ID: 1102074062

View in Genome Browser
Species Human (GRCh38)
Location 12:110045992-110046014
Sequence GCTTAAAACCATGAGTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102074060_1102074062 17 Left 1102074060 12:110045952-110045974 CCATATAAAAAATAATAATAAAA 0: 3
1: 20
2: 271
3: 2160
4: 12665
Right 1102074062 12:110045992-110046014 GCTTAAAACCATGAGTTGTTAGG 0: 1
1: 0
2: 2
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102074062 Original CRISPR GCTTAAAACCATGAGTTGTT AGG Intronic
902599479 1:17531398-17531420 GCTTAACCCCTTGAGTTCTTGGG + Intergenic
902996480 1:20229432-20229454 GCTATAGACCATGATTTGTTGGG + Intergenic
903729175 1:25477763-25477785 GCTTAAAACCATGAAGTTATTGG + Intronic
903910558 1:26721495-26721517 GCTTAAAACCAAGGGTTGCCAGG - Intronic
907989359 1:59564558-59564580 GCTCAAAATCATTAGTCGTTAGG + Intronic
908087910 1:60656234-60656256 GCTGAAAATGATGATTTGTTTGG - Intergenic
911631974 1:100193520-100193542 GCTTAGAACCATGATTGGTATGG + Exonic
912583588 1:110741441-110741463 ACTTAACTCCATGAGTTGGTAGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917668194 1:177246159-177246181 GCTTCAGTCCAGGAGTTGTTTGG - Intronic
922602635 1:226868978-226869000 GCTTAATAGCATTAGTTATTAGG + Intergenic
922626997 1:227058092-227058114 ACTTAAAACCATTAGATATTTGG - Intronic
924673928 1:246156431-246156453 GCTTATAACTCTGAGTTATTGGG + Intronic
1063079571 10:2752773-2752795 GCTTAAACACAGGAGTTGTGTGG + Intergenic
1063798127 10:9536560-9536582 GATTAAAATTATGAGTTATTAGG + Intergenic
1067408856 10:46047357-46047379 GCTTAAACCAATGAATTTTTAGG + Intergenic
1073619443 10:105031484-105031506 GTTTAAAACAATGAATTCTTAGG - Intronic
1080047719 11:27826879-27826901 GCTGAAAACCAGGAGGGGTTTGG - Intergenic
1080098732 11:28434985-28435007 GCTTAAACAGATGACTTGTTTGG - Intergenic
1080507163 11:32926253-32926275 GCTTAAAACTTTTAGATGTTTGG + Intronic
1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG + Intergenic
1081214105 11:40372954-40372976 TCTAACAACCATGATTTGTTAGG - Intronic
1081372073 11:42316341-42316363 GCTTAAAACTGTGAGATGTAAGG - Intergenic
1081861261 11:46334421-46334443 ACTTACAACCATGGGGTGTTTGG + Intronic
1082668027 11:55998713-55998735 GTTTAAAATGATTAGTTGTTAGG - Intergenic
1082745128 11:56952883-56952905 ACTTACAACCATCAGTTCTTTGG + Intergenic
1084075518 11:66772386-66772408 GATTGAAACCAGGAGTTGTAGGG + Intronic
1086668663 11:89519370-89519392 CCTTAAAACCTAGGGTTGTTTGG - Intergenic
1087211280 11:95447956-95447978 ACTTAAAACCAAGAGTCATTTGG - Intergenic
1087303270 11:96459950-96459972 GCTTAAACCCAAGAGATGGTGGG + Intronic
1091750425 12:3018642-3018664 GCTTAATGCCATGAGTTTATGGG - Intronic
1092668972 12:10840525-10840547 TCTTAAAACATTGAGTTTTTTGG - Intronic
1093212443 12:16324272-16324294 GCTGAAGACCATAAGATGTTAGG - Intergenic
1097617785 12:61904321-61904343 TCTTAAATACATGAGTTTTTGGG - Intronic
1098124890 12:67280680-67280702 TTTTAAAACAATGAATTGTTTGG + Intronic
1099436291 12:82649747-82649769 GTTTAAAACCATCAGCTCTTGGG - Intergenic
1100122868 12:91389184-91389206 TCTTAAAACTATAATTTGTTGGG + Intergenic
1100577186 12:95903892-95903914 GCTTCACAGCATGAGTTGTGAGG + Intronic
1100776190 12:97977559-97977581 GCTTAAAAAGATCAGTTGATAGG + Intergenic
1101098011 12:101363576-101363598 ATTTTTAACCATGAGTTGTTTGG + Exonic
1101899760 12:108782924-108782946 GCTCCACACCATGAGTTGTTTGG - Exonic
1102074062 12:110045992-110046014 GCTTAAAACCATGAGTTGTTAGG + Intronic
1102940740 12:116939309-116939331 GCTTAAAACCAGGAGTATTTTGG - Intronic
1103178093 12:118882097-118882119 GCTTAACATCATTAGTTATTAGG - Intergenic
1103461940 12:121111765-121111787 GCTTAAGAGCAAGAGTTGTGGGG + Intergenic
1104713238 12:130999896-130999918 CCTTAAAACCATGTTTGGTTCGG - Intronic
1107420321 13:40240039-40240061 TCTTAAGACCATGAGGTCTTGGG - Intergenic
1107536222 13:41336510-41336532 ACTTAAAACTATGACTTTTTGGG + Intronic
1110411894 13:75213953-75213975 GCATAAAACCATAAGGGGTTTGG + Intergenic
1110611025 13:77487949-77487971 GCTCCAAACCATGAGTGGTTTGG - Intergenic
1112993796 13:105547137-105547159 TCTTAAAAGAAAGAGTTGTTAGG - Intergenic
1114169862 14:20261469-20261491 GCTTAAGACCACGAGTTTATGGG + Intronic
1114277484 14:21160191-21160213 GCTTAAAACGTTGAGTTTTAGGG - Intergenic
1114303785 14:21402353-21402375 GCTTCAATCCATGAGTGGTCGGG - Exonic
1118102273 14:62620126-62620148 GCTGTAAACCATCAGTTGTTGGG + Intergenic
1121339630 14:93097568-93097590 GCTTAAAGCCAGTAGTTTTTAGG + Intronic
1125158125 15:36613070-36613092 GCTTAAAATCACTAATTGTTAGG + Intronic
1126716977 15:51528015-51528037 GCTTAAAATAATGGGTTGTAAGG + Intronic
1128138144 15:65279213-65279235 ACCTACAACCCTGAGTTGTTAGG + Intronic
1132022492 15:98374720-98374742 CCTTAAAAGCAACAGTTGTTTGG - Intergenic
1133085253 16:3357316-3357338 GGGTAAAAACATGAATTGTTTGG - Intergenic
1133411389 16:5572106-5572128 CCTTAAATACATGATTTGTTAGG + Intergenic
1135803149 16:25517844-25517866 CCTGAAAACCATGAGTGGCTCGG + Intergenic
1136059402 16:27715689-27715711 ACTTAACATCATAAGTTGTTAGG + Intronic
1142911270 17:3093621-3093643 GCTTAACACAAGGAGTTGGTAGG + Intergenic
1143086900 17:4422837-4422859 GTTTAAAGCCATGAGTTCTGGGG + Intergenic
1143814054 17:9497049-9497071 CCTTGAAACCATTAGGTGTTTGG + Intronic
1146415936 17:32633020-32633042 TCTTTAAGCCATGAGTAGTTTGG - Intronic
1146427776 17:32759648-32759670 GCTAAAAGGCATGACTTGTTTGG - Intronic
1149353646 17:55817225-55817247 GATTAAAACCAAGAGTCTTTTGG + Intronic
1151483262 17:74382962-74382984 GATAAAAACGATGAGTAGTTTGG + Intergenic
1152166007 17:78706802-78706824 GCTTAACATCATTAGTTGTAGGG - Intronic
1203167364 17_GL000205v2_random:110144-110166 TCTTAGTACCATGAGTTGTATGG - Intergenic
1153423829 18:4939897-4939919 TCTTAAATCCTTGAGTTTTTAGG - Intergenic
1163463220 19:17451625-17451647 GCTTAACATCATTAGTTATTAGG - Intronic
1163840317 19:19604173-19604195 GATTAACACCATGAGAGGTTGGG + Intronic
1164905463 19:31964043-31964065 GCTTGAAACCCTGAGTTCCTGGG - Intergenic
925757113 2:7144063-7144085 GCTTAGATCTATGAGTTTTTGGG + Intergenic
926057002 2:9779535-9779557 GCTTAAAACCATGAAATTTGTGG + Intergenic
928728578 2:34204710-34204732 GCTGAAAAGCATATGTTGTTTGG + Intergenic
928976368 2:37091026-37091048 GCTTAAAGCCAAGAGTTGGCCGG + Intronic
929049708 2:37825686-37825708 GATTAAAGCCATAAGATGTTAGG - Intergenic
929133971 2:38604919-38604941 GCTTAAAACAATTATTTTTTAGG + Intergenic
929662550 2:43802919-43802941 GTTTAATATCATTAGTTGTTAGG + Intronic
930941095 2:57015097-57015119 GCTTAAAAGAATGAGTTATTAGG + Intergenic
932191865 2:69747766-69747788 GCTTAAACCCAGGAGTTTGTGGG - Intronic
932523043 2:72433781-72433803 GCTTAACAGCTTGAGTTTTTGGG + Intronic
932611093 2:73200823-73200845 GCTTAAAACCATATGTGGCTGGG - Intergenic
933099117 2:78228560-78228582 GCTTATAACCAGAAGTTTTTGGG - Intergenic
933138744 2:78767546-78767568 GCTTAAAAACATGAGTTATTTGG + Intergenic
933909475 2:86926916-86926938 GCTTTAATCCTTGAGTAGTTTGG + Intronic
934023251 2:87976463-87976485 GCTTTAATCCTTGAGTAGTTTGG - Intergenic
936413306 2:112279942-112279964 GCTTTAATCCTTGAGTAGTTTGG + Intronic
936904618 2:117522999-117523021 GCTTAACATCATTAGTTATTAGG + Intergenic
941206037 2:162574557-162574579 GCTTAGAGCCAAGAGTTTTTGGG + Intronic
941777724 2:169410916-169410938 GCTTAGAAACAAGAGTTTTTTGG - Intergenic
942055883 2:172181686-172181708 TCTTAAAACCATCAGATCTTAGG + Intergenic
942285661 2:174413256-174413278 GCTCAAAACCATGATTTCTGAGG + Intronic
944107927 2:196099554-196099576 GCTCAAAAACATGTCTTGTTGGG + Intergenic
944140339 2:196449248-196449270 CCTTGAAACTATGAGTTGTATGG + Intronic
1171051513 20:21863516-21863538 GCTTTTTACCCTGAGTTGTTAGG + Intergenic
1171377621 20:24704141-24704163 GCTTAAAGCCATGAGTTACTCGG - Intergenic
1174672688 20:52322780-52322802 GCTGGAAAGCATGAGTGGTTTGG + Intergenic
1176404395 21:6348991-6349013 TCTTAGTACCATGAGTTGTATGG + Intergenic
1176432762 21:6640113-6640135 TCTTAGTACCATGAGTTGTATGG - Intergenic
1176999378 21:15593095-15593117 GTTTAGAACCATGAGTTGGAAGG + Intergenic
1177056665 21:16313615-16313637 GCTTGAAGCCATGAGTTCTATGG + Intergenic
1177845985 21:26287705-26287727 GCTAAAAACCATTAGTTGGCCGG - Intergenic
1179357124 21:40670814-40670836 ACTTAAAAACATGAATTATTGGG - Intronic
1180166384 21:46032929-46032951 GCTTAAAACCATTAGTTATCAGG + Intergenic
1181665678 22:24394761-24394783 GCTTAACACCATTAGTTATCAGG - Intronic
1182345035 22:29656719-29656741 TCTTTAAAACAAGAGTTGTTGGG + Intronic
1182992756 22:34783572-34783594 GGTTAGCACCATGAGGTGTTGGG + Intergenic
951945154 3:28127455-28127477 GCTAAAAACCAGGTGTTGGTGGG - Intergenic
952100354 3:30004499-30004521 GTTTAAGACTATGAGTTTTTAGG + Intronic
955313777 3:57917604-57917626 GCTTAAAACCTTGAGTTGAGTGG + Intronic
957114231 3:76003837-76003859 GCTTAACACCATTAGTCGTTAGG + Intronic
959874751 3:111369512-111369534 GCTTAACATCATGAGTCTTTAGG - Intronic
962680394 3:137793362-137793384 GCTAAAAACCAAAAGTTATTTGG + Intergenic
963609723 3:147452096-147452118 GCTTATATTCATGAGTTTTTGGG + Intronic
964713926 3:159701397-159701419 TTTTTAAACCATGAGTTTTTAGG + Intronic
965492715 3:169359541-169359563 GATGAAAATCATGAGTTGTTAGG - Intronic
965650885 3:170931698-170931720 GCTTAACATCATTAGTTATTGGG + Intergenic
966458050 3:180140764-180140786 GTTTAAAACTATAAGTTGTGAGG - Intergenic
969555962 4:7910378-7910400 GCATAAAAACAAGAGATGTTAGG + Intronic
975530359 4:75393924-75393946 GCTTAAAACCATTTGGTGTTGGG - Intergenic
975929583 4:79503362-79503384 GTTTAACACCATTAGCTGTTAGG + Intergenic
979869393 4:125799341-125799363 TCTTGAATGCATGAGTTGTTTGG - Intergenic
979960011 4:127007492-127007514 ACTTAAAACCAGGAATAGTTTGG - Intergenic
982360803 4:154516955-154516977 GGATAAAACTATGAGCTGTTGGG - Intergenic
984980191 4:185273103-185273125 GCTTAAACCCATGAATAGATTGG + Intronic
985785670 5:1892685-1892707 ACTTCAACCCATGAGTTTTTGGG + Intergenic
992253949 5:74903011-74903033 GCTTAACATCATCAGTTATTAGG + Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
993586340 5:89734822-89734844 TTTTAAAACGATCAGTTGTTTGG + Intergenic
996389000 5:122939886-122939908 GTTTAAAACCTTGAGATGTGTGG - Intronic
997330470 5:133057114-133057136 TCTCAAAAGTATGAGTTGTTTGG + Intronic
998639150 5:143989821-143989843 GCTTTAAATCATGAGTTCTGTGG + Intergenic
999075363 5:148790631-148790653 GCTTAGAGCCATGAGTCATTGGG - Intergenic
999314526 5:150575341-150575363 GATTAAAACCATGTGTGGTGTGG + Intergenic
999714257 5:154346747-154346769 GATTTAAACCTTAAGTTGTTTGG + Intronic
1000224285 5:159244359-159244381 GCTCAACATCATCAGTTGTTAGG - Intergenic
1000853201 5:166365490-166365512 TCTTAAAACCTTAAGTTATTTGG - Intergenic
1008314829 6:50026780-50026802 GCTTAAAATAATGAGTTATAAGG + Intergenic
1008972279 6:57383525-57383547 GCTAAAAAGTATGAGTTCTTTGG + Intronic
1009161193 6:60285062-60285084 GCTAAAAAGTATGAGTTCTTTGG + Intergenic
1009430946 6:63565093-63565115 GCTTGAGCCCAGGAGTTGTTAGG - Intronic
1010722458 6:79299230-79299252 GCTCAACACCATGAGTCATTAGG + Intergenic
1011173227 6:84529946-84529968 GCTTAAAAAAATGATTTGTATGG + Intergenic
1012304864 6:97642399-97642421 GCTTAAAACCATGCATTCTCAGG + Intergenic
1015520710 6:134128412-134128434 CTTTAAAACCATGAGTTTTATGG + Intergenic
1015637719 6:135295171-135295193 GCTTAACATCATTAGTTGTTGGG + Intronic
1016579007 6:145607117-145607139 GCTTTAAACCAGGAGTGGTTTGG - Intronic
1017320438 6:153086043-153086065 GCTGAAACCCATGAGTTAGTAGG - Intronic
1019896320 7:3986101-3986123 CCTTAAAACCATGAGCTGCCCGG - Intronic
1020636493 7:10701765-10701787 GCATAAGAACATGAGGTGTTTGG - Intergenic
1023327277 7:39073984-39074006 TCTTAAAATCATAAGATGTTAGG + Intronic
1023986119 7:45097245-45097267 GCTGAAAACCATTAGTTATTAGG + Intergenic
1024935689 7:54709760-54709782 GCTTAAGATCATGAGTAGCTAGG - Intergenic
1027486542 7:78768932-78768954 GATTAAGAGCATGTGTTGTTTGG - Intronic
1031130235 7:117825079-117825101 GCTTAATACCAGGAGTCGGTGGG + Intronic
1031708934 7:125020888-125020910 TCTGAAAACCATGAGTTAGTAGG + Intergenic
1032515827 7:132505399-132505421 TCTTAAAACCCTGACTTTTTGGG - Intronic
1034549318 7:151810289-151810311 GGTTGAAAACATCAGTTGTTTGG + Intronic
1035646395 8:1224834-1224856 GCTTAAAACTATGAGTCCCTGGG + Intergenic
1036734246 8:11295517-11295539 GCTCAATTCCATGAGTTGCTTGG + Intronic
1038067011 8:23973804-23973826 GCTTAAATCCCTAAGTTTTTGGG + Intergenic
1041983000 8:63884792-63884814 GTTTAAAACCATTAATTATTAGG - Intergenic
1044588206 8:93887879-93887901 GCTCCACATCATGAGTTGTTAGG + Intronic
1045444434 8:102245777-102245799 GCTTAAAACAACCATTTGTTAGG - Intergenic
1045572940 8:103388296-103388318 GCTTAACATCATTAGTTATTAGG + Intergenic
1047196226 8:122724131-122724153 GCTCAAAATCATTAGTTATTAGG - Intergenic
1047325188 8:123829243-123829265 ACTTAAAAGCATGAGTGGTGTGG - Intergenic
1050031019 9:1385729-1385751 GCTTCAAACCAGAAGTGGTTTGG - Intergenic
1050088708 9:1993668-1993690 CCTTAAAACCAGGAGGAGTTTGG - Intergenic
1050531758 9:6596641-6596663 GCTCAAAATCATTAGTTATTAGG + Intronic
1056238575 9:84620563-84620585 GCTTCTAAGCAGGAGTTGTTCGG - Intergenic
1056772529 9:89490100-89490122 GCTTAACATCATTAGTTGTTAGG - Intronic
1057115801 9:92520370-92520392 GCTTAACATCATTAGTTGTTAGG + Intronic
1057806392 9:98222847-98222869 GCCAAAAACCATGACTTTTTTGG + Intronic
1059968583 9:119640962-119640984 GCTTAATACCCTTAGCTGTTTGG + Intergenic
1061035348 9:128110754-128110776 GCTTAACTCCATTAGTTGTCAGG + Intergenic
1203438774 Un_GL000195v1:168557-168579 TCTTAGTACCATGAGTTGTATGG + Intergenic
1186177929 X:6944638-6944660 GCTCATAGCCAAGAGTTGTTTGG + Intergenic
1188429119 X:30085391-30085413 GCTTAAAATCATGAGTTATAAGG - Intergenic
1188836459 X:34962329-34962351 GCTTAAAACAATGAGTATATTGG + Intergenic
1189489928 X:41462696-41462718 GCTCAACATCATTAGTTGTTAGG - Intronic
1189540644 X:41984402-41984424 GCTCAACATCATTAGTTGTTAGG - Intergenic
1191714015 X:64181734-64181756 GCTAAAAGCCCTGAGATGTTAGG - Intergenic
1191925157 X:66301121-66301143 GCTTAAACGCATGAATTTTTTGG + Intergenic
1193181630 X:78465183-78465205 GTTCAAAATCATTAGTTGTTAGG - Intergenic
1193335432 X:80282788-80282810 GCTTAAAACTATGAGGTTATGGG + Intergenic
1193437739 X:81498814-81498836 GCTTAAAATCATTAGTCATTAGG + Intergenic
1193747706 X:85302340-85302362 GCTAAAAAACATTAGTTATTAGG + Intronic
1194223040 X:91219851-91219873 GCTCAACACCATTAGTTATTAGG + Intergenic
1197820331 X:130535104-130535126 GCTTAAAGCCATCAGGGGTTGGG - Intergenic
1198033881 X:132782033-132782055 GCTTAAAAATATGAGTGTTTGGG + Intronic
1199226935 X:145387265-145387287 GTTTAATACCATCAGTTATTAGG - Intergenic
1200559517 Y:4683281-4683303 GCTCAACACCATTAGTTATTAGG + Intergenic
1201507397 Y:14717469-14717491 GCTTAAACCCATGAGGTGGATGG + Intronic