ID: 1102063359

View in Genome Browser
Species Human (GRCh38)
Location 12:109952256-109952278
Sequence CCCCCAGGACACACCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102063359_1102063365 1 Left 1102063359 12:109952256-109952278 CCTCTGTGGGTGTGTCCTGGGGG 0: 1
1: 0
2: 1
3: 42
4: 353
Right 1102063365 12:109952280-109952302 CAGCAGAGGGTGCACAGCCTGGG 0: 1
1: 0
2: 3
3: 46
4: 317
1102063359_1102063364 0 Left 1102063359 12:109952256-109952278 CCTCTGTGGGTGTGTCCTGGGGG 0: 1
1: 0
2: 1
3: 42
4: 353
Right 1102063364 12:109952279-109952301 TCAGCAGAGGGTGCACAGCCTGG 0: 1
1: 0
2: 3
3: 42
4: 302
1102063359_1102063366 2 Left 1102063359 12:109952256-109952278 CCTCTGTGGGTGTGTCCTGGGGG 0: 1
1: 0
2: 1
3: 42
4: 353
Right 1102063366 12:109952281-109952303 AGCAGAGGGTGCACAGCCTGGGG 0: 1
1: 1
2: 6
3: 36
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102063359 Original CRISPR CCCCCAGGACACACCCACAG AGG (reversed) Intronic
900109112 1:998234-998256 CCCCCAGTCCTCACCCACTGGGG + Intergenic
900311716 1:2036579-2036601 CCCGGAGGACACAGCCATAGTGG - Intergenic
900436362 1:2633094-2633116 CCCCCATGCCACACCCCCAGTGG - Intergenic
900578566 1:3396205-3396227 CCCCCAGGACACCCCCAGCTGGG + Intronic
900645442 1:3706775-3706797 CGCAGGGGACACACCCACAGGGG + Intronic
901476719 1:9495081-9495103 CTCCCAGGACACACCCCAAGCGG - Intergenic
901636176 1:10671215-10671237 CCCCCAGGTCACAGCCAAACAGG + Intronic
902041896 1:13498741-13498763 ACCCCAGGAAACACCTGCAGGGG - Intronic
902115899 1:14120789-14120811 CTCCCAGGACACACAGACAGGGG - Intergenic
902442612 1:16440904-16440926 CCACCCGGACACACCCACTGCGG + Intronic
903287631 1:22286641-22286663 CCCCCAGGCAACACCAACTGAGG - Intergenic
905365521 1:37449120-37449142 CCCCCAGGACCCATGCCCAGGGG - Intergenic
905390863 1:37634631-37634653 CGCCCAGGACAGTCCCGCAGCGG - Exonic
906063323 1:42962351-42962373 CCCCCATGCCCCAGCCACAGGGG - Intergenic
910437253 1:87217835-87217857 ACCCCACCACACACTCACAGTGG - Intergenic
911118224 1:94268403-94268425 CCCCCAGCACACACACACATTGG + Intronic
912458922 1:109818438-109818460 CCCCCACAACACACCCACTTGGG - Intergenic
915349794 1:155217127-155217149 CCCCCAGGACAAAACAGCAGGGG + Intergenic
915353051 1:155238404-155238426 CCCCCAGGACAAAACAGCAGGGG + Intronic
918145501 1:181752508-181752530 GCCCCAGGACAAAGCCACACAGG - Intronic
920061824 1:203232216-203232238 CCACCAGGACAGACAAACAGAGG + Intronic
920070206 1:203297130-203297152 ACCACAGAGCACACCCACAGTGG - Intergenic
922434797 1:225593386-225593408 CCCCCCCCACACACACACAGGGG - Intronic
923031466 1:230252233-230252255 CTCCCAATGCACACCCACAGAGG - Intronic
924801565 1:247332153-247332175 CCCCCAGGACACGCGGCCAGTGG + Intergenic
924944254 1:248835250-248835272 CTCCCACCACACACCCCCAGTGG - Intergenic
1062829689 10:597340-597362 CCCCCTGGACACACACACACCGG + Intronic
1063138166 10:3235024-3235046 CCTCCAGGAGACGCCCACACTGG - Intergenic
1065151203 10:22825158-22825180 CCCCCAGGAGACTACCCCAGAGG + Intergenic
1067224061 10:44363930-44363952 GCCCCAGGGGACAACCACAGTGG - Intergenic
1067257178 10:44652804-44652826 ACCACAGGACACATCCCCAGAGG + Intergenic
1067289201 10:44929191-44929213 CTGCCAGGACACACTTACAGAGG - Intronic
1067405456 10:46019203-46019225 AACCCTGGACACACCAACAGTGG + Intronic
1069900989 10:71706658-71706680 CCCCCAGGGCACAGGGACAGCGG + Intronic
1070486325 10:76935296-76935318 CCCCCAGGACAAACACTCAAGGG - Intronic
1073475046 10:103747249-103747271 CCTCCAGGACGCAGACACAGTGG + Intronic
1074611804 10:115028876-115028898 CCCCCAGCACACAAACACAAGGG - Intergenic
1075714317 10:124547466-124547488 CCCCCAGTGTCCACCCACAGAGG + Intronic
1076804521 10:132848622-132848644 CCCTAAAGACACACCCGCAGCGG + Intronic
1076842381 10:133052180-133052202 CCCCCAAGACACAGCACCAGCGG - Intergenic
1077042087 11:529336-529358 CCCTCTGCCCACACCCACAGGGG - Intergenic
1077094099 11:792108-792130 CCCCCAGGCCCCACCCGCCGTGG + Intronic
1077305567 11:1867301-1867323 CCTCCAGGACACAGACCCAGAGG + Intronic
1077497009 11:2891289-2891311 TCCACAGGACACAGACACAGGGG + Intronic
1077549400 11:3193391-3193413 CTCCCAGGAGGCACCCAGAGAGG + Intergenic
1078894631 11:15587045-15587067 CCACCATACCACACCCACAGTGG - Intergenic
1079123198 11:17699512-17699534 CCCCCTGGGCAGACCCTCAGTGG - Intergenic
1079139383 11:17797917-17797939 CCCCCAGGACAGTCCCACAGTGG + Intronic
1080634688 11:34113405-34113427 TTCCCAGGATACACACACAGGGG - Intronic
1083203211 11:61132320-61132342 CCCCCAGGGAACACCCCCTGTGG - Exonic
1083654621 11:64223540-64223562 TCCCAAGCCCACACCCACAGGGG + Exonic
1083759167 11:64806435-64806457 CCACCAGGGCACACCCAGAAGGG + Intronic
1084220547 11:67674949-67674971 CTCCCAGGCCCCAGCCACAGTGG + Intronic
1084311348 11:68317919-68317941 CCCCCAGGACAACCTCCCAGGGG - Intronic
1084461488 11:69298943-69298965 CTCCCAGCTCACCCCCACAGGGG + Intronic
1084673738 11:70622417-70622439 AGCCCAGGACACTCGCACAGAGG - Intronic
1090240982 11:125181652-125181674 CCCCCATGACACAAGCACATGGG - Intronic
1090802876 11:130184691-130184713 GCCCCAGCAGACTCCCACAGTGG + Intronic
1091400788 12:179443-179465 GCCCCAGGACACTCGCAGAGAGG + Intergenic
1091793914 12:3286667-3286689 CATCCAAGACACACCCCCAGGGG + Intergenic
1093343410 12:18007880-18007902 CCCCCACCACACACACACTGGGG - Intergenic
1093741478 12:22693751-22693773 CCCCCAACACACACACACACAGG - Intergenic
1094381394 12:29847410-29847432 CCCCCACAACACACACACAATGG - Intergenic
1100796140 12:98183761-98183783 GCCCCAGGACACACAGAAAGTGG + Intergenic
1101876502 12:108599717-108599739 CCCCCAGGGCCCACCAGCAGGGG + Intergenic
1101916548 12:108900445-108900467 CCTCCAGGGCACATCCCCAGTGG - Exonic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1102759766 12:115375172-115375194 CCCCCAGGACCCAAACAGAGAGG - Intergenic
1103847458 12:123911365-123911387 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847470 12:123911395-123911417 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847485 12:123911425-123911447 CCCCCAGGACAGACCCCCCCCGG - Intronic
1103847520 12:123911502-123911524 CCCCCAGGACAGACCCCCCTAGG - Intronic
1103847545 12:123911561-123911583 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847749 12:123912002-123912024 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847762 12:123912031-123912053 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847769 12:123912046-123912068 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847807 12:123912124-123912146 CCCCCAGGACAGACCCCCCCGGG - Intronic
1103847842 12:123912201-123912223 CACCCAGGACAGACCCACCCAGG - Intronic
1103847848 12:123912216-123912238 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847873 12:123912277-123912299 CCCCCAGGACAGACCCCCCCGGG - Intronic
1103847893 12:123912322-123912344 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847905 12:123912352-123912374 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847918 12:123912381-123912403 CCCCCAGGACAGACCCCCCCGGG - Intronic
1103847942 12:123912429-123912451 CCCCCAGGACAGACCCCCTGCGG - Intronic
1104341299 12:127951812-127951834 CACCCAGGACACAACTCCAGAGG + Intergenic
1104649976 12:130524433-130524455 CCCCATGCACAGACCCACAGTGG + Intronic
1104785238 12:131444575-131444597 CCCGCTGGACACAGCCAGAGAGG - Intergenic
1104986880 12:132602456-132602478 CCCCCAGGAGAGACCTGCAGGGG - Intergenic
1105437283 13:20390164-20390186 TCCCCAGAACACAGCCAGAGTGG + Intergenic
1112641691 13:101282650-101282672 CCCCCACCCCACACACACAGAGG + Intronic
1113062069 13:106332653-106332675 CCCCCAACACACGCACACAGTGG + Intergenic
1113619013 13:111700577-111700599 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113624542 13:111785838-111785860 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113972808 13:114202887-114202909 CCTCCAACACACACACACAGTGG + Intergenic
1114031588 14:18584478-18584500 TCCCCAGGCCACACCCACCCTGG + Intergenic
1117732679 14:58739648-58739670 ACCCCAGGACACAAACCCAGGGG - Intergenic
1119133566 14:72196255-72196277 CTCCCAGCAAAAACCCACAGTGG - Intronic
1119893861 14:78203140-78203162 CCCCCAGGGCACATTCCCAGGGG - Intergenic
1121467145 14:94123267-94123289 ATCCCAGGAAACACCAACAGGGG + Intergenic
1122530401 14:102421518-102421540 CCCCCAGGGCCCACCCACATAGG - Intronic
1122839771 14:104451555-104451577 CCCCCAACACACGCACACAGTGG + Intergenic
1122992925 14:105247170-105247192 CGCCAAGGACACACCCACCGAGG - Intronic
1123057049 14:105575566-105575588 CCCCCAGGACAGGCCCACTTGGG + Intergenic
1123081197 14:105696325-105696347 CCCCCAGGACAGGCCCACTTGGG - Intergenic
1202839806 14_GL000009v2_random:111216-111238 CCCCCCACACACAGCCACAGTGG - Intergenic
1123467788 15:20529217-20529239 CCCTCTGGTCCCACCCACAGAGG + Intergenic
1123650324 15:22471825-22471847 CCCTCTGGTCCCACCCACAGAGG - Intergenic
1123740732 15:23280667-23280689 CCCTCTGGTCCCACCCACAGAGG - Intergenic
1123746266 15:23321891-23321913 CCCTCTGGTCCCACCCACAGAGG + Intergenic
1124278533 15:28345208-28345230 CCCTCTGGTCCCACCCACAGAGG + Intergenic
1124304167 15:28566400-28566422 CCCTCTGGTCCCACCCACAGAGG - Intergenic
1124533044 15:30522868-30522890 CCCTCTGGTCCCACCCACAGAGG - Intergenic
1124765613 15:32484776-32484798 CCCTCTGGTCCCACCCACAGAGG + Intergenic
1124910448 15:33915382-33915404 CCCCAAGCACACACCCTCACTGG + Intronic
1125002854 15:34789406-34789428 CCTCCAGGCCACACGCACTGGGG + Exonic
1125598624 15:40903241-40903263 CCCACAGTACACACACTCAGCGG - Exonic
1126225164 15:46261857-46261879 CCCCCAGGAAACAAGCAAAGTGG - Intergenic
1128224482 15:65992434-65992456 CCCCCCACACACACACACAGAGG - Intronic
1129481856 15:75832848-75832870 ACCCCAGGAAACACTCATAGAGG - Intergenic
1129674300 15:77624242-77624264 CAACCAGCACACACACACAGAGG - Intronic
1129789569 15:78331695-78331717 CCCCCAGCACCCACCCAAAAGGG - Intergenic
1129878606 15:78992998-78993020 CCCACATGGCACACACACAGAGG - Intronic
1132425098 15:101709458-101709480 ACACCAGGACAGTCCCACAGAGG + Intronic
1132561020 16:594033-594055 CCCCCAGGAACCACCCGCACAGG + Intronic
1132587157 16:710590-710612 CCCCCAGGGCTCACCCTCTGTGG + Intronic
1132930582 16:2457038-2457060 CCCTCAGTACACATCCACTGCGG - Exonic
1132941308 16:2509782-2509804 CCCTGAGGACACACCCAGAGGGG - Intronic
1133270071 16:4606886-4606908 CCCCCAGGCCCAGCCCACAGTGG + Intergenic
1133782069 16:8947351-8947373 CCCCCAACACACACACACACAGG + Intronic
1134442094 16:14304314-14304336 CCCCCTGACCACCCCCACAGTGG + Intergenic
1136140380 16:28284407-28284429 CCCCCAGCACACACCCCCATGGG + Intergenic
1137001428 16:35233770-35233792 CCCCCAGGACAGAGGCACTGGGG + Intergenic
1138008477 16:53357903-53357925 CCCTCTGGTCCCACCCACAGAGG + Intergenic
1138602715 16:58066217-58066239 CCCAAAGGAGACACCCACTGTGG + Intergenic
1140030883 16:71338301-71338323 CCACCAGGCTACACCCTCAGAGG + Intergenic
1141512255 16:84519974-84519996 GCCCCCGGACCAACCCACAGGGG + Intronic
1141513433 16:84527110-84527132 GCCTCAGCACACACCCACAGTGG + Intronic
1141868209 16:86765689-86765711 ATCCCAGGAAACACCAACAGGGG + Intergenic
1142609906 17:1103339-1103361 CCTCCAGGTCAGACCCTCAGGGG + Intronic
1142961186 17:3553431-3553453 CCCCCAGGACTCAGCTCCAGTGG + Intronic
1142972779 17:3623930-3623952 CTGCCAGGACACACTCACTGCGG + Intronic
1143491772 17:7289337-7289359 CCACCAGGAAGCCCCCACAGAGG - Intronic
1143782061 17:9234111-9234133 CCCACAGGAGACGCCCACATGGG - Intronic
1144024117 17:11262465-11262487 CTCACATGTCACACCCACAGAGG + Intronic
1146607230 17:34271096-34271118 GACCCAGGACACACCCTCAATGG + Intronic
1146985294 17:37210641-37210663 CCCCCAGGATACCTCCAAAGAGG + Intronic
1147143939 17:38474595-38474617 TCCCCAGGACACCTCCACTGGGG - Intronic
1147147368 17:38492871-38492893 CCCCCAAAACACACCCTCACGGG - Intronic
1148795806 17:50196137-50196159 CCTACAGGCCACACTCACAGGGG + Exonic
1148834938 17:50461089-50461111 GCCCCAGGGCAGACCCACTGAGG + Intronic
1151504185 17:74515594-74515616 CCTCAAGAACACACCCACGGAGG - Intergenic
1151540249 17:74761188-74761210 CCTCCAGGCCACAGCCACACTGG + Intronic
1152557987 17:81064065-81064087 CCACAAGGCCACACCCAGAGGGG - Intronic
1152672121 17:81614878-81614900 CCAACAAGACACACACACAGGGG + Intronic
1152853515 17:82650511-82650533 CCCCCAGGACACATCTTTAGAGG - Intergenic
1152924751 17:83081662-83081684 CCCCCCACACACACACACAGGGG + Intronic
1153226613 18:2905285-2905307 CCCCCCCGCCCCACCCACAGAGG - Intronic
1156502494 18:37568311-37568333 CCCCTAGGACACATCAGCAGTGG + Intergenic
1157184615 18:45528166-45528188 CCCCCCGCACACACACACACAGG - Intronic
1158349859 18:56554142-56554164 GCACCATGGCACACCCACAGAGG - Intergenic
1160145877 18:76363963-76363985 CCCCCAGGGCACATCCACCTGGG + Intronic
1160168300 18:76532100-76532122 CACCCAGGACCCACCCACCCAGG - Intergenic
1160530613 18:79560196-79560218 CCACCAGGCCCCAACCACAGAGG - Intergenic
1160924217 19:1535325-1535347 CCCCCAGGACAGCCCCTCTGGGG - Exonic
1161015324 19:1980270-1980292 CCCTCGGGGCCCACCCACAGCGG + Exonic
1161680550 19:5677782-5677804 CTCCCAGCACCCAGCCACAGAGG - Intronic
1163031201 19:14545372-14545394 CCTCCCGGGCACACCCACTGTGG + Intronic
1163116971 19:15195000-15195022 ACCCCAGGACACAACCACGCAGG + Intronic
1163402807 19:17104398-17104420 GCCACAAGACTCACCCACAGTGG - Intronic
1163617442 19:18337970-18337992 ACCCCAGGTCACACGCTCAGTGG - Intergenic
1164265299 19:23610357-23610379 TCCCCAGAGCACAGCCACAGTGG - Intronic
1164965654 19:32480576-32480598 CCTCCAGGAGACCCCCACACAGG - Intronic
1165061902 19:33208956-33208978 CCCCCAGGACGCCCCCGAAGAGG - Exonic
1167117659 19:47497588-47497610 CCTCCTGTACCCACCCACAGAGG + Intronic
1167696260 19:51017150-51017172 CCACCAGGACACCCGCGCAGTGG + Exonic
1202652633 1_KI270707v1_random:20688-20710 CCCCCCACACACAGCCACAGTGG - Intergenic
925169667 2:1743462-1743484 CCCCCAGGACACCCCAGGAGAGG + Intronic
925208478 2:2026886-2026908 GCCCCAGGATAACCCCACAGAGG - Intronic
925343185 2:3150865-3150887 CCCCGAGCACACACCCCCACTGG + Intergenic
925745087 2:7037120-7037142 TCCACAGCACACACACACAGTGG + Intronic
926141621 2:10371493-10371515 CCCCCAGGTCACAGCCAAGGTGG - Intronic
926216606 2:10909490-10909512 CCCCCAGGAAACCCCAATAGAGG + Intergenic
926727071 2:16006830-16006852 CCCCGAGGCCACACCCACTGTGG + Intergenic
926916119 2:17893692-17893714 CCCCAAACACACACCCCCAGTGG - Intronic
927179025 2:20430887-20430909 TGCCCAGGACAGACCAACAGAGG + Intergenic
932277935 2:70465402-70465424 CCCCCAGCCCACAGCCACTGAGG - Intronic
932430538 2:71671466-71671488 CCCCCAGGGCTCACCTACAAGGG + Intronic
934056062 2:88252695-88252717 CCCCCAGGACCCTTCCCCAGTGG + Intergenic
934686848 2:96327411-96327433 CCACCAGCACACAGCCACAGCGG - Exonic
935828381 2:106974170-106974192 CCCCCAGGAAGCAGACACAGAGG + Intergenic
937117127 2:119415748-119415770 TCTCCAGCACACACACACAGAGG + Intergenic
937955129 2:127417883-127417905 CCCCCAACACACACACACAATGG - Intergenic
938317271 2:130338872-130338894 CCCATAGGACACACTCACATAGG - Exonic
938496608 2:131801315-131801337 TCCCCAGGCCGCACCCACCGTGG - Intronic
943569762 2:189559554-189559576 CCCCCATAACACAGCCACACAGG + Intergenic
945324096 2:208463018-208463040 CACCCAGCAGACACCCACAGTGG - Intronic
946062990 2:216960952-216960974 TCCCCAGCACACAAACACAGAGG + Intergenic
947020286 2:225666857-225666879 CCCCCCCAACACACACACAGAGG + Intergenic
947548970 2:231032969-231032991 CCCCCAGGACACACCTGTACTGG - Intergenic
947643459 2:231720854-231720876 CCCACAAGTCAGACCCACAGAGG + Intergenic
1168841288 20:911621-911643 GCCCCAGGAGAGATCCACAGAGG + Intronic
1168976337 20:1968824-1968846 AGCCCAGGAGAAACCCACAGGGG + Intergenic
1168996476 20:2136896-2136918 TCCCCAGGAAACACTCCCAGAGG - Intronic
1169111084 20:3034357-3034379 CCTCCAGCACACACACACTGTGG + Intronic
1169303675 20:4469605-4469627 TCCCCAGGCCACACCCAGAATGG + Intergenic
1170148751 20:13205901-13205923 CCCCCAAGTTACACCCACATGGG + Intergenic
1171042823 20:21781539-21781561 CTCCAAGGACACAGCCTCAGTGG - Intergenic
1172701262 20:36855010-36855032 CCCCAAGCCAACACCCACAGAGG + Intronic
1173193851 20:40897492-40897514 CCCCCAACCCACACCCTCAGGGG + Intergenic
1174720298 20:52804612-52804634 GCCCAAGTACCCACCCACAGTGG - Intergenic
1175884316 20:62280298-62280320 GCCCCAGGACACACTCTCAGGGG - Intronic
1176139733 20:63539716-63539738 CCCCGAGGACTCACACCCAGAGG + Intergenic
1176172715 20:63703419-63703441 CCCCCAGGAACTTCCCACAGTGG + Intronic
1176599519 21:8778966-8778988 CCCCCCACACACAGCCACAGTGG + Intergenic
1176645460 21:9345225-9345247 CCCCCCACACACAGCCACAGTGG + Intergenic
1179250055 21:39664725-39664747 CCCACAGGACCCAGCCACAGGGG - Exonic
1179342328 21:40523948-40523970 CCCCCATCACACACCCTGAGAGG + Intronic
1179980772 21:44894611-44894633 GCCACAGGAAACCCCCACAGTGG - Intronic
1180037106 21:45255727-45255749 CCCCCCACACACACCCAGAGCGG + Intergenic
1180367465 22:11953931-11953953 CCCCCCACACACAGCCACAGTGG - Intergenic
1180367477 22:11953988-11954010 CCCCCCACACACAGCCACAGTGG - Intergenic
1180367489 22:11954045-11954067 CCCCCCAAACACAGCCACAGTGG - Intergenic
1180378592 22:12117319-12117341 CCCCCGACACACAGCCACAGTGG + Intergenic
1180378603 22:12117376-12117398 CCCCCCACACACAGCCACAGTGG + Intergenic
1180455700 22:15511535-15511557 TCCCCAGGCCACACCCACCCTGG + Intergenic
1181271896 22:21663933-21663955 CCTCCATGACACACATACAGTGG - Intronic
1181850734 22:25748224-25748246 TCCCCAGGACAGTCACACAGTGG - Intronic
1181967620 22:26668013-26668035 CCCCCAGCACACACACAGGGTGG - Intergenic
1182073541 22:27479405-27479427 CCCCCAGGAGACAGGCACAGGGG + Intergenic
1182572306 22:31248511-31248533 CCCCCAGCAGATTCCCACAGGGG - Exonic
1182738227 22:32546538-32546560 CCTCCAGCACCCACCCACCGAGG - Intronic
1183491781 22:38120697-38120719 TCCCCAGGGAACAGCCACAGTGG + Intronic
1184771009 22:46596414-46596436 GCACCAGCACCCACCCACAGAGG - Intronic
1185053276 22:48564763-48564785 CCCCCAGGACATTCCCTCAGTGG - Intronic
1185069076 22:48646512-48646534 CACCCAGAGCCCACCCACAGAGG - Intronic
1185223814 22:49642074-49642096 CCCCCTGGACCCACAGACAGTGG - Intronic
950423949 3:12914666-12914688 GCCCCAGGACACATGCACACAGG - Intronic
950541409 3:13615391-13615413 TGCCCAGGACAAATCCACAGGGG - Intronic
950902792 3:16512925-16512947 CTCCCAGGGCACACGCAGAGGGG + Intronic
950923168 3:16715721-16715743 CCCCCAGGAGACAAGCAAAGTGG - Intergenic
951221879 3:20077300-20077322 CTCCCAGGCTACACACACAGTGG - Intronic
954623531 3:52009586-52009608 CCCCCAGAACCCACCCACTTGGG - Intergenic
954794381 3:53154176-53154198 CCCACAGAGCACACCCACGGAGG + Intergenic
955905799 3:63806326-63806348 ATCCCAGGAAACACCCAGAGTGG - Intergenic
956793317 3:72696957-72696979 TCCTCAGGACACAGCAACAGTGG + Intergenic
959070992 3:101701945-101701967 CCTCCTGGCCAAACCCACAGAGG + Intergenic
960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG + Intronic
960549361 3:118956940-118956962 GCCCCACAACACACTCACAGAGG - Intronic
960954666 3:123023695-123023717 TCCCCCAGACAAACCCACAGGGG + Intronic
961818983 3:129565643-129565665 CTCGCAGGACCCACCCACACAGG - Intronic
961819169 3:129566498-129566520 ACCCCACGACCCACACACAGTGG - Intronic
961907402 3:130276858-130276880 CACCCAGGCCAGAACCACAGGGG - Intergenic
962375940 3:134858808-134858830 CAGCCAGGACAGCCCCACAGTGG + Intronic
963171311 3:142253871-142253893 CCTCCAGGACACAGCAAAAGTGG + Intergenic
965834709 3:172838582-172838604 CCCACAGGACTCAGCAACAGTGG - Intergenic
966780514 3:183580184-183580206 CCCTCAGCATACTCCCACAGGGG + Intergenic
967147819 3:186620831-186620853 CCCCCGGAAAACACGCACAGTGG + Exonic
1202741428 3_GL000221v1_random:59843-59865 CCCCCCACACACAGCCACAGTGG - Intergenic
968704182 4:2070326-2070348 CACCCAGGACCCACACACATGGG + Intergenic
968928886 4:3565671-3565693 CCCCCAGGTCACAGCCAAAGGGG + Intergenic
969115630 4:4869157-4869179 CCCCCACCACACACACACAAAGG - Intergenic
969476756 4:7426388-7426410 CCCCCAGGGGCCACCCTCAGCGG - Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
974199920 4:58623917-58623939 CCCCCAGGAGACAAGCAAAGTGG + Intergenic
974948061 4:68552533-68552555 CACCCATGACACAGCCTCAGGGG - Intronic
976082785 4:81375160-81375182 CCACCACCACAGACCCACAGCGG + Intergenic
977354452 4:95927300-95927322 CCCCCAACACACACACACAGAGG + Intergenic
981347944 4:143698169-143698191 CCCCCAGAAGTCACCAACAGAGG - Exonic
982658444 4:158177565-158177587 TCCCCAGGGCACACACACAAAGG + Intergenic
1202760212 4_GL000008v2_random:102786-102808 CCCCCGACACACAGCCACAGTGG + Intergenic
1202760223 4_GL000008v2_random:102843-102865 CCCCCCACACACAGCCACAGTGG + Intergenic
985494700 5:197982-198004 CCCCCAGGTCACCCCCACCCAGG + Exonic
985685270 5:1278745-1278767 CCCCCAGGACAGGCTCACGGAGG - Exonic
985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG + Intergenic
986288973 5:6383539-6383561 TCCCAGGGACACACCCACACGGG - Intergenic
986291163 5:6400215-6400237 CCCACAGGACACAACCTGAGGGG - Intergenic
986667240 5:10114364-10114386 CTCCCAGGAGACACCAAGAGGGG - Intergenic
990358929 5:54998175-54998197 CCTTTAGGAGACACCCACAGAGG + Intronic
990572666 5:57094802-57094824 CACCCCGAACACACCCACTGGGG + Intergenic
992024750 5:72659237-72659259 CCTGCAGGACGCACCCAGAGAGG + Intergenic
992151728 5:73910505-73910527 CCTCCAGGACAAACCCACCCTGG - Intronic
992193816 5:74320141-74320163 CACCCAGCACACATGCACAGTGG + Intergenic
997518356 5:134506432-134506454 CCCCCTGCACACACTCCCAGCGG - Intergenic
997557608 5:134814590-134814612 CCCCAAGAAAACACCAACAGGGG - Intronic
997878026 5:137566260-137566282 CCTCCAGGACACCCACACAGAGG + Intronic
998366684 5:141636928-141636950 CACCCAGGCCACGCCCCCAGGGG + Intronic
999298757 5:150477164-150477186 CCCCCAGGTCACACAGACAGGGG - Intergenic
1000050119 5:157555668-157555690 GCCCCAGGAAACACACACACAGG - Intronic
1001244260 5:170094173-170094195 CCCCCAGGGGAGGCCCACAGTGG - Intergenic
1002184152 5:177446597-177446619 CCGCCAGGGCACCCTCACAGGGG - Intronic
1003995904 6:11538526-11538548 CCCCCGGGACACGCGCAGAGTGG - Intronic
1005760157 6:28960643-28960665 CCCCGAGCACACACCCCCACTGG + Intergenic
1006633140 6:35443480-35443502 GCCCCAGCCCACAGCCACAGAGG - Intergenic
1007073385 6:39051990-39052012 TCCCCAACACACACACACAGAGG - Intronic
1007277949 6:40689351-40689373 CCCACTGGACACAACCACTGTGG + Intergenic
1007297341 6:40835052-40835074 TCCCCAGGAGACACCCACCTAGG + Intergenic
1008448954 6:51626949-51626971 CCCACAGGAGAGACCCACTGTGG - Intronic
1012050974 6:94343553-94343575 TCCCCAGAACCCAGCCACAGAGG - Intergenic
1013517207 6:110899362-110899384 CCTTCTGGACACACCCAAAGTGG - Intergenic
1017887503 6:158611115-158611137 CCCTCAGGAGAAACCCACTGAGG - Intronic
1017939718 6:159041051-159041073 CCCTCAGAACACACCCACCTGGG - Intronic
1018369825 6:163157357-163157379 CTCCCAGGACCCACCCTCCGAGG + Intronic
1018487069 6:164251768-164251790 CCCTGAGGACAGACCCACAATGG - Intergenic
1019164888 6:170091530-170091552 CCCCCAGGACGCTTCCAAAGAGG - Intergenic
1019350000 7:550142-550164 CCCCCAGGAGAAGCCCACAGAGG + Exonic
1019475859 7:1243968-1243990 CCCCCAGGGCACCCCCCCAGAGG + Intergenic
1020278411 7:6637804-6637826 CCCCCAGGACACACCCATCCAGG + Intronic
1023836282 7:44069785-44069807 CCCCCAACACACACACATAGTGG - Intergenic
1023962130 7:44935668-44935690 CGCCAAGGATACCCCCACAGCGG - Intergenic
1024527359 7:50360174-50360196 CCCCCAGGACACACAGAGGGTGG - Intronic
1026142568 7:67718788-67718810 TGCCCAGGACACAGCCTCAGGGG - Intergenic
1026850033 7:73718621-73718643 CCTCCCCGACACACCCAGAGAGG + Intronic
1027412426 7:77935125-77935147 CCCCCCACACACACACACAGAGG + Intronic
1028082963 7:86600362-86600384 CCCCCAGGAGACAAGCAAAGTGG + Intergenic
1029254110 7:99257432-99257454 GCCCCAGCACCCACCCTCAGTGG - Intergenic
1032011381 7:128350407-128350429 CCTCCATGTGACACCCACAGGGG - Exonic
1032695194 7:134329880-134329902 CTCCCAGGACAAACTCACAGTGG - Intergenic
1033173454 7:139104270-139104292 CCCAGAGGAAACACCCACATCGG + Intronic
1034163312 7:149007813-149007835 GGCCCAGGCCAAACCCACAGTGG + Intronic
1034329258 7:150268932-150268954 CCCCCAGGACGTGCCCACACAGG - Intronic
1034668796 7:152840928-152840950 CCCCCAGGACGTGCCCACACAGG + Intronic
1035628419 8:1090558-1090580 CCCACAGGACAAACCCCCTGTGG - Intergenic
1036177207 8:6550308-6550330 CTCCCAGGACCCACACACATAGG - Intronic
1036578032 8:10046991-10047013 CCCCCTGTACACCCCCACAAAGG - Intergenic
1036798538 8:11772924-11772946 CCCGCAACACACACACACAGAGG + Intronic
1039279545 8:35968713-35968735 TCCTCAGCACACTCCCACAGAGG - Intergenic
1039441507 8:37598453-37598475 CCCCCAGCCCCCACACACAGAGG + Intergenic
1039849239 8:41348048-41348070 CCCCCACCACACTCCCACCGTGG - Intergenic
1040615887 8:49037935-49037957 CTCACACGCCACACCCACAGTGG - Intergenic
1040618635 8:49064559-49064581 CCCCCAGGACAAGCCCACCGAGG + Intronic
1041205669 8:55495619-55495641 CCCCCAGGCCCTCCCCACAGTGG + Intronic
1041279658 8:56197507-56197529 CACCCAGTTCACACCCACAGAGG - Intronic
1044855263 8:96468726-96468748 CTCTCAGGAGACATCCACAGGGG - Intergenic
1045320005 8:101075227-101075249 GCCCCAGGTCACACCGCCAGTGG - Intergenic
1046074123 8:109296870-109296892 CCCCATGGACAGACCCACATGGG + Intronic
1047468440 8:125143069-125143091 CTCCCAGGACACCCCCAGTGTGG + Intronic
1047574909 8:126142232-126142254 CGCCCATGACACAGCCTCAGGGG - Intergenic
1049266625 8:141671119-141671141 CCCCCAGGGCAGGCCCACAGCGG - Intergenic
1049430989 8:142564819-142564841 ACCCCAGGACCCACCAGCAGAGG - Intergenic
1050144410 9:2550774-2550796 ACCCCAGGCCACCTCCACAGTGG - Intergenic
1050391344 9:5147144-5147166 CCCCCAGGAGACAAGCAGAGTGG - Intronic
1050966600 9:11811651-11811673 CCCCCAAGAAACACTCAGAGAGG - Intergenic
1053572149 9:39320437-39320459 CCCTCAGCACACACACACAATGG - Intergenic
1053623546 9:39844973-39844995 CCCTCAGCACACACACACAATGG - Intergenic
1053803595 9:41779257-41779279 CCCCCAGGTCACAGCCAAAGGGG + Intergenic
1053881323 9:42598255-42598277 CCCTCAGCACACACACACAATGG + Intergenic
1053891342 9:42696058-42696080 CCCTCAGCACACACACACAATGG - Intergenic
1054093706 9:60879148-60879170 CCCTCAGCACACACACACAATGG - Intergenic
1054115186 9:61155072-61155094 CCCTCAGCACACACACACAATGG - Intergenic
1054124996 9:61298574-61298596 CCCTCAGCACACACACACAATGG + Intergenic
1054141674 9:61535868-61535890 CCCCCAGGTCACAGCCAAAGGGG - Intergenic
1054191894 9:61990647-61990669 CCCCCAGGTCACAGCCAAAGGGG + Intergenic
1054220354 9:62405726-62405748 CCCTCAGCACACACACACAATGG + Intergenic
1054230361 9:62503446-62503468 CCCTCAGCACACACACACAATGG - Intergenic
1054461373 9:65466591-65466613 CCCCCAGGTCACAGCCAAAGGGG - Intergenic
1054592570 9:67027470-67027492 CCCTCAGCACACACACACAATGG + Intergenic
1054646486 9:67597143-67597165 CCCCCAGGTCACAGCCAAAGGGG - Intergenic
1055187226 9:73471339-73471361 CCCCCAGCACACATCCTCACTGG - Intergenic
1056026161 9:82496972-82496994 CCCCAAACACACACCCTCAGTGG - Intergenic
1056616041 9:88166896-88166918 CCCCAAGGACACATACACAATGG + Intergenic
1057215812 9:93228185-93228207 CCCACAGCACACACCCTCATGGG - Intronic
1057481619 9:95449223-95449245 CCGCCCGGCCACACGCACAGCGG - Exonic
1057571475 9:96207310-96207332 GCCCCCGGACACAGCCTCAGGGG + Intergenic
1057826163 9:98373567-98373589 GGACCAGGACACACCCAGAGGGG + Intronic
1059807222 9:117815478-117815500 CACCCAGGTCAAACCCACAGAGG - Intergenic
1060983275 9:127805800-127805822 GCCCCAGGGCAAAGCCACAGTGG - Intronic
1061306016 9:129733878-129733900 CTCCCAGGATACACACACAGAGG + Intergenic
1061521484 9:131120814-131120836 CACCCAGGACACAGCCACTCGGG + Exonic
1061572256 9:131485039-131485061 CCCGCTGGAGGCACCCACAGAGG - Exonic
1061715042 9:132513739-132513761 CCCCGAGGACCCTCGCACAGGGG - Intronic
1061808384 9:133148888-133148910 GCCCCAGCCCACACCCACCGGGG - Intronic
1061953428 9:133949195-133949217 CCTCCAAGTCAGACCCACAGAGG + Intronic
1062289809 9:135789445-135789467 CCCCCATCCCACACACACAGCGG + Intronic
1062316291 9:135968663-135968685 GCCCCAGGACCCTCCTACAGCGG - Intergenic
1062320933 9:135990255-135990277 GCCCCAGGCCAGGCCCACAGCGG - Intergenic
1062577562 9:137215673-137215695 CTCCCAGGCCGCACCCAGAGGGG - Exonic
1203794721 EBV:170140-170162 CCCCCAGGAAAGACCCCCGGGGG + Intergenic
1203795113 EBV:171201-171223 CCCCCAGGAAAGACCCCCGGGGG + Intergenic
1203795314 EBV:171739-171761 CCCCCAGGAAAGACCCCCGGGGG + Intergenic
1203710066 Un_KI270742v1:89767-89789 CCCCCCACACACAGCCACAGTGG - Intergenic
1203540988 Un_KI270743v1:87680-87702 CCCCCGACACACAGCCACAGTGG + Intergenic
1203540999 Un_KI270743v1:87737-87759 CCCCCCACACACAGCCACAGTGG + Intergenic
1185650276 X:1642504-1642526 TCCCCATCACACACACACAGAGG - Intronic
1186214060 X:7280399-7280421 TCAGCAGGGCACACCCACAGTGG + Intronic
1186998682 X:15151970-15151992 CTCCCAGCAGACACCCACAGTGG + Intergenic
1188375504 X:29423228-29423250 CCCCCACAACACACACACAATGG + Intronic
1189959033 X:46307340-46307362 CCTACAGCACACACCCACTGGGG - Intergenic
1193467789 X:81868864-81868886 CACCCAGGACCCAGCCTCAGAGG + Intergenic
1194016267 X:88625147-88625169 CCCCGAGAACCCACCCACTGTGG - Intergenic
1195346328 X:103954089-103954111 CCCCCAGGAGACAAGCAAAGTGG + Intronic
1195361125 X:104084756-104084778 CCCCCAGGAGACAAGCAAAGTGG - Intergenic
1198091431 X:133334676-133334698 GCCCCAGGTCACAGTCACAGTGG + Intronic
1199999227 X:153048851-153048873 CCCCCAGGACAAACACCAAGGGG + Intergenic
1200065085 X:153500401-153500423 CCCTGAAGACACACCCAGAGAGG + Intronic
1200158136 X:153988915-153988937 CCCCCAGGACCAACGCAGAGAGG - Intergenic
1200960821 Y:8994284-8994306 CCACCAGCGCACCCCCACAGAGG - Intergenic
1201354156 Y:13080374-13080396 CACCCATGACACACCTACTGAGG + Intergenic