGCATTTGTCACAAAGTAGTGGG + Intergenic
1087403835 11:97703530-97703552 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1087870252 11:103285234-103285256 GGAATTTGTACCCAAGAAGCAGG + Intronic
1089314174 11:117579398-117579420 TCCAGTTGTGCCCAAGGAGTGGG - Intronic
1091757119 12:3061037-3061059 TGCACATGTACTCAAGGAGAGGG - Intergenic
1094122212 12:26986423-26986445 GGAATTTGTAGCCAAGCAGTAGG - Intronic
1094177143 12:27552804-27552826 GGCATTTATAGCCAAGGAGCAGG + Intronic
1095347225 12:41165411-41165433 TGCATTTCTACCACAGAAGTTGG - Intergenic
1098694507 12:73536121-73536143 TGCATCTGTACTGAAAGAGTAGG - Intergenic
1100015651 12:90007866-90007888 TAGATTTTTATCCAAGGAGTGGG + Intergenic
1101443112 12:104718282-104718304 GGGATTTGAACCCAGGGAGTTGG + Intronic
1102061899 12:109938854-109938876 TGCATTTGTACCCAAGGAGTTGG - Intronic
1103212643 12:119178233-119178255 TGAATTTGTAGCCAAGAAGCAGG - Intergenic
1104711670 12:130991521-130991543 TGGATTTGAACCCAAGCAGATGG - Intronic
1105674416 13:22654986-22655008 TGCATTTGTATCAAAGTAGTTGG - Intergenic
1107309856 13:39065020-39065042 TGGATTTATACCCCAGAAGTGGG + Intergenic
1107963394 13:45578299-45578321 AGAATTTATACCCAAGGAGCAGG - Intronic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1110700440 13:78541135-78541157 TGCATTTGGACCCTAGCACTTGG + Intergenic
1112769416 13:102779812-102779834 GGCATTTATAGCCAAGGAGCAGG + Intergenic
1113528918 13:111005548-111005570 GGAATTTGTAGCTAAGGAGTAGG - Intergenic
1115068229 14:29291888-29291910 TTAATTTGTACCAAAGTAGTGGG - Intergenic
1118504287 14:66393549-66393571 TGACTCTGTACCCAGGGAGTGGG - Intergenic
1120331020 14:83092666-83092688 TGCATAGGTACCCACGGAGGCGG - Intergenic
1121539094 14:94711673-94711695 TGCCTTTTTACGAAAGGAGTGGG + Intergenic
1121558633 14:94857779-94857801 GGGATTTGAACCCAAGGAATCGG + Intergenic
1122003668 14:98684800-98684822 TGCATCTGTCCCTAAGGAGCTGG - Intergenic
1122146507 14:99692023-99692045 TGCAAGAGTCCCCAAGGAGTGGG - Intronic
1125081184 15:35675432-35675454 AGCCTTTGTACACAAGTAGTAGG + Intergenic
1127205534 15:56713174-56713196 TGCATTACTAACCAAGAAGTTGG + Intronic
1127596307 15:60485912-60485934 TGCATTTGTACCAAATGGGCAGG - Intergenic
1133533928 16:6682168-6682190 ATCATTTGTGCCCAAGGATTAGG + Intronic
1144462037 17:15466172-15466194 TGGATTTGAACCCAGGGACTCGG + Intronic
1144933283 17:18877438-18877460 TGCATCTGTGCCCCAGGAGTCGG - Intronic
1155707038 18:28828722-28828744 GGGATTTGTAACCAAGGAGCAGG - Intergenic
1156617513 18:38805105-38805127 TGCATTTGTAACTCAGGAGGGGG - Intergenic
1157807373 18:50668210-50668232 AGCATCTGTCCCCAGGGAGTGGG + Intronic
1164253230 19:23503278-23503300 TGCATTTATAGCCATGCAGTAGG + Intergenic
1165905615 19:39192840-39192862 TGCATTTATTTCCAAGGAGCCGG - Intergenic
1166612189 19:44208664-44208686 TCCATATGAACCCAAGAAGTTGG + Intronic
1167762444 19:51458078-51458100 TCCAAATGTCCCCAAGGAGTTGG + Exonic
925079167 2:1048180-1048202 TGCATGTGTACACAAAAAGTAGG - Intronic
925221312 2:2143677-2143699 GGCATTTGTACCCAGGGGATGGG + Intronic
926098487 2:10098145-10098167 TGCATTTGAACCAAAGCAGCAGG - Intergenic
927494892 2:23545713-23545735 TTCCTTTGTAGCCAGGGAGTGGG + Intronic
929141812 2:38673131-38673153 TTAATTTGTACCCAACCAGTTGG + Intronic
930009235 2:46923070-46923092 TGCTTCTGTCCCCATGGAGTTGG + Intronic
930444500 2:51452659-51452681 GGAATTTATAGCCAAGGAGTAGG - Intergenic
931641428 2:64383947-64383969 TGTATTTGTGGCCAAGGGGTTGG - Intergenic
931824933 2:65990523-65990545 GGAATTTGTAGCCAAGGAGTGGG - Intergenic
936785470 2:116089251-116089273 TGCATAAATACCCAAGTAGTGGG + Intergenic
937416929 2:121722691-121722713 TTCATTTGTTCCCATGGACTTGG - Intergenic
937667140 2:124500402-124500424 GGGATTTATAGCCAAGGAGTAGG + Intronic
938711446 2:133979116-133979138 TGCATTTGGAACAGAGGAGTGGG - Intergenic
944887199 2:204075462-204075484 TGCATTTGTAGCCAAGCACAGGG + Intergenic
946015961 2:216604225-216604247 GGGATTTGTAGCCAAGGAGCAGG + Intergenic
946965880 2:225037398-225037420 TGCAGTTCTACCTAAGGATTAGG - Intronic
947206128 2:227662784-227662806 TTCATTTTCTCCCAAGGAGTTGG - Intergenic
1168856504 20:1012932-1012954 TGCATGTATTCCCAAGGAGATGG + Intergenic
1170923444 20:20701126-20701148 AGCATTTGAACCCAGGGAGCTGG - Intronic
1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG + Intergenic
1171452403 20:25245500-25245522 GGCATTTATAGCCAAGGACTGGG + Intergenic
1176204270 20:63879570-63879592 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204277 20:63879610-63879632 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204286 20:63879650-63879672 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204295 20:63879690-63879712 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204303 20:63879730-63879752 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204311 20:63879770-63879792 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204319 20:63879810-63879832 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204328 20:63879850-63879872 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204337 20:63879890-63879912 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204345 20:63879930-63879952 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204353 20:63879970-63879992 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204362 20:63880010-63880032 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204370 20:63880050-63880072 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204378 20:63880090-63880112 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204386 20:63880130-63880152 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204394 20:63880170-63880192 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204403 20:63880210-63880232 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204412 20:63880250-63880272 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204420 20:63880290-63880312 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204429 20:63880330-63880352 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204437 20:63880370-63880392 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176204446 20:63880410-63880432 TGCATTTGTGCCCTAAGAGTGGG - Intronic
1176204454 20:63880450-63880472 TGCATTTGTGCCTAAAGAGTGGG - Intronic
1176255210 20:64148302-64148324 TGCATTTTTACATAAGCAGTAGG + Intergenic
1179260284 21:39751676-39751698 TGCATTTGTACCCTCGAAGTCGG - Intronic
1179359638 21:40693894-40693916 TGGATTTGAACCCAGGGAGTTGG - Intronic
1180855621 22:19043009-19043031 TGCGTGTGTACCCAATGTGTGGG - Intronic
1181856498 22:25785029-25785051 AATATTTGTACCCATGGAGTGGG + Intronic
949849736 3:8410957-8410979 TGCTTTTGTTCCCATGGAGTTGG + Intergenic
958520213 3:95175677-95175699 GAAATTTATACCCAAGGAGTAGG - Intergenic
958860133 3:99436338-99436360 TGAATTGGTACCCATAGAGTGGG + Intergenic
959820430 3:110729255-110729277 TGCATTTTTGGTCAAGGAGTTGG - Intergenic
959934598 3:112015741-112015763 TGCATTTGCAGTCAAGTAGTAGG + Intergenic
960235474 3:115277100-115277122 TGCAGTTGTCCTCAAGGAGATGG - Intergenic
960257366 3:115525001-115525023 TGCCACTGTACCCAAGGAGGGGG + Intergenic
962047727 3:131778268-131778290 GGCAGTGGTACCCATGGAGTGGG - Intronic
962420333 3:135222823-135222845 TGCATTTGTACCCAGTGTATTGG - Intronic
963090906 3:141482937-141482959 AATATTTGTACCGAAGGAGTTGG + Intergenic
965373763 3:167896260-167896282 TGCATTTGTAACCAGGTATTAGG - Intergenic
966861833 3:184234795-184234817 TGCATTTGTGCACAAGGAGCAGG + Intronic
967022306 3:185533474-185533496 TGGCTTTGAACCCAAGGAGTTGG + Intronic
967259940 3:187632210-187632232 TGCATTTTTACATAAGCAGTAGG - Intergenic
974318047 4:60307278-60307300 TGAATTGGTACCAAGGGAGTGGG - Intergenic
979245479 4:118499073-118499095 TGCATGGGAACTCAAGGAGTAGG + Intergenic
983252548 4:165361245-165361267 TCCAGTTGTACTCAAGGAGAGGG + Intronic
987027568 5:13942766-13942788 AGGATTTGTAGCCAAGGAGCAGG - Intronic
987569481 5:19637781-19637803 GGAATTTATATCCAAGGAGTTGG - Intronic
989554835 5:42781751-42781773 TGTATTTACACACAAGGAGTTGG + Intronic
992288655 5:75262273-75262295 GGCATTTATAGCCAAGGAGCAGG - Intergenic
992669721 5:79046927-79046949 TGCATTAGTAAGCAAGCAGTTGG - Intronic
994962034 5:106617584-106617606 TTCATTTGTACTCAAAGATTTGG + Intergenic
995008277 5:107227931-107227953 TGCATCTATACACAATGAGTTGG - Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
997835293 5:137187163-137187185 GGTATTTGTAGCCATGGAGTGGG - Intronic
998340832 5:141416069-141416091 TGCAGTTCTTCCCAAGGAGAAGG + Intronic
999075685 5:148793199-148793221 TGGATTTGGACCCAGAGAGTCGG - Intergenic
999825031 5:155265655-155265677 TCCACTTGTACCAAAGGACTGGG + Intergenic
1000168266 5:158676713-158676735 TGGAGTTGCACCCAAAGAGTGGG - Intergenic
1001135969 5:169103236-169103258 TGCTTTTGGATCCAAGCAGTGGG + Intronic
1005132803 6:22530219-22530241 TGTATTTGTATCAAAGCAGTTGG + Intergenic
1005327591 6:24718539-24718561 TGCCTTTGTATTCAAGGAGAAGG - Exonic
1005801747 6:29432322-29432344 AGCATTTGTCCCCAAGGGGATGG - Intronic
1005911264 6:30311615-30311637 TGCATTTTTCCCCAAGGAATTGG - Intergenic
1008001697 6:46366771-46366793 GGAATTTCTACCCAAGGAGAAGG - Intronic
1008806935 6:55441127-55441149 AGAATTTATAGCCAAGGAGTGGG + Intronic
1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG + Intergenic
1012898899 6:104983918-104983940 AGTATTTGTACACAAGGATTTGG - Intronic
1013744555 6:113329983-113330005 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1014663213 6:124199624-124199646 TGCATTTCTACACAAAGAATTGG + Intronic
1016009729 6:139126892-139126914 GGGATTTGTAGCCAAGGAGCAGG + Intergenic
1016622900 6:146133408-146133430 TGCATTTGTACACAAGGACAGGG + Intronic
1016822536 6:148360245-148360267 TTGATTTTTTCCCAAGGAGTTGG + Intronic
1021933047 7:25601050-25601072 TGCATTTTTATCTATGGAGTTGG + Intergenic
1024606119 7:51023958-51023980 TTCACTTGTACCCAAGCATTCGG - Intronic
1028198771 7:87936186-87936208 TGTATTTGTAGCCAAGTAGTTGG + Intronic
1037626251 8:20609571-20609593 TGCATCTGCACTCAATGAGTCGG + Intergenic
1038486049 8:27935886-27935908 TTCATTAGTACCCAGGGAGGAGG + Intronic
1038803321 8:30768808-30768830 TGCAGTTGTACTCAAGCTGTTGG - Intergenic
1039984922 8:42439059-42439081 TAAATTTGTAACCAAGGAGGTGG - Intronic
1044408325 8:91856216-91856238 TGCATGTGGACCCTAAGAGTAGG - Intergenic
1055237318 9:74139312-74139334 TGAGTTTGTACTCAAGGTGTTGG - Intergenic
1056062295 9:82896305-82896327 TGCATCTATAGCAAAGGAGTGGG + Intergenic
1057260608 9:93580983-93581005 TGCCTGTGTACCCAGGGGGTGGG + Intronic
1057377065 9:94534830-94534852 GGCATTTATAGCCAAGGAGCAGG - Intergenic
1059539673 9:115118083-115118105 TGCCTTTGTGCCCACGGAGGCGG + Exonic
1059918460 9:119130814-119130836 TTCATTTGTACAGAAGGATTCGG - Intergenic
1060776318 9:126377217-126377239 AGCATTTCTTCCCCAGGAGTAGG - Intronic
1188905657 X:35788056-35788078 AGCATTTTTACCCAAATAGTAGG - Intergenic
1189228893 X:39436539-39436561 TACATTGGTACCCATAGAGTAGG - Intergenic
1190175591 X:48146467-48146489 GGGATTTGTAGTCAAGGAGTAGG - Intergenic
1190182879 X:48208359-48208381 GGGATTTGTAGTCAAGGAGTAGG - Intronic
1190328249 X:49219686-49219708 GGAAGTTGTACCCAAGGAGAAGG - Exonic
1190668566 X:52718091-52718113 GGGATTTGTAGTCAAGGAGTAGG + Intergenic
1190670851 X:52740313-52740335 GGGATTTGTAGTCAAGGAGTAGG - Intergenic
1194569024 X:95530511-95530533 TGCTTTTGTAGCCAAGAAGATGG + Intergenic
1196172376 X:112603866-112603888 TGGATTTCTCCCCAAGGACTGGG + Intergenic
1199558248 X:149132875-149132897 AGCATTTGAACCCAGGCAGTTGG - Intergenic
1200212539 X:154353178-154353200 TTCATTCGTGCCCAAGGAGACGG - Exonic
1201491205 Y:14543503-14543525 AGCATTTGCTCCTAAGGAGTTGG - Intronic