ID: 1102069319

View in Genome Browser
Species Human (GRCh38)
Location 12:110004132-110004154
Sequence ATGGAGTCTCATACTGTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 26, 3: 91, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102069319_1102069321 6 Left 1102069319 12:110004132-110004154 CCGGCAACAGTATGAGACTCCAT 0: 1
1: 0
2: 26
3: 91
4: 356
Right 1102069321 12:110004161-110004183 AAAAAAATAAATTTTTTTTAAGG 0: 1
1: 15
2: 115
3: 869
4: 5303
1102069319_1102069322 26 Left 1102069319 12:110004132-110004154 CCGGCAACAGTATGAGACTCCAT 0: 1
1: 0
2: 26
3: 91
4: 356
Right 1102069322 12:110004181-110004203 AGGCTTTTGAGCAAGAAAAGTGG 0: 1
1: 0
2: 0
3: 35
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102069319 Original CRISPR ATGGAGTCTCATACTGTTGC CGG (reversed) Intronic
901886193 1:12224968-12224990 ATGGAGTCTTGCTCTGTTGCAGG + Intergenic
904464165 1:30698252-30698274 ATAGTGAGTCATACTGTTGCTGG - Intergenic
904552530 1:31331634-31331656 ATGGAGTCTCGCTCTGTTGCCGG + Intronic
904750504 1:32738965-32738987 ATGGAGTCTCACACTGTCACCGG + Intergenic
905014572 1:34768492-34768514 ACGGAGTCTCGCTCTGTTGCCGG - Intronic
905804417 1:40865429-40865451 ATGGAGTCTCACTCTGTCGCTGG - Intergenic
906131456 1:43460971-43460993 ATGGAGTCTCACTCTGTCCCAGG - Intergenic
906750622 1:48256005-48256027 ATTTATTCTCTTACTGTTGCTGG - Intergenic
906954917 1:50366065-50366087 ATGGTATCTATTACTGTTGCTGG - Intergenic
906990411 1:50731392-50731414 ATGGAGTCTCACTCTGTCCCCGG + Intronic
909616834 1:77620355-77620377 ATGAATTCTTATACTGTAGCTGG - Intronic
910574830 1:88749378-88749400 ACGGAGTCTCGCACTGTCGCCGG - Intronic
911069216 1:93819089-93819111 ATGGAGTCTCACTCTGTTGCCGG + Intronic
911397319 1:97327042-97327064 TTGGTGTCTCAGACAGTTGCTGG - Intronic
911419094 1:97616908-97616930 ACGGAGTCTCCCTCTGTTGCCGG + Intronic
911433952 1:97830682-97830704 ATGGAGTCTCACTCTGTCCCCGG - Intronic
911685107 1:100766456-100766478 ATGGAGTGTTCTACTGTTTCAGG + Intergenic
911894951 1:103421554-103421576 ACAGAGTCTCACTCTGTTGCAGG - Intergenic
912393953 1:109325260-109325282 ATGGAGTCTCACTCTGTCACCGG + Intronic
912604860 1:110979750-110979772 ATGGAGTCTTGCACTGTCGCTGG + Intergenic
912916298 1:113818187-113818209 ATGGAGTCTCGCTCTGTTGCCGG + Intronic
913564540 1:120059011-120059033 CTGAAGTCTAATACTGTTTCTGG - Intronic
913633590 1:120734553-120734575 CTGAAGTCTAATACTGTTTCTGG + Intergenic
913970560 1:143412556-143412578 ATGGAGTCTCACACTATCACCGG + Intergenic
914064935 1:144238167-144238189 ATGGAGTCTCACACTATCACCGG + Intergenic
914114216 1:144728187-144728209 ATGGAGTCTCACACTATCACCGG - Intergenic
914244971 1:145878700-145878722 AAGGAATCTCAGACTATTGCAGG + Intronic
914285127 1:146218360-146218382 CTGAAGTCTAATACTGTTTCTGG - Intronic
914317385 1:146526629-146526651 CTGGAGTTTCATACTGTTTAAGG - Intergenic
914496971 1:148206731-148206753 CTGGAGTTTCATACTGTTTAAGG + Intergenic
914546158 1:148669099-148669121 CTGAAGTCTAATACTGTTTCTGG - Intronic
914620406 1:149401566-149401588 CTGAAGTCTAATACTGTTTCTGG + Intergenic
917250410 1:173053444-173053466 ACGGAGTCTCACTCTGTCGCCGG - Intergenic
918074205 1:181158217-181158239 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
919415667 1:197305939-197305961 ATTGAGACTGATAATGTTGCAGG - Intronic
920151765 1:203915387-203915409 ATGGAGTCTTGCTCTGTTGCCGG + Intergenic
920334364 1:205234683-205234705 ATGGAATCTCATTCTGTCTCAGG + Intronic
920906623 1:210175839-210175861 ATGGGGTCTCACTCTGTCGCCGG + Intergenic
920929847 1:210376949-210376971 ATGGAGTCCCAAAATGTTGGAGG - Intronic
921168007 1:212521047-212521069 ATGGAGTCCCACTATGTTGCTGG - Intergenic
923182268 1:231530862-231530884 ATGGAGTCTCATTCTGTCGCCGG - Intronic
923185925 1:231573395-231573417 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
923239154 1:232063596-232063618 ACAGAGTCTCATATTGTTACCGG + Intergenic
923248008 1:232152258-232152280 ATGGATTCTCATATTATTGTGGG - Intergenic
924077622 1:240357630-240357652 ACGGAGTCTCGCACTGTTACCGG + Intronic
924228009 1:241938443-241938465 ATGGAGTCTTGCTCTGTTGCTGG + Intergenic
924682374 1:246250877-246250899 TTTGAGTCTCAAAATGTTGCTGG - Intronic
924784992 1:247186589-247186611 ATGGAGTCTCGCTCTGTTGCTGG - Intergenic
1062945305 10:1456816-1456838 ACAGAGTCTCGCACTGTTGCTGG + Intronic
1063207451 10:3847520-3847542 ATGGAGTCTCACTGTGTTGGAGG + Intergenic
1064269511 10:13852266-13852288 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
1064820917 10:19331889-19331911 ACGGAATCTCACTCTGTTGCAGG + Intronic
1064979088 10:21148548-21148570 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1065760822 10:28981801-28981823 ATGCAGTATTATGCTGTTGCGGG - Intergenic
1066138490 10:32477231-32477253 ATGGAGTCTCGCTCTGTCGCTGG + Intronic
1068257305 10:54529589-54529611 ATGAATCCTCTTACTGTTGCTGG + Intronic
1068753557 10:60624376-60624398 ATGTTGTCACACACTGTTGCTGG + Intronic
1069380209 10:67835663-67835685 ATGGAGTCTCACTCTGTTGCCGG - Intronic
1070040922 10:72778992-72779014 ATGGAGTCTCACTCTGTTGCTGG + Intronic
1071761693 10:88615602-88615624 GTGGAGTCTCACACTGTTGCTGG - Intergenic
1072226071 10:93370339-93370361 ACAGAGTCTCACTCTGTTGCTGG + Intronic
1073410284 10:103335940-103335962 ATGGAGTCTCGCACTGTCACCGG - Intronic
1075003756 10:118816179-118816201 ACGGAGTCTCACACTGTCACAGG - Intergenic
1075216585 10:120541796-120541818 ATGGAGTCTCGCACTGTTGCTGG + Intronic
1075684208 10:124352872-124352894 ATGGAGCCTCGCACTGTTGCTGG - Intergenic
1075833408 10:125430456-125430478 ACAGAGTCTCACTCTGTTGCCGG - Intergenic
1076708509 10:132316975-132316997 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1076812306 10:132893653-132893675 TGGGGGTCTCACACTGTTGCGGG - Intronic
1077602639 11:3584087-3584109 ATGGAGTCTCGTTCTGTCACCGG - Intergenic
1078141492 11:8696468-8696490 ATGGAGTCTCAGATGTTTGCTGG - Exonic
1078366511 11:10711075-10711097 ATGGAGTCTCACTCTGTCACAGG + Intergenic
1079330498 11:19528903-19528925 ATGGAGTCTCACTCTGTCACCGG - Intronic
1079554428 11:21741127-21741149 ACAGAGTCTCACTCTGTTGCCGG - Intergenic
1080467830 11:32514571-32514593 ATGGAGTCTCGCTCTGTTGCTGG - Intergenic
1080612729 11:33918682-33918704 ACGGAGTCTCGCACTGTCGCAGG + Intergenic
1081719750 11:45279778-45279800 ATGGATTCTCAGACTTTTACAGG - Intronic
1082840561 11:57685995-57686017 ATGTAGTCTCACACTGTCGCTGG - Intronic
1083410247 11:62487531-62487553 ACGGAGTCTCGCACTGTCGCCGG + Intronic
1084258527 11:67958633-67958655 ATGGAGTCTTGTTCTGTCGCCGG - Intergenic
1084621928 11:70277933-70277955 ATGGAGTCTCGCTCTGTCGCCGG + Intronic
1084814214 11:71636575-71636597 ACGGAGTCTCGTTCTGTTGCCGG + Intergenic
1085412740 11:76301258-76301280 ATGGAGTCTCACTCTGTCTCAGG - Intergenic
1086200444 11:84195186-84195208 ATGGAGTCCCACTCTGTTGCCGG + Intronic
1086336056 11:85801842-85801864 ATGGAGTCTTACACTGTCGCTGG + Intronic
1086736646 11:90314859-90314881 ATGGCTTCTGATACTGTTACTGG - Intergenic
1087782432 11:102315557-102315579 ATGCAGTCTCACTCTGTTCCAGG + Intergenic
1089229470 11:116959291-116959313 ACAGGGTCTCATTCTGTTGCTGG - Intronic
1089335398 11:117719584-117719606 ATGGAGTCAGGTACTGTTACTGG + Intronic
1090349594 11:126099295-126099317 ACGGAGTCTTATACTGTCACTGG + Intergenic
1090640908 11:128728139-128728161 ATGGAGTCTGATAGTGCAGCAGG + Intronic
1092048647 12:5452118-5452140 ACGGAGTCTCACTCTCTTGCCGG + Intronic
1093841211 12:23903391-23903413 ATGGAGTCTCCCAGTTTTGCAGG - Intronic
1094604678 12:31940113-31940135 ACGGAGTCTCACACTGTTGCAGG - Intergenic
1096221317 12:49829815-49829837 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
1096472970 12:51890457-51890479 ATAGAGTCCCATCCTGTTGAAGG - Intronic
1097145756 12:56938358-56938380 ACAGATTCTCATACTGTTGGAGG + Intergenic
1097151317 12:56981896-56981918 ACAGATTCTCATACTGTTGGAGG + Intergenic
1097203717 12:57302249-57302271 ATGGAGTCTTACTCTGTAGCCGG - Intronic
1097673529 12:62570755-62570777 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1097834180 12:64256979-64257001 ACGGAGTCTCGCATTGTTGCTGG - Intergenic
1098134710 12:67389976-67389998 ATGGAGTCTAGCACTGTCGCCGG - Intergenic
1098473730 12:70874895-70874917 ATGGAGTCTCACTCTGTCACTGG - Intronic
1099201333 12:79680922-79680944 ATGGGGTCTCAGTATGTTGCTGG - Intronic
1099977007 12:89556645-89556667 TTGGAGTCTCATTCTGTCACTGG + Intergenic
1101158260 12:101947889-101947911 ATGAAGTCTCACTCTGTTGCTGG - Intronic
1101597011 12:106176958-106176980 ACAGAGTCTCACTCTGTTGCTGG + Intergenic
1102012996 12:109630536-109630558 ATGGGGTCTCACTGTGTTGCTGG + Intergenic
1102069319 12:110004132-110004154 ATGGAGTCTCATACTGTTGCCGG - Intronic
1102282311 12:111628009-111628031 ATGGGGTCTCACTATGTTGCTGG + Intergenic
1102312939 12:111861352-111861374 ATGGAGTCTCACTCTGTCACAGG + Intronic
1102339697 12:112111907-112111929 ATGGAGTCTCACTCTGTTGCAGG - Intergenic
1103444229 12:120983567-120983589 ATGGAGTCTCACTCTGTTGCTGG + Intronic
1103821611 12:123703208-123703230 ATGGAGTCTCACTTTGTTGCTGG + Intronic
1105030102 12:132876148-132876170 ATGGAGTTTCACTGTGTTGCAGG - Intronic
1105726693 13:23169652-23169674 ATGGAGTCTCTCTCTGTTGCTGG - Intergenic
1105896702 13:24722463-24722485 ATGGAGTCTCACTCTGTCGCAGG - Intergenic
1106405744 13:29471311-29471333 ATGGAGTCTCGCTCTGTTGCTGG - Intronic
1106504814 13:30361651-30361673 ACGGAGTCTCACTCTGTTGCCGG - Intergenic
1106539208 13:30674920-30674942 ATGGAGTCTTGCCCTGTTGCTGG + Intergenic
1106624956 13:31410914-31410936 ATGGAGTCTCGCTCTGTCGCCGG + Intergenic
1107408061 13:40133444-40133466 ATGGAGTCTCGTTCTGTCACCGG - Intergenic
1108084157 13:46767560-46767582 ATAGAGTCTCAGTCCGTTGCTGG + Intergenic
1108444948 13:50498750-50498772 ATGGAGTCTCGCTCTGTTGCTGG - Intronic
1108834054 13:54518384-54518406 ATGGAGTCTCACTCTGTCCCAGG - Intergenic
1108963798 13:56271260-56271282 ATGGAGTCTCACTCTGTCCCAGG - Intergenic
1109108798 13:58290009-58290031 ACGGATTCTCACTCTGTTGCGGG + Intergenic
1110460095 13:75735484-75735506 ATGGAGTCTCACTCTGTCGCTGG + Intronic
1111924508 13:94448056-94448078 ATGGGGTCTCACTCTGTTGCTGG - Intronic
1113143741 13:107184000-107184022 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1113537877 13:111082468-111082490 ATGAAGTCTCACACTGCTCCAGG - Intergenic
1114187071 14:20410845-20410867 ACGGAGTCTCACTCTATTGCTGG + Intronic
1115952140 14:38733247-38733269 ATGGAGGCTCAAAGTGCTGCAGG + Intergenic
1116161105 14:41267805-41267827 ATTTAGTCTCATACTGATTCTGG - Intergenic
1118648510 14:67865259-67865281 ATGGAGTCTTGCTCTGTTGCCGG + Intronic
1119360091 14:74042068-74042090 ATGGGGTCTCATTATGTTGCTGG + Intronic
1119412911 14:74446640-74446662 ATGGAGTCTCATTCTTTCCCAGG + Intergenic
1121031003 14:90658793-90658815 ATGGTGTCTCATAGTGGGGCTGG - Intronic
1121323333 14:93005552-93005574 ATGGAGTCACAGAGTGTTGGAGG - Intronic
1122172357 14:99887473-99887495 ATGGAGCCTCATTCTGCAGCTGG + Intronic
1122424406 14:101597341-101597363 ATGGAGCCTCACTCTGTTGCTGG + Intergenic
1122712554 14:103670359-103670381 ATGGAGTCTCGTTCTGTCACCGG + Intronic
1122737356 14:103850508-103850530 ACGGAGTCTCACTCTGTTGCCGG - Intergenic
1122752537 14:103948863-103948885 ATGGAGTCTCACTCTGTCACAGG - Intronic
1122758450 14:104001631-104001653 ACGGAGTCTCACTCTGTCGCTGG + Intronic
1124390626 15:29253470-29253492 ATGGAGTCTCACTCTGTCGCTGG + Intronic
1124908086 15:33891077-33891099 ACAGAGTCTCACTCTGTTGCTGG - Intronic
1125039511 15:35167972-35167994 ATCTAGTCTAATTCTGTTGCTGG + Intergenic
1125316448 15:38437536-38437558 ACGGAGTCTTGAACTGTTGCTGG + Intergenic
1126140921 15:45437964-45437986 GTGGAGTCTCACTCTGTCGCAGG - Intronic
1126525178 15:49646081-49646103 ATGGAGTCTCATGCTCCAGCAGG - Exonic
1126860485 15:52878100-52878122 ATCAAGTCTCATGCTGTTGTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1128354185 15:66913053-66913075 ATGGAGTCTCGCACTGTCCCCGG + Intergenic
1128934028 15:71730314-71730336 GTGGATTCTCATTCTGCTGCTGG + Intronic
1129197325 15:73976817-73976839 ATGGAGTCTCGCTCTGTTGCTGG + Intergenic
1129626416 15:77204878-77204900 ACAGAGTCTCACTCTGTTGCCGG - Intronic
1129737867 15:77975917-77975939 CTGGAGTTTCCTACAGTTGCAGG + Intergenic
1129995077 15:79997477-79997499 ATGGAGTCTCGCTCTGTTGCCGG - Intergenic
1130617583 15:85426977-85426999 ACGGAGTCTCACACTGTCACCGG + Intronic
1130662795 15:85843785-85843807 ATGGAGTCCCATTCCGTTCCAGG - Intergenic
1131589515 15:93732881-93732903 ATGGGGTCTCACTATGTTGCTGG + Intergenic
1131630455 15:94170940-94170962 ATGGAGTCTCGCTCTGTTGCCGG - Intergenic
1132202707 15:99965815-99965837 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
1132299008 15:100765087-100765109 ATTGAGGCTGATACTGTTGGTGG - Intergenic
1132457218 16:30813-30835 CTGGACTGTCATCCTGTTGCGGG - Intergenic
1132611757 16:820379-820401 ATGGAGTCTCACTCTGTCACCGG + Intergenic
1133957198 16:10454383-10454405 ATGGAGTCTCACACTGTCACTGG - Intronic
1135021047 16:18963246-18963268 ATGGGGTCTCACTATGTTGCTGG + Intergenic
1135506431 16:23040859-23040881 AGACAGTCTCATTCTGTTGCCGG - Intergenic
1135592418 16:23713731-23713753 ATGGGGTCTCACTATGTTGCTGG - Intergenic
1135635174 16:24069549-24069571 ATGGGGTCTCACTATGTTGCAGG - Intronic
1135863086 16:26075166-26075188 ACAGAGTCTCACTCTGTTGCCGG - Intronic
1135866946 16:26111990-26112012 GTGGAGTCTCACTCTGTCGCCGG - Intronic
1136015356 16:27395978-27396000 ATGGAGTCTCACTCTGGTGCAGG - Intergenic
1137832835 16:51560540-51560562 TTGGAGTCTCATATATTTGCGGG - Intergenic
1138479330 16:57291533-57291555 ATGGAGTCTCCCTCTGTCGCCGG + Intergenic
1139407654 16:66731796-66731818 CTGGAGAATCATAGTGTTGCTGG - Intronic
1139688006 16:68619279-68619301 ATGGGGTCTCACTATGTTGCCGG - Intergenic
1139716084 16:68814208-68814230 ACGAAGTCTCACTCTGTTGCCGG - Intronic
1139929349 16:70512950-70512972 ACGGAGTCTCACTCTTTTGCCGG - Intronic
1140016746 16:71194384-71194406 ACGGAGTCTCACTCTGTTGCTGG - Intronic
1142838632 17:2609197-2609219 ATGGGGTCTCACTCTGGTGCTGG + Intronic
1143821738 17:9569920-9569942 ATGGAGTCTCACAGTGTCGCCGG - Intronic
1144487452 17:15678899-15678921 ACGGAGTCTCACTCTGTTGCTGG + Intronic
1144913583 17:18703405-18703427 ACAGAGTCTCACTCTGTTGCTGG - Intronic
1146242958 17:31247168-31247190 ATGGAGTCTTGCTCTGTTGCCGG - Intronic
1147413728 17:40273329-40273351 ATAAAGTCTCAAACTGTGGCTGG - Intronic
1147756502 17:42771928-42771950 ACGGAGTCTTGCACTGTTGCCGG - Intergenic
1148013517 17:44504565-44504587 ACGGAGTCTCGCACTGTCGCCGG + Intergenic
1148066803 17:44877002-44877024 ATGGGGTCTCGCTCTGTTGCCGG - Intronic
1148624383 17:49057765-49057787 ATGGAGTTTCGTTCTTTTGCAGG + Intergenic
1148910154 17:50938024-50938046 ATGGGATCTCACTCTGTTGCCGG - Intergenic
1149026311 17:52031173-52031195 ATGGAGTCTCACTCTCGTGCAGG + Intronic
1149039939 17:52176056-52176078 ATGGAATCTCACTCTGTTGCTGG + Intergenic
1149286871 17:55174996-55175018 ATGGAGTCTCGCTCTGTCGCAGG - Intergenic
1149340187 17:55677662-55677684 TTGGAGTCTCTTACTGCTGCAGG + Intergenic
1149702855 17:58669758-58669780 ATGAAGTCTCAAGCTGTTGCTGG - Intronic
1149817201 17:59737009-59737031 ATGGAGTCTTACTCTGTTGCTGG - Intronic
1150237425 17:63604310-63604332 ATGGAGTCTCACTCTGTTGCTGG - Intronic
1150247573 17:63687908-63687930 ATGGAGTCTCGCTCTGCTGCCGG - Intronic
1150481905 17:65517244-65517266 ATGGAGTCTCGCTCTGTTGCTGG + Intergenic
1150589890 17:66553003-66553025 ACAGAGTCTCACTCTGTTGCTGG + Intronic
1150735390 17:67732596-67732618 ATGGAGTCTTACTCTGTTGCAGG + Intronic
1150753888 17:67892920-67892942 ATGGGGTCTTACACTGTAGCTGG + Intronic
1151204563 17:72496672-72496694 ATGGAGACTCTTACTCATGCTGG - Intergenic
1151844511 17:76642897-76642919 ACGGAGTCTCACTCTGCTGCCGG - Intronic
1152144188 17:78558194-78558216 CTGGAATCTCTTTCTGTTGCTGG + Exonic
1152961210 18:81575-81597 CTGGACTGTCATCCTGTTGCAGG - Intergenic
1153111052 18:1588183-1588205 ATGGAGTCTCGCACTGTCACGGG + Intergenic
1153225421 18:2896197-2896219 ATGGAGTCTCCCTTTGTTGCTGG + Intronic
1153664569 18:7357380-7357402 ATGGAGTCTCACACTGTCGCCGG - Intergenic
1153882386 18:9432701-9432723 ACGGAGTCTCGCACTGTCGCTGG - Intergenic
1156408163 18:36802650-36802672 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
1157062974 18:44314888-44314910 ACAGAGTCTGATTCTGTTGCCGG + Intergenic
1157942320 18:51942768-51942790 ATGGAGTCTCACACTGTCACTGG + Intergenic
1157997712 18:52578954-52578976 ACGGAGTCTCACTCTGTTGCTGG - Intronic
1158503294 18:58022743-58022765 ATGAAGTCTCACACTGTCCCCGG - Intergenic
1158867777 18:61654551-61654573 ATGGAGTCTCATAAGGTAGAGGG + Intergenic
1160211520 18:76884375-76884397 ATGGAGTCTCACACTGTCGCCGG - Intronic
1161197122 19:2993185-2993207 ACGGAGTCTCGCTCTGTTGCCGG - Intronic
1161204204 19:3032262-3032284 ACGGAGTCTCATTCTGTCGCTGG + Intronic
1162082666 19:8227884-8227906 ACGGAGTCTCACTATGTTGCTGG + Intronic
1162653306 19:12108229-12108251 ACGGAGTCTCACTCTGTTGCCGG + Intronic
1162689750 19:12419538-12419560 ATGGAGTCTTACTGTGTTGCTGG + Intronic
1163067985 19:14813529-14813551 ACGGAGTCTCACTCTGTCGCTGG - Intronic
1163134031 19:15296227-15296249 ATGGAGTCTCGCTCTGTCGCCGG - Intronic
1163447586 19:17356283-17356305 ATGGAGTCTCACTCTGTCGCTGG - Intronic
1163789549 19:19298470-19298492 ATGGAGTCTCACTCTGGTCCAGG - Intronic
1165764000 19:38338901-38338923 ATGGAGTCTCACTCTGTTGTTGG + Intronic
1165880387 19:39038529-39038551 ATGGAGTCTCGCTCTGTTGCCGG + Intergenic
1166044331 19:40220998-40221020 ATGGAGTCTTGCACTGTCGCCGG + Intergenic
1166549167 19:43653788-43653810 ATGGGGTCTCACTATGTTGCCGG - Intronic
1167079231 19:47267869-47267891 ACGGAGTCTCGCACTGTTGCCGG + Intronic
1167167660 19:47810229-47810251 ATGGAGTCTCACTCTGTCGCCGG - Intronic
1167815467 19:51876901-51876923 ACGGAGTCTCGCACTGTGGCTGG - Intronic
1167856035 19:52240746-52240768 ACAGAGTCTCACTCTGTTGCCGG + Intergenic
1167895942 19:52581096-52581118 ATGGAGTCTCACTCTGTCACTGG - Intronic
1168039981 19:53750618-53750640 ATGGGGTTTCACAATGTTGCCGG + Intergenic
1168162378 19:54520083-54520105 ATGGAGTCTCTCTCTATTGCAGG - Intergenic
1168561340 19:57386245-57386267 ACGGAGTCTCACTCTGTCGCTGG - Intronic
926247314 2:11131011-11131033 ACGGAGTCTCACTCTGTTGCTGG - Intergenic
926986895 2:18634493-18634515 ACAGAGTCTCGCACTGTTGCCGG + Intergenic
927665214 2:25027237-25027259 ATGGGGTCTCCTAATGTAGCCGG + Intergenic
927995397 2:27482005-27482027 ATGGAGTCTCACTCTGTCGCCGG + Intronic
928249410 2:29661932-29661954 ATGGAATCTCACTCTGTCGCTGG + Intronic
930102165 2:47611651-47611673 ATGGAGTCTCACTCTCTTCCAGG - Intergenic
931342809 2:61418102-61418124 ATGGAGTCTCACTCTATTCCAGG + Intronic
931612639 2:64119735-64119757 ATGGAATATCATACTCTTTCTGG - Intronic
932605087 2:73159978-73160000 ACGGAGTCTCATTCTGTCCCAGG - Intergenic
933066945 2:77809147-77809169 ATGGAGTCTCATTCTGTGCTCGG - Intergenic
933507869 2:83202117-83202139 ACAGAGTCTCACTCTGTTGCTGG + Intergenic
933672746 2:85024447-85024469 ATAGAGTCTCACTCTGTCGCCGG - Intronic
934175254 2:89573483-89573505 ATGGAGTCTCACACTGTCACCGG + Intergenic
934285570 2:91647842-91647864 ATGGAGTCTCACACTGTCACCGG + Intergenic
934510345 2:94934197-94934219 ATCCAGTCTCTGACTGTTGCAGG + Intergenic
934517062 2:94995326-94995348 GTGGATTCTCATAGTGTTGTGGG - Intergenic
935572524 2:104676903-104676925 ATGGAGTCTCACTCTGTTTGGGG - Intergenic
938930739 2:136084463-136084485 ATGGAGTCTCACTCTGTCACTGG + Intergenic
939145450 2:138409151-138409173 ATGGAGTCTCACTCTGTCGCTGG - Intergenic
939615728 2:144360472-144360494 ATGGAGTCTCGCTCTGTTACCGG + Intergenic
939799755 2:146695041-146695063 ATGGAGTCTTGTTCTGTCGCTGG + Intergenic
940277600 2:151955713-151955735 ATGGGGTCTCACTATGTTGCCGG - Intronic
940914725 2:159241734-159241756 ATGGAGTCTCACATTGTCGCCGG + Intronic
941026989 2:160467686-160467708 ATGGTGTATCCTACTGTTGATGG - Intronic
946971418 2:225096315-225096337 GTGGAGTCTCACACTCTCGCCGG + Intergenic
948934611 2:241154677-241154699 ATGGAGTCTCATTCTGACCCCGG - Intronic
1169229484 20:3877989-3878011 ACGGAGTCTCACACTGTTGCCGG - Intergenic
1169321494 20:4636540-4636562 AAAGAGTCTCACTCTGTTGCAGG - Intergenic
1169919005 20:10713461-10713483 ATGCAGTCTCATCCTCTGGCAGG + Intergenic
1173266972 20:41492889-41492911 ATGGAGTCTTGGTCTGTTGCTGG - Intronic
1174191071 20:48741030-48741052 ACGGAGTCTCACACTGTTGCAGG + Intronic
1174244083 20:49163165-49163187 ATGGAGTCTCGCTCTGTCGCCGG - Intronic
1174871934 20:54191059-54191081 ACAGAGTCTCGCACTGTTGCCGG - Intergenic
1176914839 21:14612207-14612229 ACGGAGTCTCACTCTGTTGCCGG - Intronic
1177435914 21:21051764-21051786 CTGGAGTCTCATACAATTGTAGG + Intronic
1177536149 21:22431153-22431175 ATGGAGTCTCATTCTGTCAATGG + Intergenic
1178116925 21:29427261-29427283 ATGGAGTCTTACTCTGTGGCTGG + Intronic
1178155404 21:29847562-29847584 ACAGAGTCTCACCCTGTTGCTGG - Intronic
1179812226 21:43879322-43879344 ATAGAGTCTCACTCTGTTGTAGG - Intronic
1179878880 21:44285361-44285383 ATGGAGGCTCAGTCTGATGCAGG - Intergenic
1180652681 22:17391825-17391847 ACGGAGTCTCACACTCTTACAGG + Intronic
1180757711 22:18174248-18174270 ACGGAGTCTCGCTCTGTTGCCGG + Intronic
1181074062 22:20363209-20363231 ACGGAGTCTCGCTCTGTTGCCGG - Intronic
1182922363 22:34091715-34091737 ATGGAGTCTCGCACTGTCACTGG + Intergenic
1182946527 22:34328013-34328035 ATGAAGTCTCACTCTGTTCCTGG + Intergenic
1183528020 22:38335787-38335809 ACGGAGGCTCACTCTGTTGCTGG - Intronic
1183621567 22:38976125-38976147 ACAGAGTCTCACACTGTCGCCGG - Intronic
1183891079 22:40929213-40929235 ACGGAGTCTCACACTGTCACCGG + Exonic
1184375630 22:44110627-44110649 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
949101666 3:153018-153040 ATGGTGTCTCATATTCTTGTGGG - Intergenic
949553956 3:5136128-5136150 ATGGGGTCTTGTTCTGTTGCAGG + Intronic
949983665 3:9521423-9521445 ACGGAGTCTCACTCTGCTGCTGG + Intronic
949984824 3:9532527-9532549 ATGGAGTCTCACTCTCTTTCTGG + Intronic
950991050 3:17437971-17437993 ATGCAGTCTATTACTATTGCTGG - Intronic
951477460 3:23123234-23123256 ATGGAGTTTCATCTTGTTGCCGG + Intergenic
951498558 3:23357739-23357761 AAGGAGTCAGATACTGTTGCTGG - Intronic
951723208 3:25724347-25724369 AAGGAATCTCAAATTGTTGCTGG + Intronic
953165018 3:40457361-40457383 ATGGTGAGTCTTACTGTTGCGGG + Exonic
954332759 3:49899597-49899619 ACGGAGTCTCACACTGTTGCTGG + Intronic
954353261 3:50063408-50063430 ATGGAGTTTCACCATGTTGCTGG - Intronic
955366486 3:58314707-58314729 ATGGAGTCTCGTTCTGTCACCGG + Intronic
955388285 3:58498003-58498025 ATGGAGTCTCGCACTGTTGCAGG + Exonic
957073488 3:75583148-75583170 ACGGAGTCTTGTTCTGTTGCCGG - Intergenic
957818960 3:85344354-85344376 ATGGTGTCTCACTCTGTCGCTGG - Intronic
959239858 3:103776407-103776429 ATGGAGTCTCGCCCTGTTGCTGG + Intergenic
959392592 3:105794938-105794960 ATGGAGTCTCACTCTGTCGCCGG + Intronic
959777308 3:110182333-110182355 ACGCAGTCTCACTCTGTTGCCGG + Intergenic
960527317 3:118724392-118724414 ATGGAGTCTCACACTGTCACAGG - Intergenic
962120064 3:132551972-132551994 ATGGAGTCTCACTCTGTTGCCGG + Intergenic
962362176 3:134751825-134751847 ATGGAGTCTTATAGAGTTGTTGG - Intronic
962499775 3:135979347-135979369 ATGGAGTCTCCTTCTGTCACTGG - Intronic
962773773 3:138639224-138639246 ACGGAGTCTCGCTCTGTTGCTGG + Intergenic
963703382 3:148655048-148655070 ATGGAGTCTCACTCTGTCACAGG + Intergenic
965765851 3:172129159-172129181 ATGGAGTCTCACTATGTTGCTGG + Intronic
965945245 3:174232618-174232640 ATGTAGGCTCATAATGTGGCCGG + Intronic
966997341 3:185296044-185296066 CTGGAGTCTCACTGTGTTGCTGG - Intronic
967542912 3:190690361-190690383 TTGGAGTCTCATATTTTTGTGGG + Intergenic
970716001 4:18923750-18923772 ATGGAGTCTCTCTCTGTTGCTGG - Intergenic
972331308 4:38066899-38066921 ATGGAGTCTCGCTCTGTCGCCGG + Intronic
973798130 4:54449594-54449616 TTGGAGTCCCAGATTGTTGCGGG + Intergenic
974209372 4:58749840-58749862 ATGGCGTCTCACTCTGTCGCAGG + Intergenic
974244135 4:59291401-59291423 ATGGAGTATGATTCTGTTGCAGG - Intergenic
975584231 4:75934338-75934360 ATGGAGTCTCACTCTGTCACTGG + Intronic
975655838 4:76640551-76640573 AGCAAGTCTCATACTGTTTCTGG - Intronic
975817219 4:78230976-78230998 ACGGAGTCTCACACTGTTGCCGG + Intronic
976434358 4:84999797-84999819 AGGGAGTCTCACCCTGTCGCTGG - Intergenic
976658502 4:87514162-87514184 ATGGAGTCTCACTCTATTGCTGG - Intronic
978580982 4:110231120-110231142 ATGGAGTCTCGTTCTGTTGCCGG + Intergenic
979263113 4:118670716-118670738 ACAGAGTCTCACACTGTCGCCGG - Intergenic
979303905 4:119120079-119120101 ATGGAGTTTCCTTCTGTCGCTGG - Intergenic
981017801 4:139992553-139992575 ATGGAGTCTCACTCTGTTGCCGG + Intronic
981159373 4:141479131-141479153 ATGGAGTCTCAATCTGTCACCGG + Intergenic
981528250 4:145729325-145729347 ATGGAGTCTCACACTCTCCCAGG + Intronic
981855731 4:149289556-149289578 ACAGAGTCTCACTCTGTTGCTGG - Intergenic
982793665 4:159620942-159620964 ATGGAGTCTCGCTCTGTCGCCGG + Intergenic
983229935 4:165119327-165119349 ATGGAGTCTCACTCTGTTGCTGG + Intronic
983316156 4:166134843-166134865 ACGGAGTCTCACTCTGTAGCTGG + Intergenic
983390730 4:167126883-167126905 ACAAAATCTCATACTGTTGCTGG + Intronic
983572495 4:169224927-169224949 ATCGAGTCTCATTCTGTAACAGG + Intronic
983597900 4:169491111-169491133 ATGGAGTCTTCCTCTGTTGCTGG - Intronic
984245000 4:177264243-177264265 ATTTAGTCTCAAAATGTTGCAGG - Intergenic
987439433 5:17938274-17938296 CGGGACTCACATACTGTTGCTGG + Intergenic
988910167 5:35831786-35831808 ATGGATTCTAGTCCTGTTGCTGG + Intergenic
989064248 5:37443825-37443847 ATGGAGTCTCTCTCTGTTGCTGG - Intronic
989782219 5:45281610-45281632 ACGGAGTCTCACTCTGTTGCCGG + Intronic
990198069 5:53341447-53341469 CTAGAGTCTCTTACTGTTTCAGG - Intergenic
990207829 5:53449182-53449204 ATGGAGTCTCTTTATGTTGCTGG - Intergenic
990777174 5:59315446-59315468 ATTGAGTCTCACACTCTTGAGGG + Intronic
991144000 5:63279879-63279901 ACGGAGTCTCACTCTGTCGCAGG + Intergenic
991975650 5:72181743-72181765 ACGGAGTCTCGCACTGTTGTCGG + Intronic
992912168 5:81406739-81406761 ACGGAGTCTCGCACTGTCGCCGG + Intergenic
994418057 5:99499656-99499678 ACGGAGTCTCTCTCTGTTGCTGG - Intergenic
994461908 5:100075497-100075519 ACGGAGTCTCTCTCTGTTGCTGG + Intergenic
995941092 5:117585050-117585072 ACGGAGTCTCACTTTGTTGCCGG - Intergenic
996194445 5:120586146-120586168 ATGGAGTCTCGCTCTGTTGCTGG - Intronic
996622578 5:125526266-125526288 ATTGAGTCTCATGATGTTGCAGG + Intergenic
998697558 5:144657354-144657376 ATGGGGTTTCATCATGTTGCAGG - Intergenic
998831693 5:146166512-146166534 ATGGAGTCTCACTATGTTGCTGG - Intronic
998833153 5:146180481-146180503 ATGGAGTCTCATTCTTTCCCAGG - Intronic
1000267048 5:159647713-159647735 ACGGAGTCTCACTCTGTTGCCGG + Intergenic
1001026125 5:168225733-168225755 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1001472726 5:172026380-172026402 ATGGAGTCTCGCATTGTCGCTGG + Intergenic
1001770164 5:174289510-174289532 ATGGAGTCTCCCTATGTTGCTGG + Intergenic
1001829716 5:174775567-174775589 ACGGAGTCTCACTCTGTTGCCGG + Intergenic
1001876767 5:175208322-175208344 ATGGAGTCTCACTCTGTCGCCGG - Intergenic
1002390093 5:178903964-178903986 ATGGAGTCTCACTCTGTTGCCGG - Intronic
1003455788 6:6280952-6280974 CTGGAGTTTCATACTGTTTGCGG + Intronic
1003654434 6:7992743-7992765 ATAGAGTCAAATACTGTGGCTGG - Intronic
1004226490 6:13789374-13789396 ACGGAGTCTCGCACTGTCGCAGG - Exonic
1004640083 6:17506612-17506634 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1005302205 6:24482122-24482144 ATGGAGTCTCACACTGTCACCGG + Intronic
1006306544 6:33224241-33224263 ATGGAGTCTCGCTCTGTTGCTGG + Intergenic
1009776297 6:68209845-68209867 GTGGAGATTCATACTGTTCCTGG - Intergenic
1011894247 6:92204164-92204186 ATACACTCTCATTCTGTTGCTGG + Intergenic
1012604364 6:101139563-101139585 ATGGAGTCTCACACGGTCACTGG + Intergenic
1012986915 6:105885153-105885175 ATCAAGTCTCCTATTGTTGCAGG - Intergenic
1013090075 6:106892341-106892363 ATGGAGTATCGCACTGTTGCTGG - Intergenic
1013777658 6:113696537-113696559 ATGGAGTCTCACACTGTCGCCGG + Intergenic
1016232902 6:141827893-141827915 ATTTTGTCCCATACTGTTGCTGG + Intergenic
1016339988 6:143051872-143051894 ACGGAGTCTCGCTCTGTTGCCGG - Intergenic
1018105121 6:160478507-160478529 ATGGAGGCTCATTCTGAAGCAGG - Intergenic
1018113236 6:160557389-160557411 ATGGAGGCTCATTCTGAAGCAGG - Exonic
1020801647 7:12740052-12740074 ACAGAGTCTCATACTGTCACAGG + Intergenic
1020829397 7:13075216-13075238 ACGGAGTCTCACTCTGTTGCTGG + Intergenic
1021557079 7:21930672-21930694 ACGGAGTCTTGCACTGTTGCCGG - Intronic
1022436190 7:30388053-30388075 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1022719607 7:32931081-32931103 TTTGAGTCTCATACTTTTGTGGG + Intergenic
1024239867 7:47426256-47426278 ACAGAGTCTCACTCTGTTGCCGG - Intronic
1024257475 7:47549468-47549490 ATGGAGTTTCCCTCTGTTGCCGG - Intronic
1024329857 7:48144910-48144932 ACAGAGTCTCACTCTGTTGCTGG + Intergenic
1024919013 7:54537217-54537239 ATGGAGTCTCACTCTGTCACTGG + Intergenic
1026106523 7:67425013-67425035 AAGGAGTCTCACTCTGTTGCAGG + Intergenic
1026617161 7:71915707-71915729 ACGGAGTCTCGCTCTGTTGCGGG - Intronic
1026914922 7:74114215-74114237 ATGGAGTCCCACTCTGTTGCTGG - Intronic
1027110324 7:75433209-75433231 ACAGAGTCTCACACTGTCGCTGG - Intronic
1029062178 7:97809905-97809927 GTGGAGTCTCACTCTGTCGCCGG - Intergenic
1030049257 7:105523312-105523334 AGAGAGTCTCACTCTGTTGCAGG + Intergenic
1032160682 7:129507337-129507359 ATGGGGTCCCATTTTGTTGCCGG + Intronic
1034104593 7:148479550-148479572 ATAGAGGCTCATGCTGTTACTGG - Intergenic
1034604742 7:152301482-152301504 ATGGAGTCTCACACTGTCAGCGG - Intronic
1034753374 7:153591597-153591619 ATGGAGTCTCACACAGTCCCCGG - Intergenic
1034785270 7:153920584-153920606 ATGGAGTCTCACTCTGTCCCAGG + Intronic
1035384280 7:158459832-158459854 ATAGAGTCCCATCCTGTAGCTGG - Intronic
1035384291 7:158459905-158459927 ATAGAGTCCCATCCTGTAGCTGG - Intronic
1035384367 7:158460416-158460438 ATAGAGTCCCATCCTGTAGCTGG - Intronic
1035908230 8:3537026-3537048 ATGGAGTCTTTCTCTGTTGCCGG + Intronic
1035997202 8:4561347-4561369 ATGGAGTCTCATTCTGTCACCGG - Intronic
1036306731 8:7608446-7608468 ATGGAGTCTAATTCTGTCACCGG + Intergenic
1036357581 8:8056434-8056456 ATGGAGTCTAATTCTGTCACCGG + Intergenic
1036611197 8:10351276-10351298 ACGGAGTCTCGCTCTGTTGCCGG + Intronic
1038196496 8:25373022-25373044 ACGGAGTCTCGTTCTGTTGCCGG + Intronic
1039497377 8:37991151-37991173 ATGGAGTCACACTCTGTTGCCGG + Intergenic
1039751519 8:40482882-40482904 GTGGATTCTCATACTGCTGCAGG + Intergenic
1040504375 8:48034144-48034166 ATGGAGTCTCGCACTGTCACCGG + Intronic
1040628387 8:49178978-49179000 ACGGAGTCTCGATCTGTTGCTGG - Intergenic
1040837269 8:51745778-51745800 ATGTAGTCTCACTCTGTCGCTGG + Intronic
1041469332 8:58191285-58191307 ATGGAGTCTCACTCTGTCGCTGG - Intronic
1042072709 8:64954077-64954099 ATGGAGTCTCTTTCTGTAGCTGG - Intergenic
1042986440 8:74589090-74589112 ATGGAGTCTCTCACTGTCACTGG + Intergenic
1043770653 8:84195413-84195435 ATGGAGTCTCGCTCTGTCGCTGG - Intronic
1043876553 8:85492560-85492582 GTGGAGACTCACACTGTAGCAGG - Intergenic
1044732868 8:95245712-95245734 ATGGAGTGTCACTCTGTTGCCGG - Exonic
1044775651 8:95684575-95684597 ATGGAGTCTCACGCTGTACCAGG - Intergenic
1044837433 8:96310188-96310210 ATGGAGTCTCACTCTGTCCCAGG + Intronic
1045009715 8:97947337-97947359 ACGGAGTCTCGCTCTGTTGCTGG - Intronic
1045754190 8:105522723-105522745 ATGGAGTCTTGCTCTGTTGCTGG - Intronic
1046520389 8:115318283-115318305 ATGGGGTTTCATCATGTTGCAGG + Intergenic
1049113330 8:140664007-140664029 ATGGAGTCTCACTCTGTTGCAGG + Intronic
1051422774 9:16905218-16905240 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
1051627667 9:19113793-19113815 ATGGAGTCTCGCCCTGTCGCTGG + Intronic
1052787879 9:32846713-32846735 ACGGAGTCTCACACTGTCACTGG + Intergenic
1052952088 9:34220656-34220678 ATGGGGTCTCACTATGTTGCTGG + Intronic
1053048681 9:34940560-34940582 ATGGGGTCTCACTATGTTGCTGG - Intergenic
1053394861 9:37764343-37764365 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1053655048 9:40210153-40210175 ATCCAGTCTCCAACTGTTGCAGG - Intergenic
1053905432 9:42839359-42839381 ATCGAGTCTCCAACTGTTGCAGG - Intergenic
1054367163 9:64356369-64356391 ATCCAGTCTCCAACTGTTGCAGG - Intergenic
1055340029 9:75271476-75271498 ATGGAGTCTCACTCTGTATCTGG - Intergenic
1055965034 9:81858090-81858112 ATGGAGTCTTGCTCTGTTGCAGG + Intergenic
1056573844 9:87839760-87839782 ATGGAGTCTCGCTCTGTTGTCGG + Intergenic
1057296710 9:93849579-93849601 ATGGAATCTCACTCTGTCGCCGG + Intergenic
1057427050 9:94960383-94960405 ATGGAGTCTCGTTCTGTCCCAGG - Intronic
1057622783 9:96651252-96651274 ATGGAGTCTCACTCTGTTGCTGG - Intronic
1058003353 9:99889977-99889999 ACGGAGTCTCACACTGTCGCTGG + Intergenic
1058112823 9:101050097-101050119 TTGGAGTCTCACTCTGTTGCAGG - Intronic
1058580521 9:106451535-106451557 ATGGAGTCTCACATTGTCACTGG + Intergenic
1058711031 9:107679340-107679362 ACGGAGTCTCACACTGTCACTGG + Intergenic
1059619432 9:115987296-115987318 ACAGAGTCTCACTCTGTTGCCGG + Intergenic
1060579647 9:124733413-124733435 ATGAAGTATCATACAGTTGGGGG + Intronic
1061348700 9:130046750-130046772 ATAAAGTCTCACTCTGTTGCCGG - Intergenic
1062736948 9:138142561-138142583 CTGGACTGTCATCCTGTTGCAGG + Intergenic
1203583077 Un_KI270746v1:32279-32301 AGGGAGTCTCATACTATCACTGG - Intergenic
1185478693 X:430316-430338 AAGGAGTCTCGCTCTGTTGCAGG - Intergenic
1185510375 X:659779-659801 ACGGAGTCTCGCTCTGTTGCAGG + Intergenic
1185676227 X:1851475-1851497 ATGGAGTCTCGCTCTGTTTCCGG - Intergenic
1185914857 X:4024534-4024556 ATGTTGTCTCACACTGTTGCTGG + Intergenic
1186478712 X:9879288-9879310 ACAGAGTCTCCTTCTGTTGCTGG + Intronic
1186856568 X:13632190-13632212 ACGGAGTCTCACTCTGTTGCTGG - Intronic
1186942639 X:14527588-14527610 ATGGAGTCTCACTCTGTCACCGG - Intergenic
1187529381 X:20082650-20082672 ACGGAGTCTCGCACTGTTGTCGG + Intronic
1187530018 X:20087912-20087934 ACGGAGTCTCACACTGTCACTGG + Intronic
1187563024 X:20420146-20420168 ATGGGGTCTCATGTTGGTGCTGG + Intergenic
1188998347 X:36914394-36914416 TTGGAAACTCATACTGTTGGGGG - Intergenic
1189479997 X:41385130-41385152 ACAGAGTCTCATTCTGTCGCAGG - Intergenic
1189503202 X:41583932-41583954 ATGGGGTCTCCCAATGTTGCTGG + Intronic
1191811384 X:65192816-65192838 ATGGAGTCTCGCTCTATTGCTGG + Intergenic
1194110428 X:89826426-89826448 ACGGAGTCTCATTCTGTTGCCGG - Intergenic
1198030093 X:132746471-132746493 ACGGAGTCTCGCTCTGTTGCTGG - Intronic
1200298897 X:154952565-154952587 ACGGAGTCTCACTCTGTCGCCGG + Intronic
1200399141 X:156008572-156008594 CTGGACTGTCATCCTGTTGCGGG + Intronic
1201365277 Y:13198650-13198672 ATGGAGTCTCACTCTGTCTCAGG - Intergenic
1201522618 Y:14892713-14892735 ATGGAGTCTCACTCTTTCGCCGG - Intergenic
1201687145 Y:16717993-16718015 ATGGAGTCTTACTCTGTTGCCGG + Intergenic
1201890284 Y:18936271-18936293 ATGGAATGTCACTCTGTTGCCGG + Intergenic