ID: 1102080115

View in Genome Browser
Species Human (GRCh38)
Location 12:110091067-110091089
Sequence CAGGCTAGTCATTCAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102080115_1102080124 12 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080124 12:110091102-110091124 AAGGAACTCTGGGTTCCCAGGGG No data
1102080115_1102080125 18 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080125 12:110091108-110091130 CTCTGGGTTCCCAGGGGATCTGG No data
1102080115_1102080121 2 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080121 12:110091092-110091114 CTACACGTGGAAGGAACTCTGGG No data
1102080115_1102080123 11 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080123 12:110091101-110091123 GAAGGAACTCTGGGTTCCCAGGG No data
1102080115_1102080117 -7 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080117 12:110091083-110091105 TAGCCTGTCCTACACGTGGAAGG No data
1102080115_1102080122 10 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080122 12:110091100-110091122 GGAAGGAACTCTGGGTTCCCAGG No data
1102080115_1102080127 22 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080127 12:110091112-110091134 GGGTTCCCAGGGGATCTGGGCGG No data
1102080115_1102080120 1 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080120 12:110091091-110091113 CCTACACGTGGAAGGAACTCTGG No data
1102080115_1102080126 19 Left 1102080115 12:110091067-110091089 CCTGGAACTGAATGACTAGCCTG No data
Right 1102080126 12:110091109-110091131 TCTGGGTTCCCAGGGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102080115 Original CRISPR CAGGCTAGTCATTCAGTTCC AGG (reversed) Intergenic
No off target data available for this crispr