ID: 1102078360

View in Genome Browser
Species Human (GRCh38)
Location 12:110078036-110078058
Sequence TGGTTCCCTAGTGGTTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102078360 Original CRISPR TGGTTCCCTAGTGGTTGGGT AGG (reversed) Intergenic