ID: 1102073188

View in Genome Browser
Species Human (GRCh38)
Location 12:110038689-110038711
Sequence AACCTTGTATTGCTACTGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102073188_1102073192 13 Left 1102073188 12:110038689-110038711 CCCATCAGTAGCAATACAAGGTT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102073192 12:110038725-110038747 AGATTTTCTCAGGCCTTTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 319
1102073188_1102073190 3 Left 1102073188 12:110038689-110038711 CCCATCAGTAGCAATACAAGGTT 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1102073190 12:110038715-110038737 CATTTTAACCAGATTTTCTCAGG 0: 1
1: 0
2: 3
3: 33
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102073188 Original CRISPR AACCTTGTATTGCTACTGAT GGG (reversed) Exonic
907535289 1:55148460-55148482 TACCTTGTCTTGCTTTTGATAGG + Exonic
908876216 1:68680005-68680027 ATCTTTGTCTTGTTACTGATAGG + Intergenic
916375243 1:164146722-164146744 AACCTTGTATTAATACTTACAGG + Intergenic
917538820 1:175894114-175894136 CACCTTGTATCTCTACTTATTGG + Intergenic
918825643 1:189320273-189320295 AACCTTTTGTTGGTACTGTTTGG - Intergenic
920694026 1:208168051-208168073 ATCCTGGTTTTGCTACTCATGGG + Intronic
1065637914 10:27750111-27750133 AACCTTATATTGCTTGTGATAGG - Intergenic
1071218028 10:83430332-83430354 TAGGCTGTATTGCTACTGATGGG - Intergenic
1073352153 10:102827666-102827688 AACCTTGTCTTGCTCCCTATAGG + Intergenic
1073979197 10:109135011-109135033 TTCCTTCTTTTGCTACTGATTGG - Intergenic
1079227154 11:18616911-18616933 AAGCTTGTACAGCTGCTGATTGG + Exonic
1081943205 11:46963180-46963202 ATCTTTGTGTTGTTACTGATAGG + Intronic
1088456498 11:110038205-110038227 AACCTTGTCTTTCTACAGTTTGG + Intergenic
1089548851 11:119254325-119254347 AACCATGTATTGCTAACGACAGG + Intronic
1090788883 11:130072443-130072465 AACCTTGGTGTGCTTCTGATAGG + Intronic
1093342902 12:17999980-18000002 AAACTTCTATTTCTAGTGATTGG - Intergenic
1095850918 12:46804541-46804563 AATCTAGCATTGCTTCTGATTGG - Intronic
1102073188 12:110038689-110038711 AACCTTGTATTGCTACTGATGGG - Exonic
1104258003 12:127156628-127156650 AACCTTTCATTGCTATTCATGGG - Intergenic
1106922093 13:34574568-34574590 AACCTTGCATGGCTGCTGCTTGG + Intergenic
1109154055 13:58882511-58882533 AAAATTGGGTTGCTACTGATTGG - Intergenic
1111875642 13:93891028-93891050 ACCTTTGTATTTCCACTGATAGG - Intronic
1137789900 16:51166165-51166187 AGCCTTTTATTGCTAGTGATAGG + Intergenic
1156567111 18:38204307-38204329 AACCTTCATATGCTACTGATTGG - Intergenic
1156988970 18:43383105-43383127 TTACTTTTATTGCTACTGATGGG - Intergenic
1157078155 18:44491199-44491221 AACTTAGTATTGCTAATAATTGG - Intergenic
1158323370 18:56287909-56287931 AACCTTGTATGGGTATTGTTTGG - Intergenic
1162262959 19:9547517-9547539 AACCTTTCATTGCTATTCATGGG - Intergenic
1164081210 19:21862903-21862925 AACCTTTCATTGCTATTCATAGG - Intergenic
1166713890 19:44954473-44954495 ACCCTTGTGGTGCTACTGACTGG - Intergenic
929046084 2:37791989-37792011 ATGCTTGTATTGCTACTTTTGGG - Intergenic
930594366 2:53367845-53367867 AATCTTGCATTGCTATTGAAAGG - Intergenic
935096038 2:99945354-99945376 AACCTCCTATTTCTGCTGATGGG + Intronic
942002873 2:171666969-171666991 AACCTTGTTATGATACTGTTAGG - Intergenic
945822296 2:214679612-214679634 ACCCCTGTCTTGCTACTGACTGG - Intergenic
1170047678 20:12103020-12103042 AATTATTTATTGCTACTGATAGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1182771269 22:32798151-32798173 AAACCTGTATTGCTTCTGATTGG + Intronic
1185126801 22:49015647-49015669 AACCTGGCTTTGCTGCTGATAGG + Intergenic
950250960 3:11464881-11464903 AACCTTGTTTGGGTACTGTTAGG + Intronic
953834065 3:46328088-46328110 AACCTTTCATTGCTATTCATAGG + Intergenic
955625551 3:60914741-60914763 AACCTTGTATTAATAATGAAGGG + Intronic
955734123 3:62018674-62018696 AGCTTTGTAATGCTACTGCTGGG - Intronic
957740193 3:84255996-84256018 AACTATGTTTTGCTACTTATGGG + Intergenic
960450294 3:117798659-117798681 AATCTTCTATTGCTACTGAAAGG + Intergenic
961051551 3:123751179-123751201 AACCTTGTGTTACTTCTGAGGGG + Intronic
962977447 3:140458014-140458036 AACCTTCTATTGCTACCCAATGG + Intronic
964301374 3:155289114-155289136 AACATTGTGTTTCTCCTGATAGG - Intergenic
967702635 3:192611277-192611299 AAGCATGTATGGCTACTTATTGG + Intronic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978479478 4:109172742-109172764 AACATTGTATTGCTACTCTCAGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979276222 4:118816911-118816933 AACCTTGTATTGTTTATGATGGG - Intronic
979543542 4:121914332-121914354 AACCTTGGATTTCTTCTGACAGG + Intronic
982482414 4:155928620-155928642 AAACATATATTTCTACTGATTGG - Intronic
986191905 5:5504662-5504684 TACTTTGTATTTCTCCTGATTGG - Intergenic
989184723 5:38612518-38612540 AACCTGGTTTTGCTCCTGATGGG + Intergenic
994325302 5:98439632-98439654 AACCTTTCATTGCTATTCATGGG - Intergenic
994503300 5:100607331-100607353 GACCTCGTATTGCTCCTGCTTGG + Intergenic
994684747 5:102935516-102935538 AACCATGTATTGCTACTGCAGGG + Intronic
997375039 5:133391716-133391738 AACTTTGTATTGCCACTGCCTGG + Intronic
1011035147 6:82966107-82966129 ATCCATATATTGCAACTGATCGG + Intronic
1015232593 6:130933454-130933476 AACTTTATATTGCTAGTGAGTGG - Intronic
1017448082 6:154527322-154527344 AACCAGATATTGCTGCTGATAGG - Intergenic
1021291663 7:18852617-18852639 CACCTTGTATTGCCATTAATTGG + Intronic
1021299316 7:18952784-18952806 AACCTTGTACTGCCACAGAGCGG + Intronic
1026540345 7:71274903-71274925 AACATTGTTATACTACTGATGGG + Intronic
1027680732 7:81217855-81217877 TAGCTTGTATAGCAACTGATTGG - Intergenic
1034828664 7:154289927-154289949 AACCTTGTATTTCAACCTATGGG - Intronic
1036161767 8:6395540-6395562 AAGCTTGTATTGCTATTGTTGGG - Intergenic
1036908002 8:12723983-12724005 AACCTTAAATTGCTATTTATCGG + Intronic
1038466190 8:27766051-27766073 TACCTTGGATTCCTACTGAAAGG + Intronic
1038959669 8:32505336-32505358 AACATCGTATTGCTACCTATGGG - Intronic
1039631607 8:39118267-39118289 TCTCTTGTATTTCTACTGATAGG + Intronic
1040994817 8:53390921-53390943 AACCTTGCTTTGCTTCTGATAGG + Intergenic
1040994825 8:53390982-53391004 CACCTTGCTTTGCTTCTGATAGG + Intergenic
1041919277 8:63164817-63164839 AACCTTGTTTTTCTGCTGGTGGG + Intergenic
1046211207 8:111079688-111079710 AATCCAGTATTTCTACTGATGGG - Intergenic
1053307071 9:36992309-36992331 AACCTAGCAATGCTATTGATTGG - Intronic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1059313389 9:113404144-113404166 AACCTCCTATTTTTACTGATAGG - Intergenic
1061676058 9:132216336-132216358 ACCCAGGTTTTGCTACTGATTGG - Intronic
1185815305 X:3149550-3149572 AGAATTGTATTTCTACTGATGGG - Intergenic
1192292070 X:69808689-69808711 TACCTTATCTTGCTACTCATGGG - Intronic
1192350655 X:70353788-70353810 TACCTGGTATTGGTACTGAATGG - Exonic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1194198116 X:90921221-90921243 AACCTAGTATTGCAATTAATTGG + Intergenic
1194736293 X:97515862-97515884 TCCCTTGTTTTGCTACTGATGGG - Intronic
1194883980 X:99289746-99289768 AACATTGTTTTCCAACTGATGGG + Intergenic
1197845286 X:130795218-130795240 CACCTTGTATTGATACTCCTAGG - Intronic
1200543625 Y:4491610-4491632 AACCTAGTATTGCAATTAATTGG - Intergenic