ID: 1102079311

View in Genome Browser
Species Human (GRCh38)
Location 12:110085215-110085237
Sequence GTTTAGGGTTGCAGAAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102079311_1102079320 26 Left 1102079311 12:110085215-110085237 CCAGGTCTTCTGCAACCCTAAAC No data
Right 1102079320 12:110085264-110085286 TAAGGCTCTCCTAATGGTGGAGG No data
1102079311_1102079317 8 Left 1102079311 12:110085215-110085237 CCAGGTCTTCTGCAACCCTAAAC No data
Right 1102079317 12:110085246-110085268 GAGATAGATGAGGAAAACTAAGG No data
1102079311_1102079321 27 Left 1102079311 12:110085215-110085237 CCAGGTCTTCTGCAACCCTAAAC No data
Right 1102079321 12:110085265-110085287 AAGGCTCTCCTAATGGTGGAGGG No data
1102079311_1102079316 -2 Left 1102079311 12:110085215-110085237 CCAGGTCTTCTGCAACCCTAAAC No data
Right 1102079316 12:110085236-110085258 ACAAAGGCTGGAGATAGATGAGG No data
1102079311_1102079318 20 Left 1102079311 12:110085215-110085237 CCAGGTCTTCTGCAACCCTAAAC No data
Right 1102079318 12:110085258-110085280 GAAAACTAAGGCTCTCCTAATGG No data
1102079311_1102079319 23 Left 1102079311 12:110085215-110085237 CCAGGTCTTCTGCAACCCTAAAC No data
Right 1102079319 12:110085261-110085283 AACTAAGGCTCTCCTAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102079311 Original CRISPR GTTTAGGGTTGCAGAAGACC TGG (reversed) Intergenic
No off target data available for this crispr