ID: 1102077686

View in Genome Browser
Species Human (GRCh38)
Location 12:110073162-110073184
Sequence CCCTGCCCTGCTCTCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 1, 2: 10, 3: 124, 4: 688}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102077678_1102077686 -4 Left 1102077678 12:110073143-110073165 CCCACCTTCCCCAGGCACACCCT 0: 1
1: 2
2: 3
3: 61
4: 500
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688
1102077674_1102077686 18 Left 1102077674 12:110073121-110073143 CCAGGATGTTGCCCTGCGCTTTC 0: 1
1: 1
2: 0
3: 10
4: 109
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688
1102077675_1102077686 7 Left 1102077675 12:110073132-110073154 CCCTGCGCTTTCCCACCTTCCCC 0: 1
1: 1
2: 2
3: 58
4: 482
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688
1102077680_1102077686 -8 Left 1102077680 12:110073147-110073169 CCTTCCCCAGGCACACCCTGCCC 0: 1
1: 2
2: 15
3: 124
4: 980
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688
1102077673_1102077686 27 Left 1102077673 12:110073112-110073134 CCTGGGAATCCAGGATGTTGCCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688
1102077672_1102077686 28 Left 1102077672 12:110073111-110073133 CCCTGGGAATCCAGGATGTTGCC 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688
1102077676_1102077686 6 Left 1102077676 12:110073133-110073155 CCTGCGCTTTCCCACCTTCCCCA 0: 1
1: 1
2: 3
3: 48
4: 448
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688
1102077679_1102077686 -5 Left 1102077679 12:110073144-110073166 CCACCTTCCCCAGGCACACCCTG 0: 1
1: 0
2: 5
3: 110
4: 853
Right 1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG 0: 1
1: 1
2: 10
3: 124
4: 688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102077686 Original CRISPR CCCTGCCCTGCTCTCCCTGG CGG Intronic
900112810 1:1015658-1015680 CCCTGCCCTGCCCCCGTTGGGGG - Intergenic
900142196 1:1143370-1143392 CCCAGCCCCGCACTGCCTGGGGG + Intergenic
900176429 1:1293407-1293429 CGCGGCCCTGCTCGCCCAGGAGG - Exonic
900205028 1:1427951-1427973 CCCTCCCCTGCCCTCCGTGGCGG - Intergenic
900363256 1:2300077-2300099 CCCTGCCCTGCCCTGGCAGGGGG + Intronic
900402931 1:2480022-2480044 CCCTTGGCTGCTCACCCTGGGGG + Intronic
900410242 1:2509385-2509407 CGCTGGTCTGCTCTGCCTGGTGG - Intronic
900512852 1:3068586-3068608 CCCCGCCCTGCGATCGCTGGAGG - Intergenic
900859403 1:5217447-5217469 CCCTGCTCTGCTCTCCACAGAGG + Intergenic
900935555 1:5764232-5764254 TCCTGCCCTCCTCTTCTTGGGGG - Intergenic
900940154 1:5793367-5793389 CCCTTCCATGCGCTACCTGGAGG - Intergenic
901152571 1:7113532-7113554 CACTGCCCTGGTCTGCCTGTTGG - Intronic
901295349 1:8156920-8156942 TCCTGCCTTGGTCTTCCTGGTGG - Intergenic
901332335 1:8420457-8420479 CTCTGCCCTCCCCTCCCTGTGGG + Intronic
901462388 1:9399516-9399538 CCCTGCCCTGCTCTGCCCCAGGG + Intergenic
901493915 1:9610627-9610649 CCCTGCCCGGCTCAACCTGAAGG + Exonic
902366105 1:15975605-15975627 CCCGGCACTGCGCTCCCTCGCGG + Intronic
902386158 1:16077069-16077091 CCCTGCCCTGGCAGCCCTGGGGG + Intergenic
902413792 1:16227174-16227196 TCCTGGGCTGCTCTCCCAGGAGG + Intergenic
902748046 1:18486383-18486405 AGCAGCCCGGCTCTCCCTGGTGG - Intergenic
902816020 1:18917258-18917280 CCCTGCCCTGGGCGGCCTGGTGG + Intronic
902843244 1:19088816-19088838 CTCTGCCCGGGTCTCCCTGCGGG + Exonic
903049341 1:20589246-20589268 GGCTGCCCTGCTCACCCAGGAGG + Exonic
903070914 1:20726685-20726707 CCCTGCCCCGCCCTGGCTGGTGG - Intronic
903315578 1:22502292-22502314 CCCTCCTCTGTGCTCCCTGGGGG - Exonic
903875938 1:26472929-26472951 CCCTTCCCTCCCCTCCCTGCGGG + Intronic
904316579 1:29669963-29669985 CCCTTCCCTGGTGCCCCTGGAGG + Intergenic
904540225 1:31227843-31227865 CTCTCCCCTGTCCTCCCTGGTGG + Intronic
904671687 1:32170901-32170923 CCATCCCCTCCCCTCCCTGGAGG - Exonic
905033479 1:34902801-34902823 GGCTGCCCTGACCTCCCTGGGGG - Intronic
905286769 1:36885698-36885720 CCCTGCCCTGGTCCCTGTGGGGG - Intronic
905670769 1:39788862-39788884 CCCTGCCCTGCCCTGCCCAGCGG + Intergenic
906154370 1:43605510-43605532 TCCTGCCCTGCCCACCCAGGTGG + Exonic
906344041 1:45004218-45004240 CCCTGCCCTGCCCTGCCTTGGGG + Intronic
907043915 1:51288057-51288079 CCCTGCCCTGCCCTGCCTTTGGG - Exonic
907305235 1:53509471-53509493 GCCTGCCCTCCCCTCCCTGCAGG - Intronic
907336388 1:53702471-53702493 CCCTGCCACCCTCTCCCAGGAGG - Intronic
907372901 1:54014467-54014489 CCCTGCTCTGCTCACCCTCGTGG - Intronic
907524575 1:55046704-55046726 CCCTGGCCTGGCCTCCCTGCTGG + Intronic
907572625 1:55497979-55498001 CCCTTCACTGGTCACCCTGGTGG + Intergenic
908252896 1:62279104-62279126 ACTTGCCCTCCTCTCCCTTGTGG - Intronic
908959959 1:69684905-69684927 CCCTGCTCTGCTCTCCCTGGTGG + Intronic
909525229 1:76614871-76614893 CACAGCCCTGATCTCCCTAGAGG - Intronic
910200067 1:84690309-84690331 CCCCGCCCGCCCCTCCCTGGCGG + Intronic
912126428 1:106544608-106544630 CCCTTCCGTGTTCTACCTGGAGG - Intergenic
912552485 1:110493192-110493214 CCCTGCCCAGTTGGCCCTGGTGG + Intergenic
912715217 1:111978674-111978696 CCCAGCCCTGGTCCCCCAGGAGG - Intronic
915119169 1:153617765-153617787 CCCGCCCCTGCTCCCTCTGGTGG + Intergenic
915146957 1:153801038-153801060 CCCTTCCCTGCTCTCCTTGGAGG + Intergenic
915367843 1:155325378-155325400 CCCGGCCCTCCACGCCCTGGTGG + Exonic
915477376 1:156161109-156161131 CGCTCCCCCGCTCTCACTGGGGG - Intronic
915536160 1:156537105-156537127 CCCTGCTCTGCTCCCCATGGTGG + Intronic
915944815 1:160141883-160141905 GTCTGCCCAGCTCTCCCTGAAGG - Exonic
916687063 1:167157036-167157058 GCCTGTCCTGCTCACCCTGAGGG + Intergenic
916845984 1:168650527-168650549 CCTTGCCCTACTCTCCTTTGTGG + Intergenic
918230605 1:182527857-182527879 CTCTGTACTGCTCTCTCTGGGGG - Intronic
918241740 1:182626253-182626275 CCCTTCCCTGCTCACCCTCTGGG + Intergenic
918753710 1:188308081-188308103 ACCTGTTCTGCTCTCCCCGGTGG + Intergenic
919808984 1:201397364-201397386 CCCTGGCCTGCCCTCCCTGCCGG - Intronic
919918931 1:202156811-202156833 CCCTCCCCTGCTCTCCCTACAGG - Intronic
920051704 1:203168282-203168304 CCCTGCCTTCCTTCCCCTGGTGG - Intronic
920251401 1:204624722-204624744 CTCCTCCCTCCTCTCCCTGGCGG + Intronic
920389695 1:205591760-205591782 CTCTGCCCTGCCAGCCCTGGGGG - Intronic
921884995 1:220296619-220296641 TCCTGCCCTGCAGTCCTTGGAGG + Intergenic
922753009 1:228079736-228079758 CCCAGCCCTGCCCTCCCTCTTGG - Intergenic
922858207 1:228793206-228793228 TCCTGCACAGCCCTCCCTGGTGG + Intergenic
922985589 1:229863873-229863895 GCCGGCCCTGCCCTCCCTGTGGG - Intergenic
922986824 1:229872510-229872532 GCCTGCTCTACTCTCCCAGGAGG - Intergenic
923092460 1:230750791-230750813 CCTTGCCCTGGGCTCCCTTGAGG - Intronic
924561210 1:245156977-245156999 CCCCTCCCAGCTCTCCCTGGCGG + Intronic
924839833 1:247697281-247697303 GCCTGCCCTGCTGTCACTGTTGG - Intergenic
1062798110 10:359245-359267 GGTGGCCCTGCTCTCCCTGGGGG - Intronic
1063364327 10:5480661-5480683 TCCTGCCTTCCCCTCCCTGGAGG + Intergenic
1063655143 10:7980818-7980840 ACCTGCCCTGGCCTCCATGGTGG - Intronic
1064220857 10:13439461-13439483 CCCTGCACTGTTCTGCCGGGTGG - Exonic
1064295869 10:14078808-14078830 CCCTGCCCTGGGCTGCCTTGTGG + Intronic
1065079015 10:22109825-22109847 CACTGCCCAGATCTCCCTTGAGG + Intergenic
1065266207 10:23978884-23978906 ACCTGCCATGTTCTCTCTGGTGG + Intronic
1065373784 10:25016502-25016524 CCCCTCCCTCGTCTCCCTGGCGG - Intronic
1069634516 10:69917282-69917304 GCATGCCCCGTTCTCCCTGGAGG - Exonic
1069817916 10:71210273-71210295 CCGGGCCCTGCTCTCCCTCCAGG - Intergenic
1069913138 10:71771946-71771968 CCCTGCACTGCCCTCCCTGGTGG - Intronic
1070642553 10:78180129-78180151 CCCTGCCCTGCTCACAGAGGGGG + Intergenic
1070774656 10:79102629-79102651 CCCTTCCCTGGTCTGGCTGGAGG + Intronic
1070972490 10:80578997-80579019 CCCTCCCCAGCTCCCCATGGTGG - Intronic
1071249938 10:83807296-83807318 GCTTGCCCTGCTGTCCCTGGAGG + Intergenic
1071561598 10:86650177-86650199 CCCTGCTCTGCTCTCTGTTGCGG + Intergenic
1072241189 10:93496766-93496788 CACTGACCTGCCCTCCCTGGCGG - Exonic
1072805842 10:98423715-98423737 CCCTGCCCTGGCCACCCAGGGGG + Intronic
1072806926 10:98429694-98429716 CCTGTCCCTGCTCTCCCAGGAGG + Intronic
1073425340 10:103452390-103452412 GCCCGCCCTCCTCTGCCTGGTGG - Intronic
1074819585 10:117168295-117168317 CCCCGCCCGGCTCTGCCTGTGGG + Intergenic
1074903460 10:117839577-117839599 CTCCGCCCAGCTCTCCATGGAGG - Intergenic
1075090222 10:119440162-119440184 CCCTGCCCTGCCCACCCAGAAGG + Intronic
1075689828 10:124387388-124387410 CCCGGCCCTGCTCTGACAGGTGG - Intergenic
1076569078 10:131420486-131420508 CCCAGCGCTGCTCTCTCTGGGGG + Intergenic
1076703791 10:132290165-132290187 CCCAGCCCTGCTCTCCTTTCTGG - Intronic
1076746576 10:132517616-132517638 CCCTGCCCTGCCCCCACCGGAGG - Intergenic
1076869766 10:133187568-133187590 CCCTCCACCACTCTCCCTGGCGG + Intronic
1076885075 10:133258462-133258484 CCCTGCCCTGCCACCCCGGGTGG - Intergenic
1077021578 11:419414-419436 CCCTGCCCTGCGCCCACTGACGG - Intronic
1077046777 11:550206-550228 CCTGGCCATGCTCACCCTGGAGG + Exonic
1077214135 11:1388355-1388377 CCCTCCCCTGCCCCCACTGGTGG + Intergenic
1077367141 11:2165846-2165868 TCCTGGCCTGGCCTCCCTGGGGG - Intronic
1077537925 11:3133411-3133433 CACTGCCCTGCACTGCCTGCGGG + Intronic
1078131594 11:8618587-8618609 TACTGCCCTGCCTTCCCTGGGGG + Intronic
1078255236 11:9653210-9653232 CCCTCCCCTGCTTTCCAAGGAGG - Intergenic
1078341677 11:10501630-10501652 CCCTGCCCTGGGCTCCTGGGAGG + Intronic
1078668739 11:13346706-13346728 CCATGCCCTGCTTTCTCTGGCGG + Intronic
1078755366 11:14203933-14203955 GACTTCCCTGCTCTCCCTGTTGG - Intronic
1079203679 11:18395718-18395740 CCCTGCACTGCATTCGCTGGAGG - Intronic
1079240852 11:18721297-18721319 CCCTGCTCTGCTCTGCCCCGGGG + Intronic
1080691964 11:34565862-34565884 ACTTGCCTTTCTCTCCCTGGTGG + Intergenic
1080802171 11:35618876-35618898 CCGGGCGCTGCTCACCCTGGCGG + Exonic
1080869108 11:36221482-36221504 TCCTGTCCTTCTCTCCCTGTAGG - Intronic
1081487002 11:43538496-43538518 CCCTGCCCTCTTTTCCTTGGAGG - Intergenic
1081699160 11:45141866-45141888 CCCTTCCCTGGCCTCCCTGCAGG - Intronic
1081868784 11:46373977-46373999 CACAGCCCTGCTCTGCCTGGTGG - Intronic
1082035442 11:47642113-47642135 CCCGGCCCTGCCCTGCCCGGCGG - Intronic
1083048799 11:59758625-59758647 TCTTGCACTGCTCTTCCTGGTGG + Intronic
1083250619 11:61464230-61464252 CCCTGCCCTGCTCTTCTTATAGG + Intronic
1083264729 11:61541431-61541453 CCACCCCCTGCTCTCCCTGGAGG - Intronic
1083296812 11:61719409-61719431 CCGTGCTCTTCCCTCCCTGGAGG + Intronic
1083327432 11:61879889-61879911 GCCTGCCCTCCCCTCCCAGGGGG - Intronic
1083424055 11:62573895-62573917 CCCCTCCCTTCTCTCCCGGGCGG - Exonic
1083581241 11:63826918-63826940 CCCTGCCCAGCTCCCCCTCCGGG + Exonic
1083685342 11:64371838-64371860 CCCTACCCTGTTCTCCCCTGAGG + Exonic
1083784094 11:64933973-64933995 CCCAGCCCAGCTTTCACTGGGGG + Exonic
1084026672 11:66454801-66454823 CTCTTCCCTGCTCCTCCTGGGGG + Intronic
1084038466 11:66527880-66527902 CCCTGCCCTGCCCTGTCTGGGGG - Intronic
1084092200 11:66886108-66886130 CTCTGCCCTGCTCTCCACGCAGG - Intronic
1084153729 11:67302972-67302994 CCCTGCCCTGCTCGCCTCCGAGG + Intergenic
1084435276 11:69135813-69135835 CCCAGGCCTGCTCCTCCTGGAGG - Intergenic
1084464202 11:69312858-69312880 CTCTGCTCTGACCTCCCTGGTGG + Intronic
1084471543 11:69362456-69362478 CCCAGTCCTGCTCTACCTGTTGG - Intronic
1084987189 11:72885861-72885883 CCCTGCCCTCCTCACTATGGTGG + Intronic
1085021928 11:73215519-73215541 CCCTGCCTTACACTCTCTGGTGG - Intergenic
1085034365 11:73291293-73291315 CCTTGCCCTGCCCTGCCTTGGGG + Intronic
1085306316 11:75488050-75488072 CCCTGTGCTGCTCTTACTGGTGG + Intronic
1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG + Intronic
1088592294 11:111414318-111414340 ACCTGGACCGCTCTCCCTGGTGG - Intronic
1088805410 11:113347865-113347887 CCCTGCCCTTCTCTGCCCTGTGG + Intronic
1088815602 11:113418800-113418822 CCCTGCCTTGCACTTCCTGTGGG + Intronic
1089138881 11:116270778-116270800 CCCTGCCCAGCTCTGCCAGGAGG - Intergenic
1089384791 11:118060494-118060516 CCCTGTCCTGCCCTCGCTGCCGG - Intergenic
1089524811 11:119089971-119089993 CCCTTCCCTCCTCCCCCAGGCGG + Exonic
1089566852 11:119376222-119376244 ACCTGCACAGCTGTCCCTGGAGG + Intronic
1089604859 11:119635905-119635927 GCATGCCCAGCCCTCCCTGGGGG - Intronic
1089627595 11:119761495-119761517 CCCTGGCCACCACTCCCTGGTGG + Intergenic
1089705619 11:120275564-120275586 CACTGTCCTGATCTGCCTGGTGG - Intronic
1089833275 11:121347908-121347930 CCCTGCCCGGCTATCCCTCCAGG + Intergenic
1090228151 11:125083884-125083906 CCTTGCCCTGCTCTGCCAGCAGG + Intronic
1090397628 11:126429630-126429652 CTCTGACCTGCTCTACCAGGCGG + Intronic
1090426388 11:126609522-126609544 CCCTGCCCCTCTCTCCCAGCAGG - Intronic
1090447828 11:126779296-126779318 CCCAGCCATGCTCTCCCAGTGGG + Intronic
1091208490 11:133836370-133836392 CCCTGCCCCACTCTTCCTAGGGG - Intergenic
1091216053 11:133902898-133902920 CCCAGCCCTCCTCACGCTGGTGG - Intergenic
1092155343 12:6278649-6278671 CCCTGCCCTGTGTTCCCGGGAGG + Intergenic
1092262365 12:6959552-6959574 CCCTCCCCGCCTCTCCCTGAAGG - Intronic
1092275899 12:7060781-7060803 CCCTGTGCTGCTGTCCCTGGGGG + Intronic
1092904386 12:13088749-13088771 CCCTCCCCTCCCCTCCCTTGGGG - Intronic
1095174206 12:39071954-39071976 CCCTGCCCTGCTTTCCTTCTTGG - Intergenic
1095947118 12:47759560-47759582 CCCTACCGCGCGCTCCCTGGTGG + Intronic
1095962912 12:47846528-47846550 CCTCGCCCTTCTCTCCCTGTTGG + Intronic
1096007531 12:48184609-48184631 CCCTGTGCTGGTCTCCTTGGGGG + Exonic
1096649600 12:53055506-53055528 CCCTGCCCATCTCTCTCTGTTGG + Intronic
1097306736 12:58077430-58077452 CCCTTCCTTCCTCTCTCTGGAGG - Intergenic
1100614922 12:96223543-96223565 ACCTGGCCTCCTCTCCCTGCAGG + Exonic
1101955805 12:109211621-109211643 CCCTGCACTGCAGCCCCTGGCGG - Intronic
1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG + Intronic
1102678085 12:114672080-114672102 CACCGCCCTGCCCTCCATGGCGG - Exonic
1103342234 12:120227016-120227038 ACCTACACTGCTCTCCTTGGAGG - Intronic
1103464786 12:121133331-121133353 CCCTGCCCTGCGCGCCCTGGCGG - Intronic
1103936831 12:124481475-124481497 CCCTGCCATGCAGGCCCTGGAGG + Intronic
1103954545 12:124568847-124568869 CCATTCCCCGCTCTCCCTGGGGG - Intergenic
1104429490 12:128705211-128705233 CCCAGCCCCGCTCTCCCAGGTGG + Exonic
1104443129 12:128811485-128811507 CCCTGCATTGCTCTACCTGGGGG + Intronic
1104636645 12:130441800-130441822 TCCTGGCGTTCTCTCCCTGGGGG + Intronic
1104751206 12:131240405-131240427 CCCTCCCCATCTCTCCTTGGAGG + Intergenic
1104829724 12:131741882-131741904 CCCTCCGCTGCTTTTCCTGGGGG + Intronic
1104974424 12:132546101-132546123 CCCTCCCCTGCGCTCCCCGCAGG + Intronic
1105426197 13:20297054-20297076 CCCTGTCCTCCTCTCCCTCTAGG + Intergenic
1105476156 13:20729816-20729838 CCCTGCCCTGCCCTCCTTGCAGG + Intronic
1105532334 13:21231126-21231148 CCCTGACCTGCTCCACCTGGGGG + Intergenic
1105673838 13:22648694-22648716 CCCTGCTCTGCTCTCTGTGGTGG + Intergenic
1106172383 13:27299132-27299154 CCATGCCCTGCTCTCCTGGATGG - Intergenic
1110661373 13:78062118-78062140 CCCTGCCCTGTCCTCACTTGGGG + Intergenic
1112415380 13:99200206-99200228 CCCTGCCCTCCCCGCCGTGGTGG - Intergenic
1112554881 13:100457848-100457870 CCCTGCCATGCCCCCCTTGGAGG + Intronic
1113284203 13:108828692-108828714 GCCTGTCCTGCTCCTCCTGGAGG - Intronic
1113619460 13:111703071-111703093 CCTTGCCCTGCTCTCCCACCTGG - Intergenic
1113624989 13:111788332-111788354 CCTTGCCCTGCTCTCCCACCTGG - Intergenic
1113847801 13:113402570-113402592 CCCTTCCCTGCAGTCCCTGTGGG - Intergenic
1113850337 13:113414124-113414146 CCCTGCCCTTCTCTCAGAGGAGG - Intergenic
1113894601 13:113755543-113755565 CCCTGGGCTGCTCTCAGTGGTGG + Intergenic
1118757228 14:68853866-68853888 CCCTGCCCAGCTCTAGCTGTGGG + Intergenic
1119205603 14:72791447-72791469 CAGGGCACTGCTCTCCCTGGTGG - Intronic
1119540497 14:75435117-75435139 CCCTTCCCTGTTCTCCTTAGAGG + Intronic
1119749459 14:77067123-77067145 CCCTGCTCTGCACCCCCAGGAGG + Intergenic
1119770811 14:77219701-77219723 CCCTGCTCTGCCCTCCCTGCAGG + Intronic
1120308598 14:82802084-82802106 CCCTTCCCTGCCCTCCCTCTTGG + Intergenic
1121273571 14:92653047-92653069 CCCCGCCCTGCACTCCGAGGAGG + Exonic
1121439567 14:93940179-93940201 CCAGACCCTGCTCTCTCTGGGGG + Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1121504898 14:94469585-94469607 CCTGGCCATGCTCTCCCTTGGGG - Exonic
1121521263 14:94587587-94587609 CCTGGCCATGCTCTCCCTGGGGG + Exonic
1121623920 14:95371160-95371182 CCCTGCCTGCCTCTCCCTGAAGG + Intergenic
1122317661 14:100835469-100835491 TGCTGGCTTGCTCTCCCTGGTGG + Intergenic
1122411608 14:101528713-101528735 CCCTGCCTTCCTCTCCCCTGGGG - Intergenic
1122443879 14:101755213-101755235 ACCTGCCCTGCCCTCTCTGCTGG - Intergenic
1122576558 14:102746696-102746718 CCCTGCCCGGCTCTTCCTGCAGG - Intergenic
1122599098 14:102912462-102912484 CCCTGCCGTGCCCTGGCTGGTGG + Intergenic
1122861644 14:104585177-104585199 CCCTGCCCTGGGGTCCTTGGAGG - Intronic
1122917922 14:104867307-104867329 CCCTGTCCTGCTGAGCCTGGAGG + Intronic
1122984192 14:105204797-105204819 CCCTGCCCTGCCCTCCCCTCTGG + Intergenic
1123063927 14:105606730-105606752 CCCTGCTCTGCTTTTCCTTGGGG + Intergenic
1123073241 14:105652373-105652395 CCCTGCTCTGCTTTTCCTTGGGG + Intergenic
1123093169 14:105751144-105751166 CCCTGCTCTGCTTTTCCTTGGGG + Intergenic
1123105284 14:105838609-105838631 TCCTGCCCTGCTCTCTCAAGTGG + Intergenic
1202850859 14_GL000225v1_random:17968-17990 CCCTGCACTGATCACCCAGGTGG - Intergenic
1124209984 15:27754629-27754651 CTCAGTCCTGCTCTCCCTGCAGG - Intergenic
1124362454 15:29047665-29047687 CCCTGCCCTGCACTTCCCTGAGG - Intronic
1124659848 15:31538252-31538274 CCCTGCTCTTCTCTCCCCAGCGG - Intronic
1125489411 15:40136005-40136027 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489425 15:40136054-40136076 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489504 15:40136349-40136371 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489533 15:40136450-40136472 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489547 15:40136498-40136520 CCCTGCCCTGCCCTGCCCTGTGG - Intergenic
1125489559 15:40136547-40136569 CCCTGCCCTGCTCTACCCTGTGG - Intergenic
1125724407 15:41861014-41861036 CCCTCCTCTGCACTCCCTGGAGG + Intronic
1125739333 15:41951113-41951135 CCCAGCACTGATCTCACTGGTGG + Intronic
1127372640 15:58355384-58355406 CCCAGCTTTGCTCTCCCCGGGGG + Intronic
1127770157 15:62224356-62224378 CCCTCCCCTGCCCTGCCTGGTGG + Intergenic
1127770763 15:62228708-62228730 CCCTGCCCTGGTCTCTCTTCTGG - Intergenic
1128075133 15:64821131-64821153 CCTAGCTCTGCTCTCCTTGGGGG - Intronic
1128300164 15:66561715-66561737 ACCTGTCCAGCTCTCCTTGGTGG + Intronic
1128504517 15:68257119-68257141 CGCTGCCGTGCGCTCGCTGGCGG - Intronic
1128983526 15:72202875-72202897 CCCTGCCATGACCTCCCTGGCGG + Intronic
1129540190 15:76342199-76342221 CCCAGCTCAGCGCTCCCTGGCGG + Exonic
1129897990 15:79122787-79122809 CCTTCCCCTGCACCCCCTGGAGG - Intergenic
1130322612 15:82853512-82853534 CCCTGCCCTGCCCGACCTGGAGG - Intronic
1130551977 15:84895140-84895162 CCCTCCCCTGCCCTGCCTCGGGG - Intronic
1130990848 15:88874873-88874895 TCCTCCCTAGCTCTCCCTGGAGG - Exonic
1131121032 15:89823525-89823547 CCCTGCCCTGCCCTGCCCTGGGG - Intergenic
1131192183 15:90325637-90325659 CCCTGGTCTGCTCAGCCTGGGGG - Intergenic
1132603309 16:783433-783455 TCCTGCCCTGGCCTGCCTGGTGG - Intergenic
1132733415 16:1374296-1374318 CCCTGCCCTGTCGTCCCTGCTGG + Intronic
1132734614 16:1379335-1379357 CGCTCCCCTGCCCTCCCTCGGGG + Intronic
1132896847 16:2233298-2233320 ACTGGCCCTGCTCTCCCTGTGGG - Intronic
1132897518 16:2236107-2236129 CGCTGCCTTGCTTTCCCTGAAGG + Exonic
1132942596 16:2515341-2515363 CCCTGCCCCACCCTGCCTGGTGG + Intronic
1132959595 16:2614445-2614467 CCCTGGCCTGCTCTCCCTCAAGG + Intergenic
1132972656 16:2696420-2696442 CCCTGGCCTGCTCTCCCTCAAGG + Intronic
1133061116 16:3175141-3175163 CCCAGCCCACCTCCCCCTGGTGG + Intergenic
1133141976 16:3751875-3751897 CTCTGCCCTGCTCTGATTGGTGG - Intronic
1133209960 16:4258025-4258047 CCCAGCCCTCCTCTCCCTTCTGG - Exonic
1133236202 16:4388512-4388534 CCGTGCCCTGCTCCTCCAGGAGG + Intronic
1133530533 16:6651259-6651281 CCTGGCCATGCTCTCCATGGAGG - Intronic
1135722416 16:24828810-24828832 TGCTGTCCTGCTCTCCCTGCAGG - Intergenic
1135877496 16:26216709-26216731 CCCTCCCCTTCTCTACCTGCTGG - Intergenic
1136040039 16:27571583-27571605 ATCTGCCGTGCTCACCCTGGAGG + Intronic
1136281941 16:29218386-29218408 CTGTGCCCTCCTGTCCCTGGAGG - Intergenic
1136544346 16:30947397-30947419 CCCTGCACTGATATCTCTGGGGG + Exonic
1136548179 16:30966949-30966971 GCCTGGCCTGCTGTCCCTCGTGG + Exonic
1137292555 16:47061701-47061723 CCCTGCCCTGATCTCCTGGTGGG + Intergenic
1137295805 16:47092243-47092265 CCCTGGCAGCCTCTCCCTGGCGG + Intronic
1137578761 16:49621035-49621057 CCCTGCCTTGGGCTCCCCGGGGG - Intronic
1137584836 16:49658219-49658241 CCCTGCACTGCCCTGTCTGGAGG - Intronic
1137614789 16:49839673-49839695 CCCGGCTCTGTTCTCTCTGGAGG - Intronic
1139659480 16:68411134-68411156 CCCCGGCCTGCTTTGCCTGGAGG - Intronic
1139832375 16:69810464-69810486 CACTGCCCTCATGTCCCTGGGGG - Intronic
1140457975 16:75115645-75115667 CCCTGCAGAGCTCTCCCTGCAGG + Exonic
1141296362 16:82773390-82773412 CCCTGCCCTGCTCCCACTTCTGG + Intronic
1141425533 16:83942280-83942302 CACTGCGCGGCTCTGCCTGGAGG - Intronic
1141523273 16:84595443-84595465 CCCAACCCTGCTCACCCTGAAGG + Intronic
1141647179 16:85373785-85373807 CCCTGCCCTGGGCTGCCTCGGGG - Intergenic
1141771055 16:86089817-86089839 ACATCCCCTGCTCTCCCTGGGGG - Intergenic
1141843555 16:86591046-86591068 CCCTGCTCAGCTCCTCCTGGAGG - Intergenic
1141948500 16:87325738-87325760 CGATCCCCTGCTCTCCCTGGAGG + Intronic
1141995161 16:87632304-87632326 CCCCACCCTCCTCTGCCTGGTGG + Intronic
1142086317 16:88184302-88184324 CTGTGCCCTCCTGTCCCTGGAGG - Intergenic
1142137022 16:88456100-88456122 CCCTGCGCTGGTCTGTCTGGGGG + Intronic
1142156682 16:88535544-88535566 CCCACCCCTGCCATCCCTGGTGG - Exonic
1142197084 16:88743960-88743982 CCCTGCACAGCACCCCCTGGTGG - Intronic
1142203274 16:88771104-88771126 GCCTGCCCTGCTCTGCCTCACGG - Intronic
1142218048 16:88839500-88839522 CCCTGCCCTGCACACCCGCGTGG + Intronic
1142259763 16:89037221-89037243 CCCTGCCCAGCACTCACTGCAGG - Intergenic
1142455258 16:90217103-90217125 CCTTGGCCTCCTCTCCCAGGAGG - Intergenic
1143615618 17:8047542-8047564 CCCAGCCCAGCTCTCCTTGCAGG + Exonic
1144386251 17:14751452-14751474 GCCTGCTCTGATCTCCCAGGGGG + Intergenic
1144774692 17:17779390-17779412 CGCTGTCCTGGCCTCCCTGGAGG - Intronic
1144782927 17:17816921-17816943 CCCTGCCCTGCCCACTCTGCCGG + Intronic
1144967760 17:19088909-19088931 GCCAGCACTGCTCTCCCTGAGGG + Intergenic
1144980156 17:19163154-19163176 GCCAGCACTGCTCTCCCTGAGGG - Intergenic
1144988066 17:19215078-19215100 GCCAGCACTGCTCTCCCTGAGGG + Intergenic
1145251187 17:21297857-21297879 CTGGGCCCTGCTCACCCTGGAGG - Intronic
1146794132 17:35769579-35769601 GCCTGCCCACCTCTGCCTGGTGG - Intronic
1147044303 17:37742353-37742375 CCCTGCCTTTCTCTTCCAGGAGG + Intronic
1147139374 17:38452784-38452806 CCCTGCCCTGCTCGCCTTCCTGG - Intronic
1147307508 17:39573949-39573971 CACTGCTCCGCTCTCCCTTGGGG - Intergenic
1147947140 17:44086619-44086641 TCCTCCCCTGCTGCCCCTGGGGG - Exonic
1148131200 17:45263565-45263587 CCCTGCCCTGCCCTGCCAGAGGG + Exonic
1148148132 17:45378938-45378960 CCCGGCCCTGCCCTGCCTGCTGG + Intergenic
1148461880 17:47843666-47843688 AGCTGCCCTCCTGTCCCTGGGGG + Intergenic
1148646140 17:49220436-49220458 CCCTGTGCTGCGCTCCTTGGAGG - Intronic
1148744943 17:49912886-49912908 CCCATCCCTGCTCAACCTGGCGG - Intergenic
1148773760 17:50081692-50081714 CCCAGCCCTACTCTTCATGGAGG - Intronic
1148910459 17:50939802-50939824 CCCCGCCTTGCTCTGCATGGGGG + Intergenic
1149044118 17:52224725-52224747 CCTTGCCTTTCTCTTCCTGGAGG + Intergenic
1150133606 17:62682183-62682205 CCCTGCCCTGCTCTGCCCTGGGG + Intronic
1150657141 17:67046651-67046673 CCCTGCCCTGCCCTGCCCAGGGG - Intronic
1150743374 17:67797357-67797379 CCCTGCCCTGCCCTGCCCAGAGG - Intergenic
1151236312 17:72722236-72722258 CCCTGCCCTCCTCTCATTGATGG + Intronic
1151500363 17:74484297-74484319 CCCAGCCCTGCTGGCCCTCGGGG - Exonic
1151718693 17:75844054-75844076 CCCTGCTCTGCTGGCCCAGGGGG + Intronic
1151975296 17:77480845-77480867 CCAGGCCCTGCTCTGCCTGCGGG - Intronic
1152078318 17:78171717-78171739 CCCTGCTGTGCTCCCCCTGCAGG + Exonic
1152101000 17:78301741-78301763 CCCTGTCCTGTTGTCTCTGGGGG + Intergenic
1152334954 17:79695490-79695512 CCCAGCCCTGCTCCCCTGGGGGG + Intergenic
1152342680 17:79733885-79733907 CCCTGCCCGGTCCTCTCTGGGGG + Intronic
1152422917 17:80203763-80203785 CCCTGCCCTGCTCACCTGGCAGG + Intronic
1152475173 17:80513262-80513284 CCACGCCCGGCTCTCCCGGGTGG - Intergenic
1152574134 17:81132759-81132781 ACCTGCGCTGGGCTCCCTGGTGG - Intronic
1152585644 17:81188348-81188370 CACTGCCCTGCACCCCCTGCCGG + Intergenic
1152693950 17:81734565-81734587 CCCTGCCGTGCCCTCCCCGAGGG - Intergenic
1152740112 17:82015024-82015046 CCGGGCCCTGCTCTGGCTGGGGG + Intronic
1152745374 17:82036369-82036391 CCCAGCCCTGCTCACCTTGTGGG + Exonic
1155117598 18:22784436-22784458 CCTTCCCCTGCACTCCCAGGAGG + Intergenic
1156464621 18:37341043-37341065 CCCTTCCCTGCTCACCAAGGTGG - Intronic
1157533776 18:48443506-48443528 CCCACCCCTGGCCTCCCTGGAGG - Intergenic
1158592861 18:58792123-58792145 CCCGGCCTTGCTGTCCCTGCTGG + Intergenic
1160223266 18:76992547-76992569 CCCTGCCCTGCCCACCCTTCAGG + Intronic
1160710087 19:547444-547466 CCCTGCCCTGCCCACCCCAGGGG + Intronic
1160726050 19:618266-618288 CCATGCTCGGCTCTCCCTGTCGG + Intronic
1160738312 19:674729-674751 CCCTGCCCTGCTCCCCAAGCCGG + Intergenic
1160738348 19:674836-674858 CCCTGCCCTGCTCCCCAAGCCGG + Intergenic
1160781731 19:880422-880444 CCCTCCCCTGCGCTCCTTGAGGG - Intronic
1160866121 19:1256878-1256900 CACAGTCCTGCCCTCCCTGGAGG - Intronic
1160878610 19:1309474-1309496 ACCTGTGCTGCTCTCCCTGGAGG - Intergenic
1161010451 19:1957236-1957258 CACTGGCCTGCTCTCCGTGTAGG - Intronic
1161014818 19:1978383-1978405 CGCTGCCCTGAAATCCCTGGGGG - Intronic
1161273831 19:3404604-3404626 CCCGGCCCTGCCCTCCTGGGTGG - Intronic
1161445512 19:4316694-4316716 CCTTGCCCTCCTCTCCCTGAGGG - Intronic
1161562609 19:4981730-4981752 CTCTGCAGTGCTCTCCCTGTGGG + Intronic
1161701769 19:5799867-5799889 CCCTGCCCTGGCCTCCTTGGTGG + Intergenic
1161965040 19:7543069-7543091 GCCTCACCTGGTCTCCCTGGCGG - Exonic
1162090567 19:8276991-8277013 CCCCTCCCTGGTCTCCCTGCAGG + Intronic
1162092800 19:8291819-8291841 CCCCTCCCTGGTCTCCCTGCAGG + Intronic
1162494316 19:11014595-11014617 CTCTGCCCTTCTTCCCCTGGAGG + Intronic
1162496935 19:11028631-11028653 CCCTGCCCTGCGGTCCCTGATGG + Intronic
1162789454 19:13055408-13055430 CTCAGCACTGCCCTCCCTGGCGG - Intronic
1162885521 19:13694168-13694190 ACCTGCCTTTCTTTCCCTGGGGG - Intergenic
1163033925 19:14561006-14561028 CCCTGCCTTGTAGTCCCTGGGGG - Intronic
1163536933 19:17882237-17882259 CCCTGCCCTGGTCTCCTGAGAGG + Intronic
1163653703 19:18533255-18533277 CCCTGTCCTGCTCACCTTGTTGG + Exonic
1163705190 19:18808293-18808315 CCCTGCCATGCCCTCCTTGGAGG + Intergenic
1163767381 19:19171040-19171062 CCCTGCTCTGATCTTCCTGTGGG - Intronic
1163844115 19:19628819-19628841 CCCTGCCCTGCCCTGCCCTGTGG + Exonic
1164148597 19:22529185-22529207 CCCTGCCCTGGTCACTCCGGAGG + Intronic
1164681401 19:30135983-30136005 TGCTGCTCTGCCCTCCCTGGGGG + Intergenic
1164753583 19:30673374-30673396 CTCTGCTCTCCTCTCCCTGGGGG + Intronic
1164836465 19:31358033-31358055 CCAGGCCCAGCTCTTCCTGGAGG + Intergenic
1164859803 19:31554028-31554050 CCCTTCCCTGCTCTCCCCAGGGG + Intergenic
1164933890 19:32196439-32196461 CACTGCCAAGCTCTCCCTGAGGG + Intergenic
1165096852 19:33414158-33414180 CCCTGCCCTGCCCCACCTGCAGG - Intronic
1165792121 19:38499017-38499039 CCCTGCCCTGCCCTGCCCTGCGG - Intronic
1166068092 19:40371852-40371874 CCCTGCTCTGGCCTACCTGGCGG + Exonic
1166267724 19:41695444-41695466 GCCGGCCCTGCTTTCCCTCGGGG - Intronic
1166769309 19:45271450-45271472 CCCTCTCCTTCTCTCCCTGCAGG + Exonic
1167169900 19:47824100-47824122 TCCTGCCCTGCTCCCACTGCAGG - Intronic
1167247662 19:48383390-48383412 GCCTGCCCTGCTCTGGCTGTGGG - Intronic
1167298780 19:48667358-48667380 CACTGCCCTGCTCAGTCTGGGGG + Intronic
1167614802 19:50526471-50526493 CCAGTCCCTGCCCTCCCTGGAGG - Intronic
1167619246 19:50551933-50551955 CCCTTCCCTGCGCCGCCTGGGGG + Intronic
1167696229 19:51017038-51017060 CCCTGCCCGCTCCTCCCTGGAGG + Intronic
1167999803 19:53436021-53436043 CCCTGCTCTGGTCACTCTGGAGG - Intronic
1168004237 19:53473398-53473420 CCCTGCTCTGGTCACTCTGGAGG - Intronic
1168288689 19:55346842-55346864 CCCTGCCCTGCGCTCCCCAGAGG - Intronic
1168316365 19:55486461-55486483 GCCGGCCCTGCTCCTCCTGGCGG + Exonic
1168406891 19:56115112-56115134 CCCAGGCCTGCCCTCCCTGAGGG + Intronic
925115025 2:1371404-1371426 TCCTGCCCTGCCCTTGCTGGTGG + Intergenic
925205587 2:2003181-2003203 CCATGGCCTGCTCTGCATGGGGG + Intronic
925583982 2:5444312-5444334 CCATGCCCCGCGCTCACTGGAGG - Intergenic
926090769 2:10047822-10047844 CAGTGCCCAGCTCTCCCTGCAGG + Exonic
926138268 2:10352704-10352726 CCCTCCCCAGCTCTCCCTGGGGG - Intronic
926234423 2:11028592-11028614 CCTTGCTCTGCTCTCCCAGCAGG - Intergenic
926303137 2:11618331-11618353 ACCTGGCATGCTCTCCCTGGGGG - Exonic
926757828 2:16250249-16250271 CCCTGCCTGGCTCCTCCTGGGGG - Intergenic
926971468 2:18471440-18471462 CTCAGCCCTGCTCTCCCCAGGGG + Intergenic
927198779 2:20565753-20565775 CCCTGCTCTGACCTGCCTGGTGG - Intronic
927203683 2:20593765-20593787 GCCTGCCCTGCTGCCCCTGCTGG + Intronic
927418469 2:22904293-22904315 CCCTTACCTGCGCCCCCTGGAGG - Intergenic
927871913 2:26629251-26629273 CCTTGCACTCCTCTGCCTGGAGG + Intronic
927990196 2:27442282-27442304 CCCGGGCCCGCTCCCCCTGGCGG - Intergenic
928132965 2:28666739-28666761 CCTGCCCATGCTCTCCCTGGAGG - Intergenic
928245565 2:29624158-29624180 ACCAGTCCTGCTCTCGCTGGTGG + Intronic
928367662 2:30715124-30715146 CCCTGCCCTACTCACACTGTGGG + Intergenic
929604797 2:43226979-43227001 CCCTGCCCTGTTCTCCGAGGCGG + Intergenic
929685868 2:44033666-44033688 CCAATCTCTGCTCTCCCTGGAGG + Intergenic
929942733 2:46347258-46347280 CCCTGCCCTCCTCTCACAGCTGG - Intronic
931186717 2:59959579-59959601 CTCTGCCCTCCCATCCCTGGAGG + Intergenic
931350825 2:61486875-61486897 GCCTGCCTTACCCTCCCTGGTGG + Intronic
931671771 2:64654005-64654027 CCCGGCCCGCCTCTCCCCGGCGG + Intronic
931721009 2:65067892-65067914 CCCTTCCCTACTCTGCCTGATGG - Intronic
932449821 2:71802298-71802320 CCCTGCCAGGGGCTCCCTGGAGG + Intergenic
932493970 2:72137606-72137628 CCCTGCCCTGCCCTGCCCCGTGG + Intronic
932581636 2:72996026-72996048 CCCTGTGCTCCTCTCCATGGGGG + Intronic
932702449 2:74001131-74001153 CCCTGCCCTGTGTTCCCAGGGGG + Intronic
933212357 2:79585684-79585706 CCCTGGCCTGCACTCCATGCTGG + Intronic
933816130 2:86070068-86070090 CCCGGCCCAGCTCACTCTGGGGG + Exonic
934111456 2:88747304-88747326 CTCAGCCCTGCTCACCATGGTGG - Intronic
934531078 2:95089524-95089546 CACAGCCCTGCCCTCCATGGTGG + Intronic
934655984 2:96116958-96116980 GCCCGCCCTGCCCTCCCTGCGGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935214510 2:100965596-100965618 CCCTGCAGGGCTCACCCTGGTGG - Intronic
935338812 2:102041695-102041717 CCCTTCCCTGGGCTCCCTGAAGG + Intergenic
935593522 2:104862540-104862562 CCCAGCCCTGCCCTCCCTCCCGG - Intergenic
935612395 2:105038544-105038566 CCCTGCCCTGCTGTCTAGGGAGG + Intronic
935691124 2:105733342-105733364 CCCTGGGTTGCTCTCGCTGGGGG - Intergenic
936008589 2:108910596-108910618 CCCAACCCTGCTCTTCCTGTTGG + Intronic
936025147 2:109025992-109026014 CCAAGGCCTGCCCTCCCTGGGGG + Intergenic
936086820 2:109474870-109474892 CCCTTCCCTGCTGGCTCTGGAGG - Intronic
936095815 2:109529400-109529422 GCCTCCCCGGCTCTCCCTCGAGG - Intergenic
936234594 2:110732460-110732482 CCCTGCCCTGGCTTCCCGGGCGG - Intergenic
937230823 2:120397163-120397185 CCCTGCCCTGCCCTGCCCTGGGG + Intergenic
937252750 2:120534683-120534705 CACTGCCCTGCTGGTCCTGGTGG - Intergenic
937266049 2:120615221-120615243 CCCTGCCCTCCTCTTCCTGCAGG + Intergenic
937316287 2:120933872-120933894 CCCTGCCCTGCCCTGCCCTGGGG + Intronic
937915383 2:127096417-127096439 CGCAGCTCTGCCCTCCCTGGTGG - Intronic
937916003 2:127099017-127099039 CCCTGCCCCGGCCACCCTGGAGG - Intronic
938364991 2:130727460-130727482 CCCTGGCCTGCACTCCCTAGGGG - Intergenic
939497446 2:142941077-142941099 CCCAGCCCTCCTCTCCCTCTGGG + Intronic
942469350 2:176243532-176243554 CCCTCCCCAGCTCTCCCTGCTGG + Intergenic
942579858 2:177406470-177406492 AAATGCCCTTCTCTCCCTGGAGG - Intronic
943904517 2:193480721-193480743 CACACCCCTGCTCTCCCTTGAGG - Intergenic
944682580 2:202090763-202090785 CTCTGTCCTGCTCTCCCTGTGGG - Exonic
946010870 2:216562537-216562559 CTCAGACCTGTTCTCCCTGGGGG - Intronic
946094642 2:217262906-217262928 CCCTCCCTTGCTCACTCTGGTGG + Intergenic
946351880 2:219160621-219160643 CGCTGGCCTTTTCTCCCTGGAGG - Intronic
946743118 2:222819204-222819226 GCCTGCCCTGCTATTCCTGTAGG - Intergenic
947172977 2:227330619-227330641 TGCTGCCCTGCTCACCCTGTGGG - Exonic
947475947 2:230447839-230447861 CCCTCCTCTCCCCTCCCTGGAGG + Intronic
947533843 2:230928770-230928792 CCCTGCCTTCCTCTCTCTGTTGG - Intronic
947871715 2:233442261-233442283 CCCAGCCCTGCTCCCCATGTGGG - Intronic
947984539 2:234437315-234437337 CCCTGGCCTCTTCTCCCTGTGGG + Intergenic
948094844 2:235325337-235325359 TCCTGCCCAGCTGCCCCTGGAGG + Intergenic
948377287 2:237529857-237529879 CCTTCCCCAGCTCTCCCAGGAGG - Intronic
948425679 2:237885500-237885522 CCCCTCTGTGCTCTCCCTGGTGG + Intronic
948553928 2:238794583-238794605 CCATGGCCGGCTCTCCCTGTGGG - Intergenic
948553943 2:238794647-238794669 CCATGGCCGGCTCTCCCTGTGGG - Intergenic
948554058 2:238795163-238795185 CCATGGCCGGCTCTCCCTGTGGG - Intergenic
948654918 2:239470683-239470705 CCCAGCTCTGTGCTCCCTGGGGG - Intergenic
948783342 2:240338360-240338382 AGGTGCCCTGCTCTTCCTGGGGG - Intergenic
948793611 2:240391452-240391474 CCCTGGGCTGGTCACCCTGGGGG - Intergenic
948899716 2:240950160-240950182 CCCTGCTCTGCTGACCCTGAGGG + Intronic
949086739 2:242161829-242161851 CCTTGGCCTCCTCTCCCAGGAGG - Intergenic
1169084053 20:2816116-2816138 CCCTTTCCTGCTTTCCCTGCTGG - Intergenic
1170264659 20:14451701-14451723 GCCTGCATTGCTCTGCCTGGGGG - Intronic
1170655237 20:18280580-18280602 CCCTCCCCTGCCATCCATGGGGG - Intergenic
1171199958 20:23232974-23232996 CTCTGCCCTGCTTTACCTGTAGG + Intergenic
1171242344 20:23581959-23581981 CCCTTCCCTACCCACCCTGGTGG - Intergenic
1171292286 20:23989269-23989291 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1171473408 20:25390141-25390163 CCCTACCCTGCTCTCCCACGCGG + Intronic
1171481418 20:25458403-25458425 TCCTGGCCTGCTCTCCCTGAAGG + Exonic
1172209601 20:33187413-33187435 CCCTTCCCTGCCATTCCTGGAGG - Intergenic
1172759832 20:37314250-37314272 CCCGGCCCTCCTCCCACTGGTGG - Intronic
1172788510 20:37486342-37486364 CCCTGCCCTGCTCTTCCAACTGG - Intergenic
1172916528 20:38447567-38447589 CCCTGATCTGCACTCCCTGAGGG + Intergenic
1172951649 20:38726469-38726491 TCCTGCCCTGGCCTCCCTTGGGG - Intronic
1173000584 20:39102588-39102610 CCCAGCCCTGATCTCCAGGGTGG + Intergenic
1173522876 20:43712269-43712291 CCGTTCCCAGCTCTCCCTTGAGG - Intronic
1173903315 20:46606901-46606923 CTGTGCCCTGCACTTCCTGGGGG - Intronic
1173992489 20:47314106-47314128 CCCTTCCCTGGACTCCCTGCAGG - Intronic
1174040200 20:47694184-47694206 CCATGCCCTGTTCTCTCTGAGGG + Intronic
1174416351 20:50369750-50369772 CCCTTCCCTGCTCTCCCGAGAGG + Intergenic
1174442811 20:50569437-50569459 CCCTGCCCTCCTCACTCTGTTGG + Intronic
1174627546 20:51927924-51927946 CCCTGCTGTCCTCTCCCTGCAGG - Intergenic
1175251655 20:57613615-57613637 CCCCACACTGCTCTCCCTAGGGG + Intronic
1175391958 20:58633112-58633134 GCCTGGCCTGCTCACCATGGTGG - Intergenic
1175458283 20:59131547-59131569 CTCTGCCCTGCACCCCATGGTGG + Intergenic
1175490306 20:59376086-59376108 CATGGCCCTGCCCTCCCTGGCGG - Intergenic
1175562251 20:59940182-59940204 CGCTACCCTGCGCTCCCGGGAGG - Exonic
1175602515 20:60286579-60286601 TCCTGCCCTGCTCTGTCTAGTGG - Intergenic
1175640841 20:60629018-60629040 CCCTGCCATGCTGTCCCTGCCGG - Intergenic
1175766792 20:61597886-61597908 CCCTGCCCTTCAGTCTCTGGTGG - Intronic
1176023732 20:62975387-62975409 CCCTGCCCAGCACTCCCTGCCGG - Intergenic
1176035360 20:63033768-63033790 CCCTGCCCTGTTCTCCAAGATGG + Intergenic
1176117418 20:63439164-63439186 CCCTGCCCTGCCCTGCCCTGGGG + Intronic
1176120246 20:63451219-63451241 CCGTGCTCAGTTCTCCCTGGAGG + Intronic
1176286316 21:5021152-5021174 CCCTGCCCAGCTCTTCCCGCCGG + Intergenic
1176302345 21:5104597-5104619 CCCTGCTGTGGCCTCCCTGGCGG - Intergenic
1176371654 21:6065989-6066011 TGCTGCCCGCCTCTCCCTGGGGG + Intergenic
1176423556 21:6534014-6534036 CCCTGCCCTGCCCTGCCTCCAGG - Intergenic
1178249719 21:30990777-30990799 CCCAGCCCCGCTCCCCCTGCTGG - Intergenic
1178406684 21:32329984-32330006 CTATGCCCTGATCTCACTGGTGG + Intronic
1178813427 21:35905404-35905426 CCCTTGCCAGCTCTCCCCGGGGG - Intronic
1179495558 21:41769363-41769385 ACCTGCACTGCACTCCCAGGCGG - Intergenic
1179515570 21:41904005-41904027 CCCTGGGCTGCACTCCCAGGAGG + Intronic
1179547370 21:42121890-42121912 CCATGCCCTGCCCTCCCTGCTGG - Intronic
1179699050 21:43142330-43142352 CCCTGCCCTGCCCTGCCTCCAGG - Intergenic
1179724094 21:43332104-43332126 CCCTGTCCTGCTGTCTGTGGTGG + Intergenic
1179751865 21:43472550-43472572 TGCTGCCCGCCTCTCCCTGGGGG - Intergenic
1179838360 21:44052958-44052980 CCTTGCCCTGCTCTCTCTCCTGG + Intronic
1179854682 21:44157326-44157348 CCCTGCTGTGGCCTCCCTGGCGG + Intergenic
1179870865 21:44242323-44242345 CCCTGCCCAGCTCTTCCCGCCGG - Intergenic
1179902700 21:44402201-44402223 CCTTGCACTGCTCTTCCTGGGGG - Intronic
1179983908 21:44910746-44910768 CCCCCCACTGCTCGCCCTGGTGG - Exonic
1180169551 21:46050755-46050777 CCCTGCCCAGCTCTGGATGGGGG - Intergenic
1180181979 21:46122101-46122123 GCCTGCCGGGGTCTCCCTGGAGG - Exonic
1180413860 22:12691926-12691948 CTCTGCACTGTTCACCCTGGGGG + Intergenic
1180749233 22:18112973-18112995 CCCTTCACTTCCCTCCCTGGTGG + Intronic
1180823353 22:18847032-18847054 CCCTGCCCCGCTCTCCTTGAGGG - Exonic
1180848448 22:18997476-18997498 CCCTGCCCTGCTGTCCTTCAGGG + Intergenic
1180911729 22:19455534-19455556 CCCTTAGCTGCTCTCCTTGGTGG - Intronic
1180985764 22:19903204-19903226 CCCTGCCCAGGTCCCCGTGGGGG - Intronic
1180998305 22:19976374-19976396 CCCTGCCCTGCTCACCCTCATGG + Intronic
1181030225 22:20145945-20145967 CCCTGGCCTGCTCTGGGTGGTGG + Intronic
1181106945 22:20581276-20581298 CCCTGCCCTCTGCTGCCTGGTGG + Intronic
1181123777 22:20690131-20690153 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1181189390 22:21127514-21127536 CCCTGCCCCGCTCTCCTTGAGGG + Exonic
1181209809 22:21282981-21283003 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1181282247 22:21728240-21728262 CCTTCCCCTCCTCTCCATGGAGG + Intronic
1181399707 22:22643963-22643985 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
1181634274 22:24167108-24167130 CCCTGCCCTGGTCCCTGTGGTGG - Exonic
1181649708 22:24252105-24252127 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1181707664 22:24658641-24658663 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
1181749792 22:24981307-24981329 CCCAGGCCAGCTCTCCTTGGGGG - Intronic
1181997388 22:26893499-26893521 CCCTGCTCAGCTCTGCCTGCTGG - Intergenic
1182143939 22:27985191-27985213 GCCTGCCATGCTCTCCCTGGGGG - Intronic
1182222168 22:28767343-28767365 CCCTGCCCTGAGCTCCTGGGAGG - Intergenic
1182277036 22:29196151-29196173 CCCCTCCGTGCTCTCCCAGGAGG - Intergenic
1183370240 22:37427840-37427862 CCCTGCGCTGCTCACCCCGCGGG + Intergenic
1183616239 22:38947528-38947550 CACTGCCCTGCTCTTACAGGAGG + Intergenic
1183716022 22:39534198-39534220 CACAGCACTGCTCTCCCTGGTGG - Intergenic
1183831422 22:40420277-40420299 CCCTGCTCTGCTTTCCATGACGG + Intronic
1184149778 22:42631273-42631295 GGCTTCCCTGCTCTCCCTGGTGG + Intronic
1184333086 22:43838224-43838246 CCCTGCCCTGCTCTCAAGGAAGG - Intronic
1184473980 22:44710877-44710899 CCCTGCCCTGCCCTGCCCTGCGG - Intronic
1184589719 22:45473787-45473809 ATCTGGCCTGTTCTCCCTGGAGG - Intergenic
1184775059 22:46618966-46618988 CCCTGACCTGGCCTCCCTGCAGG - Intronic
1184850070 22:47114989-47115011 CCCTGCCCAGCAGGCCCTGGAGG - Intronic
1185067751 22:48640531-48640553 CCCTGCCCTGCCCACCCAGCTGG - Intronic
1185272970 22:49937081-49937103 CCCCACCCTGCTCTCCCCGGAGG - Intergenic
1185277401 22:49955758-49955780 CCCTGCAGTGCCTTCCCTGGTGG - Intergenic
1185291909 22:50031499-50031521 GCCTGCCCTGCTCTCCCATGGGG - Intronic
1203217136 22_KI270731v1_random:12452-12474 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
1203273493 22_KI270734v1_random:72938-72960 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
951036458 3:17938319-17938341 GCCTGCCCTGCTCTACCAAGGGG + Intronic
951809862 3:26687082-26687104 CCCTGTCCTGTTCTCAGTGGTGG - Intronic
953512323 3:43554749-43554771 ACCTGTCCTTCTCTCCCTGAAGG - Intronic
953634633 3:44652387-44652409 CTCTGCCCAACTCACCCTGGGGG + Intronic
953983446 3:47424314-47424336 CGCTGCACAGCTCTCCCTGAGGG - Intronic
954003666 3:47576981-47577003 CCCTGCCTGGCTCTCCTGGGCGG + Exonic
954391425 3:50269903-50269925 ACCTGCCTTCCTCTTCCTGGGGG + Intronic
954688158 3:52381844-52381866 CACTGCCCAGCACGCCCTGGAGG - Intronic
954718018 3:52536511-52536533 CCCTGCCGTGCTCTGATTGGCGG + Intronic
956432438 3:69200633-69200655 CTTTGCCCTCCTCTCCCTGATGG - Intronic
960877698 3:122313761-122313783 CCCTTCCCTTCTCTCCCAGGTGG + Intergenic
961596450 3:128021922-128021944 CCCTGCCCTGCCCTGCAAGGAGG + Intergenic
963846143 3:150159841-150159863 CCCTTCCCTGCCTTCCCTGGGGG - Intergenic
963861451 3:150314717-150314739 ACCTGCCCTGCTCTACCTGTTGG + Intergenic
964627294 3:158771883-158771905 CCTTACTCTGGTCTCCCTGGAGG + Intronic
965216200 3:165868115-165868137 CCCTTCACTGAACTCCCTGGAGG + Intergenic
966465319 3:180225246-180225268 CCCTGCCCTGCCCTGCCTGCAGG - Intergenic
966971416 3:185048821-185048843 TTCTGGCCTGCTCTCTCTGGAGG - Intronic
967187877 3:186960899-186960921 CTCTGCCCTGCTCTCTTTGTAGG + Intronic
967833577 3:193942735-193942757 CCATGCTCTGCTCTCACTGGTGG - Intergenic
967834058 3:193945925-193945947 CTCTGCCCTTCTCTCCCTGCAGG - Intergenic
967876718 3:194272593-194272615 TCCTGTCCCGCTCTCCCTGTGGG + Intergenic
968448315 4:663520-663542 CCCCTCCCTGCGCTCCCCGGTGG + Intronic
968462784 4:733573-733595 GCCTGCACTGTCCTCCCTGGGGG + Intronic
968469694 4:773752-773774 CCCTGCCCTGCCCTGCAGGGAGG - Intergenic
968562303 4:1290360-1290382 CCCAGCCCTGGGCTCCCGGGAGG - Intronic
968621557 4:1605582-1605604 CCCATCCCTCCTCTCCCTGCGGG + Intergenic
968921149 4:3522803-3522825 CCCTGCCCTGCTCTGCTCTGGGG - Intronic
968951875 4:3699701-3699723 CACTGAGCTTCTCTCCCTGGAGG + Intergenic
968980707 4:3847955-3847977 CCCTGGCCTGGGCTCCCTGAAGG + Intergenic
969057282 4:4409839-4409861 ACCTGCCCTGCTCTCCAGGTGGG - Intronic
969230210 4:5825340-5825362 CCCGAGCCTGCTCTCACTGGTGG - Intronic
969299919 4:6291760-6291782 CCCTGCTCTGCCTGCCCTGGGGG + Intronic
969333984 4:6495963-6495985 CCCCTCCCGGCTCTCCATGGCGG + Intronic
969689873 4:8698535-8698557 CCCTGCCCTCCTCTGCCTCCTGG - Intergenic
969714353 4:8861171-8861193 CGCTGCCCTCCTCTACCTGCTGG + Intronic
970637168 4:18021914-18021936 CCCTCCCCGCCTCTCCCTGAGGG - Intergenic
970804135 4:20010330-20010352 CCCTGACATGGACTCCCTGGTGG - Intergenic
971265540 4:25093548-25093570 CCCTTCCCTGCTCTCCATTGAGG - Intergenic
976975847 4:91165517-91165539 CCATGCCCTGCTCCCAGTGGTGG + Intronic
978302390 4:107285547-107285569 TTCTGCTCTGCTCTCCTTGGTGG - Intergenic
979470389 4:121089690-121089712 CCATGCCCTGTGCTCCCCGGGGG + Intergenic
983538580 4:168884408-168884430 CACTGCCAAGCTCTCCCTGTAGG + Intronic
984313197 4:178090891-178090913 CCTTGCCCTGCTCTGGCTGGTGG - Intergenic
984462787 4:180058413-180058435 TCCTTTCCTGCTCTCCCCGGGGG - Intergenic
985525685 5:400328-400350 CCATTCCCTGCGGTCCCTGGGGG + Intronic
985535936 5:465789-465811 CCCTTCTCTGCTCTACCTGGAGG + Exonic
985656332 5:1133422-1133444 CCCTGCCCTGCTGGTCCTGGGGG + Intergenic
985773234 5:1825814-1825836 CTCTGCCCGGCTCTCCTTGCGGG + Intergenic
985942656 5:3150894-3150916 ACCTGCCCTGGCCTCCCTGTGGG - Intergenic
987708690 5:21484012-21484034 CCCTGCCCTGCTCTCCTTGAGGG + Intergenic
988750919 5:34190133-34190155 CCCTGCCCTGCTCTCCTTGAGGG - Intergenic
991114261 5:62935851-62935873 CGCTGCCCTGCACTCCCATGTGG - Intergenic
991490861 5:67181435-67181457 GCCTGCCCTGCTTTTCCTGGGGG + Intergenic
991736059 5:69632057-69632079 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991739188 5:69653345-69653367 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991759010 5:69903086-69903108 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
991788326 5:70215036-70215058 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991790763 5:70233086-70233108 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991812558 5:70487696-70487718 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991815515 5:70508173-70508195 CCCTGCCCTGCTCTCCTTGAGGG - Intergenic
991818649 5:70529462-70529484 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991838239 5:70778152-70778174 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
991880773 5:71215400-71215422 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991883210 5:71233421-71233443 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
992394240 5:76357082-76357104 CACTGCCCTTCCCTTCCTGGAGG - Intergenic
992911688 5:81401396-81401418 CACTGCCCTGCTCCCCTGGGAGG + Intergenic
994420822 5:99525362-99525384 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
994486221 5:100388952-100388974 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
994530558 5:100964862-100964884 CCCTGTCCTGCTTTCCCTGGAGG + Intergenic
995181420 5:109234277-109234299 CCCTGCTCTTGTCTCCTTGGTGG + Intergenic
995753789 5:115480274-115480296 CCCTGCCGAGCTTGCCCTGGAGG - Intergenic
996075750 5:119191784-119191806 GCCTTCCCTGCTGACCCTGGTGG + Intronic
997021564 5:130008276-130008298 CTCTGACCTGCTATCACTGGAGG - Intronic
997232079 5:132252796-132252818 CCCTCTGCTGCTCTGCCTGGAGG + Intronic
997474207 5:134133406-134133428 CCCTCCCCTGCTCTCCCTGATGG - Intronic
999311622 5:150555302-150555324 CCCTGTCGTGTTCTCCCTCGAGG + Exonic
999977855 5:156929656-156929678 CACAGCCATGCTCTCCTTGGAGG - Intronic
1001287660 5:170435551-170435573 CCTTGCCATTCTCTCCCAGGAGG + Intronic
1001705079 5:173735650-173735672 CCCTTCCTTGCCCTCCCTGCCGG - Intergenic
1001779755 5:174357752-174357774 TCCTGGCCTGCTCTCCCTTAAGG - Intergenic
1002164693 5:177337086-177337108 CCCAGCCCAGCTCACCCTGAGGG - Intronic
1002329652 5:178432799-178432821 CCCTCCCCTGCTCTTCCTTGAGG + Intronic
1002484033 5:179522816-179522838 GCCTGCCCTGCTGTCCCTAGAGG - Intergenic
1002500530 5:179644665-179644687 GCCTGCCCTGCTGTCCCTAGAGG + Intronic
1002661390 5:180792980-180793002 CCCTGGCCTGCCCTCCCCGGTGG - Exonic
1003652099 6:7970256-7970278 CTGTCCCCTCCTCTCCCTGGAGG - Intronic
1003727822 6:8785878-8785900 CTCTGCCCTCCTCCCCCAGGGGG - Intergenic
1004434442 6:15577115-15577137 GCCTGTCCTGCTCTTCCTGTAGG - Intronic
1004503312 6:16227756-16227778 CCCTGCTCTGCTCACTCCGGAGG - Intergenic
1004650063 6:17600232-17600254 CCCTTCCCAGCTCCGCCTGGCGG + Intergenic
1005548996 6:26896438-26896460 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1006098241 6:31669556-31669578 CCCTGTCCTCCCCTCTCTGGGGG - Intronic
1006155184 6:32009869-32009891 CCCTGCTCTCCTCTCCCAGGTGG - Intergenic
1006161490 6:32042603-32042625 CCCTGCTCTCCTCTCCCAGGTGG - Exonic
1006375780 6:33671021-33671043 CCCTGCTCCGCTCTCCCTCCTGG + Intronic
1006378348 6:33684100-33684122 GCCTGAGCTGCTCTTCCTGGAGG + Exonic
1006436142 6:34027065-34027087 CCCTTCCCCGCTCTGCATGGGGG + Intronic
1006474849 6:34247145-34247167 CCCTCCCCTGCTCCCCAGGGTGG - Exonic
1006803079 6:36771749-36771771 CCCTCCCCTGCCTACCCTGGAGG + Intronic
1006918652 6:37613355-37613377 ACCTTCCTTGCTCTGCCTGGGGG - Intergenic
1007633190 6:43283908-43283930 CCCTGTCCTGCTCTCTGAGGAGG + Exonic
1007687246 6:43674168-43674190 CCCTGCCTCTCTGTCCCTGGGGG - Intronic
1007761998 6:44138752-44138774 CCCTGCCCTGCCCCACCTTGAGG + Intronic
1008331812 6:50254587-50254609 CACTGCCATGCTCTCCCTTCAGG - Intergenic
1008583345 6:52926067-52926089 CCCTGCTCTGGTCACTCTGGAGG + Intergenic
1008647515 6:53530189-53530211 CCCTGTCGTCCTGTCCCTGGAGG - Intronic
1009019746 6:57937548-57937570 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1009324822 6:62337638-62337660 CCCTGAGCTGCTCTCCATGTTGG - Intergenic
1009636077 6:66266101-66266123 CACTGCACTCCTCTCCCTCGTGG + Intergenic
1014100830 6:117509755-117509777 CCCTACCCTACTCCTCCTGGTGG + Intronic
1014254634 6:119148519-119148541 CCCGCCCCTGCTCTGCCTGCAGG + Intronic
1015859994 6:137665816-137665838 CCCTTCCCTATTTTCCCTGGTGG + Intergenic
1016040135 6:139424250-139424272 ACCTGCCCTGCTCATCATGGTGG + Intergenic
1016657914 6:146543287-146543309 TCCTGCCCTACTCTCCCCGCAGG - Intergenic
1016761174 6:147739135-147739157 CACTGCCCTGCTCTGTCTGAAGG - Intergenic
1016891832 6:149014908-149014930 CACTTCCTTGCTCTCCTTGGAGG - Intronic
1016892123 6:149016964-149016986 CCCTGCCCTGCTCACATTTGAGG - Intronic
1017760373 6:157563398-157563420 CCTTGCCCTGCTCTGACTTGGGG + Intronic
1018053297 6:160030271-160030293 CCCTACCCCTCCCTCCCTGGGGG - Intronic
1018169277 6:161131580-161131602 CCCTGCCCTGCCCCCCCAGCAGG - Exonic
1018392242 6:163349537-163349559 CCAGGCCCTGGTCTCTCTGGGGG + Intergenic
1018684894 6:166296734-166296756 CTCTGCCCTGCCAGCCCTGGAGG - Intergenic
1018874426 6:167807426-167807448 CTCCGCCCTGCACTCCCAGGTGG - Intergenic
1018905261 6:168072204-168072226 CCCTGCCCTGCACCCCCTGCTGG + Intronic
1019162277 6:170076592-170076614 CCCTGCCCTGGGCTCCCTGCTGG + Intergenic
1019304679 7:327618-327640 CCCTGCCCTGGCCTCCAGGGTGG + Intergenic
1019576362 7:1739567-1739589 CTCTCCCCAGCTCTCCCAGGGGG - Intronic
1019596444 7:1860606-1860628 AGCTGCCCAGCTCTGCCTGGGGG + Intronic
1019641395 7:2105666-2105688 CACAGCCCTGCTTTACCTGGTGG + Intronic
1019999085 7:4744727-4744749 ACCTGCCCTGCTCTTGCTGCGGG + Intronic
1020212361 7:6166308-6166330 ACCTGCCCTCCTCTCCCTAAGGG + Intronic
1021362718 7:19735674-19735696 ACCTTGCCTGCTCTCCCTGCCGG - Intronic
1021651126 7:22834582-22834604 TGCTGCGCTGTTCTCCCTGGAGG + Intergenic
1022008895 7:26292056-26292078 CCCTGCTCTGTTCTGCCCGGAGG + Exonic
1022801237 7:33779467-33779489 CTCTTCCCTGCTCTTCCTCGTGG - Intergenic
1022993008 7:35726713-35726735 TCCTGCCCTGTGCTGCCTGGTGG - Intergenic
1023169191 7:37374250-37374272 CCCTCTCCTTCTCTCCCTGTGGG - Intronic
1023882522 7:44328341-44328363 CCACAGCCTGCTCTCCCTGGTGG - Intronic
1023990529 7:45125788-45125810 CCCTACCTTGCTTTCCCTTGAGG - Intergenic
1024655991 7:51451767-51451789 CCATGCCCTGGTCTCCCTCCAGG - Intergenic
1025026619 7:55521726-55521748 CCCTGCCCTGCCCTGCCCTGTGG - Intronic
1025078672 7:55964478-55964500 GCGCGCCCTGCTCCCCCTGGCGG + Intronic
1025941905 7:66081241-66081263 CCCTGCCATCATCTCCTTGGAGG + Intronic
1026045291 7:66902554-66902576 CCCTGCCTTCAGCTCCCTGGCGG + Intergenic
1026989064 7:74573001-74573023 CCCTGCCCTTTTCTGGCTGGTGG + Intronic
1027172005 7:75879151-75879173 CACTGCGCTGCTCTCGCTGCTGG + Exonic
1029172962 7:98643771-98643793 CCCAGCCCTGCTGTGCCAGGTGG + Intergenic
1029460900 7:100693684-100693706 CCCTGCCCTGGGCCGCCTGGGGG - Intergenic
1029496083 7:100895973-100895995 CCCCTCCCCGCTCTCCCGGGTGG + Intronic
1030348277 7:108456539-108456561 CCCTCCCCCGCACTCCCTGCGGG + Intronic
1031111802 7:117619741-117619763 GCCTTCCCTGCTCACCCTGGTGG - Intronic
1031682098 7:124687792-124687814 CCCTTCACTGCTTTCCTTGGTGG - Intergenic
1032090478 7:128909242-128909264 CCCTGCCCATCCCTGCCTGGAGG - Intronic
1033600197 7:142883828-142883850 CCCTGCCCTGATCTCCTTACTGG - Intronic
1033653545 7:143359407-143359429 CCCATCCCAGCTCTCCATGGAGG - Exonic
1033679930 7:143584005-143584027 CCCTTTCCTCCTCTCCCTAGAGG - Intergenic
1033691904 7:143745438-143745460 CCCTTTCCTCCTCTCCCTAGAGG + Intergenic
1033730883 7:144178464-144178486 CCCTTTCCTCCTCTCCCTAGAGG + Intergenic
1033857564 7:145583181-145583203 CTCTGCCCTGGTCTCCGCGGAGG - Intergenic
1034439848 7:151081012-151081034 CCGTGCCCTTCTCTCCCAAGGGG + Intergenic
1034441283 7:151087149-151087171 CCTGGCCATGCTCTCCCTGTCGG + Intronic
1035037379 7:155904033-155904055 CCCTCCCCTGGTGTCCCTGCAGG - Intergenic
1035044714 7:155956100-155956122 GCCCTCCCTGCTCTCCATGGTGG + Intergenic
1035242213 7:157539693-157539715 CCCTGATCTCCTCTCCCGGGAGG + Exonic
1035497970 8:69440-69462 CCTTGGCCTCCTCTCCCAGGAGG + Intergenic
1035550190 8:517293-517315 CCCTGCCCAGCTGTCTCTTGTGG + Intronic
1035868698 8:3113108-3113130 CCCTGCCTTCCTTTCCCTGAAGG + Intronic
1036028634 8:4940124-4940146 CCCCTCCCTGCTCTCACAGGGGG - Intronic
1036474450 8:9080565-9080587 CCCTGCCCTGATTTTCCTGCAGG + Intronic
1036517476 8:9458182-9458204 CCCTGAGCTTCTCTTCCTGGTGG + Intergenic
1036548912 8:9799729-9799751 CCCTGCCCTGGCCTCCTTGTGGG - Intergenic
1036626242 8:10474522-10474544 CCCTGGCATGCTCCCCCTGGTGG + Intergenic
1037319588 8:17630638-17630660 CCCTCCCCTCCCCTCCCTGCTGG + Intronic
1037737862 8:21581447-21581469 CGCTGCCAGGCTCACCCTGGGGG - Intergenic
1037787568 8:21911865-21911887 GGCTGCCCTGCTCTCCCCTGGGG - Intronic
1037802099 8:22041417-22041439 CCCTTCCCTTCCCACCCTGGGGG + Intergenic
1037839089 8:22231541-22231563 CCCCACCCTGCTGTCCCTGTTGG + Intronic
1037931130 8:22880955-22880977 TCCTGCTCTGCTCTGCCTGGGGG + Intronic
1038118490 8:24584800-24584822 CTCTGCCCTGCTCCCCCAAGTGG + Intergenic
1038272218 8:26084494-26084516 CGCTGCCCTGCCCTCACTGGGGG - Intergenic
1038456685 8:27676342-27676364 TCCTGCACTGCTCTCACTGGTGG - Intronic
1038467102 8:27774427-27774449 CCTTGCCCCGCCCACCCTGGTGG - Exonic
1040020542 8:42737045-42737067 CCCTGCACTGGCCTCCTTGGTGG + Exonic
1040290151 8:46120090-46120112 TGCTGCCCTGCTTTCCCTTGTGG + Intergenic
1040307451 8:46219549-46219571 TCCTCCCCTGCTGTCCCAGGTGG - Intergenic
1040980837 8:53244868-53244890 TCCTGCCTTGGTATCCCTGGGGG + Intronic
1042499347 8:69491798-69491820 CCTTGCGTTGTTCTCCCTGGTGG - Intronic
1044703646 8:94987416-94987438 CTCTTCCCTCCTCTCCCTTGGGG + Intronic
1045017304 8:98010658-98010680 GCCAGGCCTGCTCTCCTTGGAGG + Intronic
1045063598 8:98427417-98427439 CCCGGCCCAGGTCTCCCTGCCGG - Intronic
1045063928 8:98428915-98428937 CACTGGCCTCCGCTCCCTGGGGG + Exonic
1046775228 8:118157404-118157426 TCCTGACCTTCTGTCCCTGGAGG - Intergenic
1047766118 8:127991519-127991541 CCATGCCCTGCTGCACCTGGAGG + Intergenic
1048442530 8:134470277-134470299 CTGTTCCCTGCTCTCCCTGATGG - Intergenic
1048461534 8:134625499-134625521 TCCTGCCCTGCTCCCTCTGCAGG + Intronic
1048866301 8:138764222-138764244 CCCTGCCCTGCCATCCCCAGAGG - Intronic
1049185667 8:141251355-141251377 CCTTGCCCTGCTCTCCATGAAGG + Intronic
1049272136 8:141701442-141701464 CCCTGTGCTGGTCACCCTGGGGG + Intergenic
1049277373 8:141726511-141726533 CCCTGCCCTTCTTCCTCTGGGGG - Intergenic
1049292557 8:141812387-141812409 CCCCGCCCTCCCCGCCCTGGAGG - Intergenic
1049396632 8:142403849-142403871 CCTTTCCCTGCTCTGCCTGCGGG + Intergenic
1049478727 8:142809996-142810018 CCCTGGCTTCCTCTGCCTGGGGG + Intergenic
1049504116 8:142985744-142985766 CCCTGCCCTCCTGGCCTTGGTGG + Intergenic
1049536870 8:143186502-143186524 CCCTGCCCAGGTGTCCCAGGAGG + Intergenic
1049711031 8:144063388-144063410 CCCAGCCCTGCGCTCTCTGGTGG - Intronic
1049745847 8:144262961-144262983 CCCTGCCCGGCCCTTCCTGTTGG - Exonic
1049758409 8:144320948-144320970 CTCCACCCTGCCCTCCCTGGAGG + Intronic
1049778704 8:144417839-144417861 CCCAGCCCTGCCCTCTCTGTGGG + Intergenic
1049927529 9:423984-424006 CTCAGCCCTGCGCTACCTGGTGG + Intronic
1050450347 9:5774087-5774109 CCCTGCTCTCCTCTGCCCGGGGG - Exonic
1051265611 9:15306540-15306562 CCCTGCCCTGCTGTCGCGGCAGG + Intronic
1053239821 9:36487074-36487096 TCCTGCCCTGCACACCCTGGGGG + Intronic
1053739296 9:41123786-41123808 CCCTCCCCTGGACTCCCTGCGGG - Intergenic
1054459708 9:65456076-65456098 CCACCCACTGCTCTCCCTGGAGG - Intergenic
1054689054 9:68307536-68307558 CCCTCCCCTGGACTCCCTGCGGG + Intergenic
1054765749 9:69041135-69041157 CACTGCCCTGTCCTCCCTGGAGG + Intronic
1054869875 9:70039416-70039438 CTATGCCCTGCTCTCTCTGTGGG - Intergenic
1056532361 9:87498388-87498410 CCCTCCCTTGCTCCCCCGGGCGG + Intronic
1056577814 9:87869323-87869345 CCCTCCATGGCTCTCCCTGGGGG - Intergenic
1056606915 9:88093434-88093456 CCCTGCCCTGACTTCCCTGTGGG + Intergenic
1056762619 9:89425899-89425921 CTCTGCCCTGGTGTCCCTGGAGG - Intronic
1056791403 9:89627620-89627642 CCCTGCTCTGCCTTCCCTGGGGG + Intergenic
1056791581 9:89628624-89628646 CCCTGGCCTGGGCTCCCTGGTGG + Intergenic
1057047932 9:91900208-91900230 CCCTGCCCCCCACCCCCTGGCGG - Intronic
1057105414 9:92410492-92410514 CCCTGCCATCCTCACCCTGGTGG + Intronic
1057801904 9:98195915-98195937 CCCTTCCCTGCTCTTTCTGGAGG - Intergenic
1059409833 9:114124892-114124914 CCCTGCCCTCCCCACTCTGGAGG + Intergenic
1059437716 9:114286504-114286526 CCCATCCCTGCTCACCGTGGGGG + Intronic
1059695256 9:116724428-116724450 CCCTTCCCTTTTGTCCCTGGGGG - Intronic
1060828790 9:126701132-126701154 TCCGGACCTGCTGTCCCTGGTGG - Intergenic
1060868094 9:127015832-127015854 CCCTGCCCTGCTCCACTTGGAGG + Intronic
1060868772 9:127022403-127022425 CTCTGCCGTGCTCTCCCTCATGG + Intronic
1060915268 9:127385138-127385160 CCCAGTCCTACTCACCCTGGAGG - Exonic
1060987695 9:127829033-127829055 CCCTGACCTCCTCTCTCTGGTGG + Intronic
1061038251 9:128125333-128125355 CCATGCCCTGCCCTACCAGGTGG - Exonic
1061208613 9:129178130-129178152 CCCTGCCCGGCGCGCCCCGGCGG - Exonic
1061422946 9:130481995-130482017 TCCCTCCCAGCTCTCCCTGGAGG - Intronic
1061727584 9:132589937-132589959 CACTCCCCTTCTCTCCCTGGCGG - Exonic
1061744776 9:132731443-132731465 CCCTGCCCTGCCCTCAGTGTTGG + Intronic
1062029790 9:134357002-134357024 GCCTCCCCGGCTCTGCCTGGGGG - Intronic
1062160149 9:135075481-135075503 CCCTGCCCAGCCCTGCCCGGAGG + Intronic
1062172774 9:135144684-135144706 CCCTCCCCGGCTCCCCATGGTGG + Intergenic
1062195778 9:135273213-135273235 CCCAGCCCTGCACTTCCTGAGGG - Intergenic
1062200945 9:135302351-135302373 CCCTCCCCTCCACTCCCTGTCGG + Intergenic
1062276239 9:135732844-135732866 CCATGCCCTTCTCCCACTGGGGG + Intronic
1062397098 9:136356931-136356953 CCCTGCCCTCCCCACTCTGGGGG - Intronic
1062414597 9:136441861-136441883 CCGAGCACTGCTCACCCTGGGGG - Intronic
1062452809 9:136622618-136622640 CCCGCCCGTGCCCTCCCTGGTGG - Intergenic
1062460282 9:136660056-136660078 CCCTGCCCTGGCCGCTCTGGTGG - Intronic
1062503066 9:136859477-136859499 CTCTGCCCTGCTCACCCCTGGGG + Intronic
1062562077 9:137146190-137146212 CCATGCCCCTCGCTCCCTGGAGG + Intronic
1062712874 9:137986231-137986253 CCCTGGACTTCTCTCCCTGAGGG - Intronic
1203785064 EBV:122997-123019 CCCTAACCTGCTCCCCCCGGTGG - Intergenic
1186369047 X:8927835-8927857 CCCCGCAGCGCTCTCCCTGGTGG + Intergenic
1187149340 X:16667883-16667905 CCCTGCCCTGCTCTCTGTCAGGG - Intronic
1187200576 X:17130189-17130211 CCTCACCCTGCTTTCCCTGGAGG - Intronic
1187238784 X:17493883-17493905 CCCTGCCCTGCCCTCCTGGTTGG - Intronic
1187883166 X:23864923-23864945 CACTTCTCGGCTCTCCCTGGAGG - Intronic
1190456809 X:50635181-50635203 CCCTGCGCTGCTCTCCATTGAGG + Exonic
1190652852 X:52583406-52583428 CCCAGCCCTGATCCCCCTTGAGG - Intergenic
1191813405 X:65216667-65216689 CCCTGCACTGCACTGCCTGGTGG - Intergenic
1192946541 X:75969528-75969550 CCCTGCCCTGTCCTCACTTGGGG - Intergenic
1194496588 X:94623790-94623812 TCCTGGCCTGCTGTCCTTGGTGG - Intergenic
1195614254 X:106900375-106900397 CCCTGCCCTGCTCTGCTTCCTGG + Exonic
1198459232 X:136847344-136847366 GCCTGCCCCGCTCCCCCGGGTGG - Intergenic
1198641460 X:138760505-138760527 CCCTCCCCTGCCCACCTTGGTGG - Intronic
1199719099 X:150529373-150529395 CCCTGCACTGCTTCCCCAGGGGG - Intergenic
1199930095 X:152509160-152509182 CCCTTCCCTTCTTTCCCTAGGGG - Intergenic
1199978996 X:152910910-152910932 CTCTGCCCTGCTCTCTGTGAAGG + Intergenic
1199991882 X:152992037-152992059 TCCTGCCCTCTTCTGCCTGGAGG - Exonic
1200047485 X:153410513-153410535 CCCTGCACTGGGCCCCCTGGGGG + Intergenic
1200089199 X:153626453-153626475 CCCTGCACTGGGCCCCCTGGGGG - Intergenic
1200096854 X:153668613-153668635 CTCCAGCCTGCTCTCCCTGGTGG + Intergenic
1200145385 X:153923610-153923632 CTCTGCCCTGCTCTGTCGGGAGG - Intronic
1200145475 X:153924169-153924191 CCCTGCCCTGCTTCCCCCAGAGG + Intronic
1200259017 X:154602224-154602246 CCCTGGCCGGCCCTCCCTGCGGG - Intergenic