ID: 1102087059

View in Genome Browser
Species Human (GRCh38)
Location 12:110150365-110150387
Sequence CCGCACCCGGCCATGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102087055_1102087059 7 Left 1102087055 12:110150335-110150357 CCAAAGTGCTGGAATTACAGGTG 0: 2937
1: 78215
2: 214265
3: 253644
4: 202709
Right 1102087059 12:110150365-110150387 CCGCACCCGGCCATGTTTTTAGG 0: 1
1: 1
2: 4
3: 24
4: 197
1102087054_1102087059 8 Left 1102087054 12:110150334-110150356 CCCAAAGTGCTGGAATTACAGGT 0: 3111
1: 86006
2: 313232
3: 241847
4: 148165
Right 1102087059 12:110150365-110150387 CCGCACCCGGCCATGTTTTTAGG 0: 1
1: 1
2: 4
3: 24
4: 197
1102087052_1102087059 11 Left 1102087052 12:110150331-110150353 CCTCCCAAAGTGCTGGAATTACA 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954
Right 1102087059 12:110150365-110150387 CCGCACCCGGCCATGTTTTTAGG 0: 1
1: 1
2: 4
3: 24
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102087059 Original CRISPR CCGCACCCGGCCATGTTTTT AGG Intronic
900304342 1:1996628-1996650 CCGCACCCGGCCAGTATTTCAGG - Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901467417 1:9431326-9431348 CCGCACCTGGCCATACTTTGTGG + Intergenic
904002193 1:27345199-27345221 CCATACCCGGCCAAGTGTTTGGG + Exonic
904822361 1:33254409-33254431 CTGCACCCGGCCGTGTCTTTAGG + Intergenic
906314885 1:44780096-44780118 CCGCACCCGGCCTGCTTTTTGGG + Intergenic
906624167 1:47311438-47311460 CTGCACCCGGCTAATTTTTTTGG + Intronic
908259831 1:62331424-62331446 CCGCGCCCAGCCTAGTTTTTTGG + Intergenic
908758207 1:67488357-67488379 CCACACCCGGCTGTATTTTTTGG - Intergenic
909133905 1:71772403-71772425 CCCCACCCCTCCTTGTTTTTTGG - Intronic
909159949 1:72134492-72134514 CCGCACCTGGCTATTTTTTGGGG + Intronic
910937504 1:92496941-92496963 CCATACCCGGCCATGTTCCTTGG + Intergenic
911198491 1:95019925-95019947 CCACACCCGGCCATGTATCATGG - Intronic
912836847 1:113004146-113004168 CTGCACCCGGACTTTTTTTTGGG + Intergenic
915951610 1:160193138-160193160 CAGCACCTAGCCATGTTTTAAGG - Intronic
918348675 1:183631287-183631309 CCACACCCGGCCGTTTTGTTGGG - Intronic
920017076 1:202920664-202920686 CCGCGCCCGGCCAATTTTGTTGG + Intronic
922237020 1:223729710-223729732 CCGCACCCGGCCTTGATTCCAGG - Intronic
922507809 1:226136584-226136606 CTGCACCCGGCCCTCTTTCTGGG - Intergenic
924364971 1:243283136-243283158 CCGCACCCGGCCTGATTTTTGGG + Intronic
1064800476 10:19064995-19065017 CCGCACCCGGCCCTTTTCTAGGG - Intronic
1065934358 10:30507713-30507735 CCGCTCCCGGCCTTATTTATTGG + Intergenic
1066381992 10:34909924-34909946 CGGCACCTGGCCTTGTCTTTAGG - Intergenic
1066384778 10:34932781-34932803 CCGCATCCGGCCAAGCTGTTTGG + Intergenic
1068528227 10:58155444-58155466 CTGAACTTGGCCATGTTTTTAGG - Intergenic
1074807826 10:117071746-117071768 CCGCACCCAGCCAGGATTCTAGG - Intronic
1075547707 10:123367886-123367908 CCGCTCCCGGCCTAGTTTTCAGG - Intergenic
1081893530 11:46565549-46565571 CCACACCCGGCTAATTTTTTTGG - Intronic
1081904044 11:46655107-46655129 CTGCGCCCGGACCTGTTTTTTGG - Intronic
1085240848 11:75053849-75053871 CCGCACCCGGCTAATTTTTTTGG + Intergenic
1087760343 11:102098575-102098597 CCGTGCCCGGCCTTTTTTTTTGG - Intergenic
1088229981 11:107663638-107663660 CAGCAGCCGGCCATGTGTGTTGG + Intronic
1091412201 12:250853-250875 CTGCGCCAGGCCCTGTTTTTAGG - Intronic
1092191187 12:6522222-6522244 CTGCACCCGGCCATGGATCTTGG + Intronic
1093346959 12:18049742-18049764 CCACACCCGGCTAATTTTTTTGG - Intergenic
1096002129 12:48138882-48138904 CCACACCCGGCTAATTTTTTTGG - Intronic
1096811980 12:54176514-54176536 CCGTGCCCGGCCTTTTTTTTTGG - Intronic
1097668112 12:62504535-62504557 CCGCACCCGGCCTGTTTTTATGG + Intronic
1101936347 12:109061073-109061095 CTGCACCCAGCCATGTTCATGGG + Intronic
1102085648 12:110137055-110137077 CTGCACCCGGCCATCTGGTTAGG - Intronic
1102087059 12:110150365-110150387 CCGCACCCGGCCATGTTTTTAGG + Intronic
1102115911 12:110403030-110403052 CCGCGCCCGGCCCCGTTTTCAGG + Intronic
1102178980 12:110897440-110897462 CCACACCCAGCTAAGTTTTTGGG - Intronic
1102349915 12:112184614-112184636 CCGCCCTCGGCCTTGTCTTTTGG + Exonic
1102411743 12:112726083-112726105 CCGCACCCAGCCTTTTTTTTCGG + Intronic
1103783195 12:123413203-123413225 CCGCACCCGGCTTTTTTTTGGGG - Exonic
1105457727 13:20556739-20556761 CCGCACCTGGCTAATTTTTTGGG + Intergenic
1105941621 13:25152872-25152894 TCCCACCTGGCCATGCTTTTGGG - Intergenic
1107491490 13:40883820-40883842 CCGCACCCGGCCAGGTTCTTAGG + Intergenic
1107831370 13:44376478-44376500 CCACGCCCGGCCTTGTTTCTTGG - Intronic
1107857940 13:44633920-44633942 CCGCGCCCGGCCCTGTTTTTTGG - Intergenic
1108122109 13:47200066-47200088 CCACACCCGGCCAAAATTTTTGG - Intergenic
1110423612 13:75340654-75340676 CTGCACCCGGCCATTTTATAGGG - Intronic
1113782446 13:112984388-112984410 CCGCACCTGGCTAATTTTTTTGG + Intronic
1114498731 14:23152703-23152725 CCACACCCGGTGATGTTTTCAGG + Intronic
1115324309 14:32121161-32121183 CCACACCCAGCCACCTTTTTTGG + Intronic
1115537866 14:34390551-34390573 CCGCGCCCAGCCCTGTTTTGTGG - Intronic
1116257644 14:42577286-42577308 CCACACCCGGCTAAGTTTTCTGG - Intergenic
1124200500 15:27674863-27674885 CCGCTCCAGGCCATGACTTTGGG + Intergenic
1125733505 15:41907673-41907695 CCACACCTGGCCAATTTTTTTGG + Intronic
1126503096 15:49369245-49369267 CTGCACCCGGCCTGGTGTTTTGG + Intronic
1129442022 15:75588539-75588561 CCTCACCTGGCTATATTTTTAGG - Intergenic
1129989029 15:79945524-79945546 CTGCTCCCAGCCATGTTTCTGGG + Intergenic
1131780445 15:95850971-95850993 GCGTACCCTGCCATGTCTTTAGG + Intergenic
1132145781 15:99428629-99428651 CTGCACCCGGCCAACTTTTGTGG - Intergenic
1133780583 16:8936037-8936059 CCGCCCCCTGCCAGCTTTTTGGG - Intronic
1133815935 16:9197424-9197446 CTGCGCCCGGCCAAGATTTTAGG + Intergenic
1138531102 16:57634857-57634879 CCGCATCAGGCCATGCTTGTGGG + Intronic
1140279529 16:73542088-73542110 CCGCGCCCGGCCCTGTTTGGTGG + Intergenic
1140780674 16:78293685-78293707 CCGCACCCAGCCACCTTTTAGGG - Intronic
1140821564 16:78667986-78668008 CCGCACCCAGCCAAGTTGTATGG - Intronic
1141967183 16:87453387-87453409 CCGCACCCTCCCATGTTCTGCGG - Intronic
1143191275 17:5041900-5041922 CCGCACCCGGCCTATTTTTAAGG + Intronic
1145879094 17:28341033-28341055 CCGCACCCGGCCTGGATCTTGGG + Intronic
1146334638 17:31958555-31958577 CCGCACCTGGCCTAATTTTTTGG - Intronic
1146825148 17:36015744-36015766 CCGCACCCGGCCAAATTTTAAGG - Intronic
1147981517 17:44277508-44277530 CCGCACCCAGCCATGTTTCCTGG - Intergenic
1149271614 17:54984631-54984653 CCGCACCCGGCCAGTTTCTCTGG + Intronic
1150530967 17:65981104-65981126 CCACGCCCGGCCATCTTCTTAGG + Intronic
1151044523 17:70903826-70903848 CCGCACCTGGCCTTTTTTTGGGG + Intergenic
1151841359 17:76620328-76620350 CCGCACCCAGCCTTATTGTTAGG + Intergenic
1151951751 17:77358198-77358220 CAGCACCTGGCGATGTTTTGGGG + Intronic
1152326183 17:79639328-79639350 CCGCGCCCGGCTAATTTTTTTGG + Intergenic
1152791880 17:82284526-82284548 CCGCGCCCGGTCCAGTTTTTGGG - Intergenic
1156805520 18:41174598-41174620 CCACACCCGGCTAATTTTTTTGG - Intergenic
1157257003 18:46148475-46148497 CTGCACCTGGCTTTGTTTTTTGG + Intergenic
1157535059 18:48451975-48451997 CCGCACCCAGCCAGGTCTCTGGG + Intergenic
1161305392 19:3564499-3564521 CCGCGCCCGGCCAAGTTGTGTGG - Intronic
1161547960 19:4893750-4893772 CCGCACCCGGCCTTCCTTTTTGG - Intronic
1162053796 19:8050886-8050908 ACTCACCCGGCCATGTGGTTTGG + Intronic
1163927051 19:20355967-20355989 CCGCACCCGGCCCAGTTGTTTGG - Intergenic
1164320003 19:24135824-24135846 CCACACCTGGCCTTTTTTTTTGG + Intergenic
1165569796 19:36766042-36766064 CCACACCTGGCTATTTTTTTTGG + Intronic
1166176944 19:41080776-41080798 CTGCACCCAGCCATGTTCTGAGG + Intergenic
1167121106 19:47517299-47517321 CCGCACCCGGCCAATTTCCTTGG - Intergenic
1167447736 19:49548286-49548308 CCGCTTCCGGCCGCGTTTTTTGG + Intergenic
1168504851 19:56924938-56924960 CCGCCCCCCGCCATATTTCTGGG + Intergenic
1168708935 19:58486697-58486719 CCGCACCCAGCTTTTTTTTTTGG + Intronic
926564944 2:14458864-14458886 CCACACCTGGCCAAGATTTTTGG - Intergenic
926646598 2:15296384-15296406 CCACACCCGGCTAATTTTTTTGG - Intronic
928392979 2:30923456-30923478 CCCCTCCCTGCCATGTTTTTTGG - Intronic
928556058 2:32426310-32426332 CCACACCCGGCCATTCTGTTGGG - Intronic
929137802 2:38641898-38641920 CCGCACCCGGCCATAATTTCAGG - Intergenic
929876669 2:45802106-45802128 CCACACCCTGCTAAGTTTTTGGG - Intronic
932342022 2:70969245-70969267 CCGCGCCCGGCCGAGTTTTACGG + Intronic
932631363 2:73346061-73346083 CCGCGCCCGGTCTGGTTTTTTGG + Intergenic
933062014 2:77749648-77749670 CCGCGCCCGGCCAGGAATTTTGG - Intergenic
933423042 2:82076223-82076245 CCACACCAGCCCATGTTTCTCGG - Intergenic
934552328 2:95270052-95270074 CTGCACCCGGCCAGGGGTTTTGG + Intergenic
935167556 2:100582446-100582468 CCGCACCCGGCCTTTTTTTGGGG - Intergenic
935277129 2:101484614-101484636 CCACACCCAGCTATATTTTTGGG - Intergenic
940508340 2:154583599-154583621 CCCCTCCCAGCCATTTTTTTTGG - Intergenic
940671788 2:156678967-156678989 CCGCGCCCGGCTAATTTTTTTGG - Intergenic
944577701 2:201105538-201105560 CCACACCCGGCCTGGTTTTCAGG - Intergenic
945275739 2:207985830-207985852 CCACACCCGGCTAATTTTTTTGG - Intronic
945588780 2:211701600-211701622 CCGCGCCCGGCTAATTTTTTTGG - Intronic
946559577 2:220897678-220897700 CCGTGCCCGGCCATGCTTGTAGG - Intergenic
946890330 2:224269146-224269168 CCGCGCCTGGCCATCTTTCTTGG + Intergenic
946958417 2:224957287-224957309 CCCCCCCCGGCTTTGTTTTTCGG + Intronic
947962741 2:234253337-234253359 CTGTGCCCGGCCATATTTTTAGG - Intergenic
948472306 2:238191615-238191637 CCACACCTGGCCATCTGTTTTGG - Intronic
1168831783 20:848966-848988 CCGCACCCGGCCGGGTGTTCAGG - Intronic
1170679868 20:18516841-18516863 CCGCACCCGGCCACATTTTTAGG + Intronic
1172822218 20:37747085-37747107 CCACACTCAGCCTTGTTTTTAGG - Intronic
1173623927 20:44457403-44457425 CCACACCTGGCCTTGTTTGTAGG - Intronic
1174832095 20:53822538-53822560 CCACACCCGGCTAATTTTTTTGG + Intergenic
1177188814 21:17826620-17826642 CCACACCCGGCTAATTTTTTTGG - Intergenic
1177440488 21:21116697-21116719 CCGCACCCAGCTATTTTTTTTGG - Intronic
1177646818 21:23909467-23909489 CCACACCCGGCCATGCACTTTGG - Intergenic
1178330083 21:31682132-31682154 CCGCACCTGGCCTACTTTTTAGG - Intronic
1180674353 22:17577013-17577035 CCGCACCTGGCTAATTTTTTTGG + Intronic
1180760106 22:18195657-18195679 CCACACCCGGCTAATTTTTTTGG + Intergenic
1180770417 22:18379956-18379978 CCACACCCGGCTAATTTTTTTGG + Intergenic
1180775562 22:18429039-18429061 CCACACCCGGCTAATTTTTTTGG - Intergenic
1181071561 22:20345058-20345080 CCACACCCGGCTAATTTTTTTGG - Intergenic
1181194633 22:21174008-21174030 CCACACCCGGCTAATTTTTTTGG - Intergenic
1181214810 22:21318770-21318792 CCACACCCGGCTAATTTTTTTGG + Intergenic
1181326460 22:22052391-22052413 CCGTGCCCGGCCATGGTGTTAGG + Intergenic
1182291839 22:29286127-29286149 CCGCACCCGGCCTGATTTTTTGG + Intronic
1183909582 22:41068368-41068390 CCGTGCCCGGCTATTTTTTTTGG + Intergenic
1183988253 22:41581166-41581188 CCACACCTGGCTAAGTTTTTTGG - Intronic
1184111594 22:42398701-42398723 CTGCACCCGGCCATGGGTCTTGG + Intronic
1184772090 22:46603361-46603383 CCACACCCGGCTAATTTTTTTGG + Intronic
956450499 3:69370305-69370327 CTGCACCCGGCCCTGTGGTTGGG - Intronic
958866007 3:99502361-99502383 CCACAACCCACCATGTTTTTTGG - Intergenic
962816893 3:139008525-139008547 CTGCACCCGGCCATATTTTGAGG + Intronic
964009541 3:151874328-151874350 CCACGCCCGGCTATTTTTTTTGG + Intronic
966244454 3:177791029-177791051 CCGCCCAAGGCCATGTTCTTAGG - Intergenic
966310410 3:178587577-178587599 CCACACCCGGCTAATTTTTTGGG + Intronic
967165243 3:186774125-186774147 CCGCGCCCGGTCACGATTTTTGG + Intergenic
968015385 3:195327639-195327661 CTGCGCCCGGCCAGGTTTTATGG - Intronic
968509045 4:987368-987390 CCGCCCCCCGCCGTGTTTGTGGG + Intronic
969677798 4:8624286-8624308 CCGCACCTGGCCCGGTTTTCTGG - Intergenic
969678753 4:8629927-8629949 CCGCACCTGGCCCGGTTTTCTGG - Intergenic
969679709 4:8635569-8635591 CCGCACCTGGCCCGGTTTTCTGG - Intergenic
971016953 4:22498326-22498348 CTGCACCCGGCCATGTTAACTGG - Intronic
971065410 4:23026723-23026745 CCGCGCCCGGCCATTTTCCTTGG - Intergenic
971536168 4:27754132-27754154 CCGCGCCCGGCCCCATTTTTTGG + Intergenic
972536885 4:40007293-40007315 CCGCTCCTGGCCATCTTTTAAGG + Intergenic
972576368 4:40355907-40355929 CCACACCCGGCTAATTTTTTTGG + Intergenic
974246454 4:59325860-59325882 CCACGCCCGGCTAAGTTTTTCGG + Intergenic
976589236 4:86832449-86832471 CCACACCCGGCTAATTTTTTTGG - Intronic
977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG + Intergenic
987123181 5:14787021-14787043 CCGCACCCGGCCTGTTTCTTGGG - Intronic
988847619 5:35144752-35144774 CCGCACCTGGCCAAATTTTTAGG + Intronic
994631475 5:102293888-102293910 CCGCACCCGGCTAATTTTTGTGG + Intronic
997324576 5:133009325-133009347 CCGCACCTGGCCATCTTTTTTGG - Intronic
998119657 5:139565443-139565465 CCCCACCCTGCTATGTTTTAAGG + Intronic
998240879 5:140443398-140443420 CCACGCCCGGCCTTTTTTTTGGG - Intronic
998968592 5:147567115-147567137 CCGCACCTGGCCCTGTTTCTGGG + Intergenic
1004380175 6:15126016-15126038 CCGCACCCGGCCAAGTTTTTTGG + Intergenic
1004656347 6:17665838-17665860 CCACACCCGGCTAATTTTTTTGG + Intronic
1004969661 6:20895792-20895814 ACGCAACTGGACATGTTTTTGGG - Intronic
1006927212 6:37663749-37663771 CCTCAGCCGTCCATGTTTTCAGG + Intronic
1007540033 6:42633679-42633701 CCGCACCTGGCCAGTTTTTGGGG + Intronic
1007830368 6:44633885-44633907 CCACACCCAGCTAAGTTTTTTGG - Intergenic
1015586545 6:134782434-134782456 CCACACCCGGCTAATTTTTTTGG - Intergenic
1016269672 6:142273951-142273973 ACACACTGGGCCATGTTTTTAGG - Intergenic
1017753416 6:157509952-157509974 CCGCACCCGGCCATGAAGTAGGG - Intronic
1018313916 6:162538106-162538128 CCGCACCCGCCGAGGTATTTGGG - Intronic
1022123774 7:27335860-27335882 CCGCACCCGGCCTAAATTTTAGG + Intergenic
1022156176 7:27663687-27663709 CCACACCCGGCTAATTTTTTTGG + Intergenic
1022267942 7:28776180-28776202 CCACACCCGGCTAATTTTTTTGG - Intronic
1023874477 7:44279346-44279368 CCTCACCCTGCCATTTTCTTGGG - Intronic
1024093354 7:45965626-45965648 CCACACCCAGCTAAGTTTTTTGG - Intergenic
1024259783 7:47565363-47565385 CCGCGCCCGGCCTTTTTTTTTGG + Intronic
1026711305 7:72742418-72742440 CTGCACCCGGCCAGTATTTTTGG + Intronic
1026944167 7:74305782-74305804 CCGCACCCGGTCACATTTTAGGG + Intronic
1026971519 7:74471351-74471373 CCACACCCGGCTAATTTTTTTGG - Intronic
1027784174 7:82558222-82558244 CCACACCCGGCTAATTTTTTTGG + Intergenic
1029712220 7:102306053-102306075 CCACACTCGGCTAAGTTTTTTGG + Intronic
1029803463 7:102974098-102974120 CCGCACCTGGCCAGGTTTACAGG - Intronic
1033916349 7:146331012-146331034 CCGCGCCCGGCCATGATAGTTGG - Intronic
1035660250 8:1342235-1342257 CCGCACCTGGCCAGGTTGTGAGG + Intergenic
1036651706 8:10648320-10648342 CCGCACCTGGCCAATTTTCTGGG + Intronic
1036825373 8:11971711-11971733 CCGCACCTGGCCAGATTTCTTGG + Intergenic
1037355116 8:18010690-18010712 CCGCGCCCAGCCATATTTTTAGG - Intronic
1037849889 8:22318606-22318628 CCGCGCCTGGCCAAGTTTCTGGG + Intronic
1039590868 8:38745832-38745854 CCGCACCCAGCCTTGTTTTCTGG + Intronic
1039682884 8:39761789-39761811 CCGCGCCCGGCCATGTAGGTTGG - Intronic
1040024578 8:42770088-42770110 CCGCACCCGGCCATGTCAGGGGG + Intronic
1040558035 8:48498455-48498477 CCACAACCTGCTATGTTTTTTGG + Intergenic
1041241184 8:55850339-55850361 CCACACCCGGCTAATTTTTTTGG - Intergenic
1041667086 8:60456239-60456261 CCACACCCAGCTAAGTTTTTTGG - Intergenic
1042590939 8:70398165-70398187 CCGTACCTGGCCATCATTTTGGG - Intronic
1044978679 8:97693020-97693042 CCACACCTGGCCATGTTTTGCGG + Intronic
1045226064 8:100246691-100246713 CCGCACCCAGCCGAGTTTATAGG + Intronic
1047007441 8:120635005-120635027 CCGCACCCAGCTAATTTTTTTGG + Intronic
1047395317 8:124492479-124492501 CCACACCCAGCCAATTTTTTGGG - Intronic
1048350276 8:133610279-133610301 CTGCACCCGGCCAATATTTTAGG - Intergenic
1049072555 8:140368060-140368082 CTGCACCCCGTCATGGTTTTTGG + Intronic
1055303785 9:74907979-74908001 CCACACCCGGCTAATTTTTTTGG - Intergenic
1059446258 9:114339941-114339963 CCACACCCGGCTAATTTTTTTGG - Intronic
1060089772 9:120732616-120732638 CCGCACCCGGCCTTGCTTTCAGG + Intergenic
1060854048 9:126900660-126900682 CCTCACCTGGCCATTTTTTTTGG - Intergenic
1061131590 9:128711586-128711608 CCACGCCCGGCCTTTTTTTTGGG + Intronic
1185499682 X:587332-587354 CTGCACCCGGCCAGGCTGTTTGG - Intergenic
1187057751 X:15757083-15757105 CTGCACCCGGCCATCTACTTTGG - Intronic
1189932803 X:46033069-46033091 CCGCGCCCGGCCTTGTTTCGAGG - Intergenic
1190315750 X:49149658-49149680 CCGCGCCCAGCCTTTTTTTTTGG - Intergenic
1193935390 X:87612714-87612736 CCGCACCCTGCCATGCTTACTGG - Intronic
1194633847 X:96320052-96320074 CCGCGCCCGGCCAAGCCTTTAGG + Intergenic
1194663695 X:96654478-96654500 CTGCACCCGGCCATAGTTTTAGG + Intergenic
1197223836 X:123937332-123937354 CCACACCCGGCTAATTTTTTTGG + Intergenic
1197227904 X:123972559-123972581 CCGCGCCCGGCCAATTTTTAAGG + Intronic
1198464254 X:136890408-136890430 CCGCGCCCGGCCTTGTGTGTGGG - Intergenic
1199215558 X:145256809-145256831 ACGCGCCTGGCCATATTTTTAGG - Intergenic