ID: 1102084487

View in Genome Browser
Species Human (GRCh38)
Location 12:110124653-110124675
Sequence CACCCGACCGGGCCTCTAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 49}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102084487_1102084505 15 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084505 12:110124691-110124713 CCTGTCCCGAGCCCGGGGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 203
1102084487_1102084503 14 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084503 12:110124690-110124712 CCCTGTCCCGAGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 210
1102084487_1102084501 13 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084501 12:110124689-110124711 CCCCTGTCCCGAGCCCGGGGAGG 0: 1
1: 0
2: 1
3: 24
4: 247
1102084487_1102084498 9 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084498 12:110124685-110124707 CTGTCCCCTGTCCCGAGCCCGGG 0: 1
1: 0
2: 1
3: 31
4: 363
1102084487_1102084499 10 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084499 12:110124686-110124708 TGTCCCCTGTCCCGAGCCCGGGG 0: 1
1: 0
2: 0
3: 14
4: 196
1102084487_1102084511 29 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084511 12:110124705-110124727 GGGGAGGGGGACACTATTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 152
1102084487_1102084497 8 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084497 12:110124684-110124706 CCTGTCCCCTGTCCCGAGCCCGG 0: 1
1: 0
2: 2
3: 34
4: 326
1102084487_1102084506 16 Left 1102084487 12:110124653-110124675 CCCGCTAGAGGCCCGGTCGGGTG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1102084506 12:110124692-110124714 CTGTCCCGAGCCCGGGGAGGGGG 0: 1
1: 0
2: 3
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102084487 Original CRISPR CACCCGACCGGGCCTCTAGC GGG (reversed) Exonic
912538784 1:110396653-110396675 CACCCACCCGGAACTCTAGCTGG + Intergenic
1073822753 10:107283787-107283809 CACACACCCGGGCCTGTAGCGGG + Intergenic
1077335753 11:2003208-2003230 CTCCCAACAGGGCCTCCAGCAGG - Intergenic
1077460231 11:2705447-2705469 CACCCAACCAGGCCCCAAGCAGG - Intronic
1081324489 11:41728399-41728421 CACCCACCCGGAACTCTAGCTGG + Intergenic
1202818737 11_KI270721v1_random:58390-58412 CTCCCAACAGGGCCTCCAGCAGG - Intergenic
1096021647 12:48330073-48330095 AAACCGACCGGACATCTAGCGGG + Exonic
1102001375 12:109559824-109559846 CACCCTCCTGGGCCGCTAGCCGG - Intronic
1102084487 12:110124653-110124675 CACCCGACCGGGCCTCTAGCGGG - Exonic
1103926763 12:124427594-124427616 CACCCGACCTGACCCCTGGCTGG - Intronic
1108336247 13:49444536-49444558 CCCCCGACAGTTCCTCTAGCCGG + Exonic
1118827679 14:69398738-69398760 CACTCGACCGGGCCTTGACCCGG - Exonic
1129221943 15:74136247-74136269 CACCCGACCCAGACCCTAGCTGG + Exonic
1130882051 15:88063654-88063676 CACTGAACCAGGCCTCTAGCAGG + Intronic
1131710817 15:95054316-95054338 CACCGCACCCGGCCTCTAGTTGG + Intergenic
1136246736 16:28980561-28980583 CACCGCACCCGGCCTCTAGGGGG - Intronic
1139429831 16:66905165-66905187 CACCCACCCAGGACTCTAGCTGG - Intergenic
1139453999 16:67056966-67056988 CACCATGCCCGGCCTCTAGCAGG + Intronic
1153457487 18:5296118-5296140 AACCCGACCGGGTCTCTAAGTGG + Intronic
1153835424 18:8959618-8959640 CACCTGACCGGGCCTCTCAGGGG + Intergenic
1161138139 19:2632908-2632930 CACCCGCCTGGGCCTCTGCCTGG + Intronic
1162809681 19:13156174-13156196 CCCCCGCCCGGGCCTCTTGGGGG + Intergenic
1164606407 19:29601702-29601724 CACCGTACCTGGCCTCTAGTAGG - Intergenic
1167277929 19:48550120-48550142 CACCCCACCAGGCCTCCGGCTGG - Intergenic
931179516 2:59885516-59885538 CCCCCGACCGAGCCTCCAGTGGG + Intergenic
935332507 2:101987465-101987487 CACCTGGCAGGGCCTCCAGCAGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
945870190 2:215219103-215219125 CACCCACCCGGAACTCTAGCTGG - Intergenic
946402152 2:219473740-219473762 CACCGGCCCGTGCCTCTAGGAGG - Exonic
948207204 2:236168517-236168539 CACCCAAGCTGGCCTCGAGCGGG + Intergenic
949006954 2:241655147-241655169 CACCCGACCCAGCCTCCAGACGG - Intronic
1176189358 20:63800608-63800630 CACCCACCCGGAACTCTAGCTGG - Intronic
1178566619 21:33692308-33692330 CACCCTACCTGGATTCTAGCTGG + Intronic
1179929406 21:44557541-44557563 CACCCGGCCCGGCCTCTCCCTGG - Intronic
1184532555 22:45065550-45065572 CACCGCACCGGGCCTCCAGTGGG + Intergenic
961461984 3:127056422-127056444 CACCCATCCGGAACTCTAGCTGG + Intergenic
974892320 4:67896875-67896897 CACCCACCCGGAACTCTAGCTGG + Intergenic
994949817 5:106446992-106447014 CACCGTGCCTGGCCTCTAGCAGG + Intergenic
1004129118 6:12902132-12902154 CACCAGGCCTGGCCTATAGCAGG - Intronic
1020239505 7:6382237-6382259 CACCCGCCTTGGCCTCTTGCTGG + Intronic
1021513839 7:21461559-21461581 CACCCACCCGGAACTCTAGCTGG + Intronic
1025819141 7:64946957-64946979 CCCCCTGCTGGGCCTCTAGCCGG + Intergenic
1028621772 7:92834818-92834840 GACTGGACCGGGCCTTTAGCCGG - Intronic
1029708500 7:102287378-102287400 TACCCGGCCGGGGCCCTAGCAGG - Intronic
1033741602 7:144280196-144280218 CTCATGACCGTGCCTCTAGCTGG + Intergenic
1033752299 7:144369418-144369440 CTCATGACCGTGCCTCTAGCTGG - Intronic
1035167494 7:157000240-157000262 AAGCCGGCCGGGCCTCCAGCTGG - Intronic
1051477965 9:17529598-17529620 CACACGCCGGGGCCTATAGCGGG - Intergenic
1061968302 9:134028893-134028915 CTGCCGACCAGGCCTCTGGCAGG - Intergenic
1199264934 X:145818394-145818416 CACCGCACCAGGCGTCTAGCAGG + Exonic