ID: 1102064802

View in Genome Browser
Species Human (GRCh38)
Location 12:109965451-109965473
Sequence CTGATACCTACTCTGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102064802 Original CRISPR CTGATACCTACTCTGAATGC AGG (reversed) Intronic
902530212 1:17086080-17086102 GTTATACCAACTCTGACTGCAGG - Intronic
903424465 1:23243698-23243720 CTGAGACCTACTCTGCAGGTTGG + Intergenic
907866467 1:58404178-58404200 CGGGGACCTACTCAGAATGCAGG + Intronic
911319469 1:96395262-96395284 CAGAGACCCAATCTGAATGCAGG + Intergenic
1063874421 10:10458116-10458138 CTGGTAACTTCTCTGAATGCTGG + Intergenic
1066615913 10:37294900-37294922 TTGGTTCCTAGTCTGAATGCTGG + Intronic
1072086900 10:92088566-92088588 CTGATAGTTATTCTGAATACAGG - Intronic
1072303545 10:94085402-94085424 CTGAGATCTACTCTGAACTCCGG + Intronic
1075533212 10:123247963-123247985 CTGCTATCTGCTCTGAAAGCAGG - Intergenic
1075646537 10:124100553-124100575 CTGAGTCCGACTCTGAAGGCAGG + Intergenic
1078396026 11:10982929-10982951 CTGATACCACCTTTTAATGCAGG - Intergenic
1079763868 11:24365286-24365308 CTGATACCTACTTTAAAGCCAGG - Intergenic
1082142897 11:48630594-48630616 TTGATACATTCTCTGAATCCTGG + Intergenic
1082570095 11:54727959-54727981 TTGATACCTCCTCTGAATCCTGG + Intergenic
1088989278 11:114937744-114937766 CTGACACCTACTCTGGATGTGGG + Intergenic
1090590861 11:128266317-128266339 TTGTTACCTACTCTGTGTGCAGG + Intergenic
1096647113 12:53044910-53044932 TTGATTCCTACTCTCAATGTGGG - Intergenic
1097722531 12:63038844-63038866 CTGATAGGTACCCTGAGTGCTGG + Intergenic
1102064802 12:109965451-109965473 CTGATACCTACTCTGAATGCAGG - Intronic
1105335493 13:19463838-19463860 CTGAGAACTAATCTGAATGATGG - Intronic
1107116853 13:36756206-36756228 TTGATACATACTCTGAATGTTGG + Intergenic
1111383458 13:87491737-87491759 CTGAGACCAAGTCTGAAGGCAGG + Intergenic
1113128837 13:107011739-107011761 AAGAAACCTACTCTGAATGAAGG + Intergenic
1117028648 14:51647779-51647801 TTAAAACATACTCTGAATGCTGG + Intronic
1202849634 14_GL000225v1_random:8792-8814 CTGAAACCAAATCTGAATACTGG - Intergenic
1129125621 15:73438464-73438486 CTTCTCCCTCCTCTGAATGCTGG + Intergenic
1130048299 15:80462980-80463002 ATGATACCTACTCACAAAGCAGG - Intronic
1131986373 15:98046034-98046056 CTGAAACTTACTCTAAAGGCTGG + Intergenic
1138989119 16:62369160-62369182 CTGATTCTTGGTCTGAATGCTGG + Intergenic
1140328745 16:74031183-74031205 CTTAGAACTACTCTGAATTCAGG + Intergenic
1144792273 17:17867123-17867145 CTGATGCCCACTCTGGGTGCTGG - Intronic
1146214703 17:30970046-30970068 CTGATACCTACTTTGAGCCCAGG + Intronic
1154083059 18:11276861-11276883 CTGACACCTGCTGTGAGTGCTGG - Intergenic
928289849 2:30027555-30027577 CTGATACATTCTTTGAAAGCAGG - Intergenic
928976258 2:37089629-37089651 CTGATATCTTCTCTGAATAAGGG - Exonic
930173691 2:48278861-48278883 CTGTTACCTATTCTGAATTTAGG - Intergenic
930231421 2:48847596-48847618 CTGATATATACTGGGAATGCAGG - Intergenic
930655543 2:54003748-54003770 CTGATACCAAATGTGACTGCTGG + Intronic
932292034 2:70589963-70589985 GTGAGACCTACTGTGAATACAGG + Intergenic
938797987 2:134734767-134734789 CTGATACGTGCTCTGAAAGAGGG - Intergenic
940184568 2:150969195-150969217 TTGTCACCTACTCTGAAGGCTGG - Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940957189 2:159740844-159740866 CTAATACATCCCCTGAATGCAGG + Intronic
942042907 2:172082762-172082784 GTGACACCTGTTCTGAATGCCGG - Intergenic
943334821 2:186600656-186600678 CTGATTCCTGCTCTTAATGGAGG - Intronic
1171905427 20:30895310-30895332 CTGATACGAAATCTGAATCCTGG + Intergenic
1173328064 20:42051584-42051606 CTGACAACCACTCTGACTGCTGG - Intergenic
1176738083 21:10571146-10571168 CTGAGAACTAATCTGAATGATGG + Intronic
1182942705 22:34293061-34293083 CTTATTCCTATTCTGAATACAGG - Intergenic
1184612611 22:45614456-45614478 CTCATACCTCCTCTGAATCTGGG + Intergenic
949095364 3:79336-79358 CTGATACTAACTCTGAGAGCTGG - Intergenic
958733575 3:97985138-97985160 CCGATACCTATTTTGATTGCTGG - Intergenic
959728124 3:109568870-109568892 CTGATACCAACTCAGCAGGCAGG + Intergenic
966698667 3:182820562-182820584 CTGACAGCTACTCTGGAGGCTGG + Intronic
972869706 4:43282487-43282509 CTGACCCCTACTCCAAATGCTGG + Intergenic
975652335 4:76606379-76606401 ATGTTAGCTACTCTGAATGTTGG + Intronic
976339674 4:83933222-83933244 CTGAGACCTATTCTGAATCAAGG - Intergenic
979715613 4:123833724-123833746 CTACTATCTTCTCTGAATGCTGG - Intergenic
985269284 4:188179044-188179066 CTGCCAGCTGCTCTGAATGCAGG - Intergenic
985327821 4:188792633-188792655 CTTTTAACTTCTCTGAATGCAGG - Intergenic
990579297 5:57152589-57152611 CTGAAACTTACTCAGATTGCAGG + Intergenic
998595919 5:143530280-143530302 CTGATACCAACTCAAAATGAGGG + Intergenic
1003097095 6:3150907-3150929 GGGAGACCTGCTCTGAATGCTGG - Intronic
1003166595 6:3684617-3684639 CTGATATCTTCTGTGAATGGGGG + Intergenic
1008019920 6:46564853-46564875 ATGCTACCTTCTCTGAATTCCGG - Intronic
1012954645 6:105555975-105555997 CTGGTTCCTACTGTGAATGACGG - Intergenic
1014722953 6:124940175-124940197 CTGTTTCCTTCTCTGAATCCAGG - Intergenic
1023766408 7:43515152-43515174 CTGACATCTGCTGTGAATGCTGG - Intronic
1029406518 7:100377666-100377688 CTGAAACCTCCTCTGACTCCCGG - Intronic
1030333357 7:108296617-108296639 CTGATATCAAATATGAATGCAGG + Intronic
1031643508 7:124194391-124194413 CTGAAACCTAATGTGATTGCTGG + Intergenic
1036212348 8:6852653-6852675 CTGAGCCCTACTGTCAATGCAGG - Intergenic
1036679556 8:10861158-10861180 CTAATACCTTCTGTGTATGCTGG + Intergenic
1036964663 8:13283431-13283453 CTGATACCAACTCTGCATATGGG + Intronic
1043247755 8:78027087-78027109 ATGATACCCTCTCTCAATGCTGG + Intergenic
1059628485 9:116093146-116093168 CTAATACATACTCTGAATTTAGG - Intergenic
1187378001 X:18774463-18774485 ATGCTATCTTCTCTGAATGCAGG + Intronic
1196222800 X:113131442-113131464 CTGATCCCTACTCTAAAGGATGG - Intergenic
1199331876 X:146570933-146570955 CTGATACCTACTTTTTATGGTGG + Intergenic
1199430643 X:147756181-147756203 CTGACACCTCTTCAGAATGCAGG + Intergenic