ID: 1102082850

View in Genome Browser
Species Human (GRCh38)
Location 12:110112416-110112438
Sequence ATCCAGCTGGAGGTCCGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102082850_1102082855 13 Left 1102082850 12:110112416-110112438 CCCACACGGACCTCCAGCTGGAT No data
Right 1102082855 12:110112452-110112474 TGATCCCAGCAGATACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102082850 Original CRISPR ATCCAGCTGGAGGTCCGTGT GGG (reversed) Intergenic
No off target data available for this crispr