ID: 1102090360

View in Genome Browser
Species Human (GRCh38)
Location 12:110182246-110182268
Sequence CTATAGAAGCTATAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102090360_1102090368 30 Left 1102090360 12:110182246-110182268 CCACCCAGCTATAGCTTCTATAG 0: 1
1: 0
2: 1
3: 1
4: 98
Right 1102090368 12:110182299-110182321 CTTATAGGAGAAAGATTAGTGGG 0: 1
1: 0
2: 3
3: 19
4: 194
1102090360_1102090365 3 Left 1102090360 12:110182246-110182268 CCACCCAGCTATAGCTTCTATAG 0: 1
1: 0
2: 1
3: 1
4: 98
Right 1102090365 12:110182272-110182294 TCTAGTTGGTCGCAATTTCTAGG 0: 1
1: 0
2: 0
3: 9
4: 85
1102090360_1102090367 29 Left 1102090360 12:110182246-110182268 CCACCCAGCTATAGCTTCTATAG 0: 1
1: 0
2: 1
3: 1
4: 98
Right 1102090367 12:110182298-110182320 ACTTATAGGAGAAAGATTAGTGG 0: 1
1: 0
2: 3
3: 33
4: 261
1102090360_1102090366 15 Left 1102090360 12:110182246-110182268 CCACCCAGCTATAGCTTCTATAG 0: 1
1: 0
2: 1
3: 1
4: 98
Right 1102090366 12:110182284-110182306 CAATTTCTAGGAAAACTTATAGG 0: 1
1: 0
2: 0
3: 17
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102090360 Original CRISPR CTATAGAAGCTATAGCTGGG TGG (reversed) Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
915205904 1:154270265-154270287 CTACAACAGCTACAGCTGGGGGG + Exonic
918305810 1:183245128-183245150 CTAGAAAAACTCTAGCTGGGTGG + Intergenic
918889612 1:190249158-190249180 CTATTTAAGCTACAGCTGTGTGG - Intronic
919200859 1:194353774-194353796 CTATGGAATCAATAGCTTGGAGG + Intergenic
920696044 1:208181965-208181987 GTATAGCAGCTAGAGCAGGGAGG - Intronic
923868456 1:237964934-237964956 CTATAGAAACTAAAGATAGGTGG - Intergenic
1074959839 10:118433225-118433247 ATATTAAAGCTAGAGCTGGGTGG - Intergenic
1077721795 11:4637417-4637439 CCAGAGAAGCTATAATTGGGCGG + Intergenic
1083036101 11:59638981-59639003 CTTTAGAAGTTATGGTTGGGAGG - Intronic
1083327693 11:61881509-61881531 TTATAGAACCAGTAGCTGGGTGG + Intronic
1084257319 11:67952016-67952038 CTAGGGTAGCCATAGCTGGGAGG + Intergenic
1086145788 11:83550243-83550265 CTCTAAAAGCTATAGCTGCAGGG - Intronic
1088836443 11:113581529-113581551 CTACAGAAGCTATAGCTTGGCGG - Intergenic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1102090360 12:110182246-110182268 CTATAGAAGCTATAGCTGGGTGG - Intronic
1102122405 12:110451850-110451872 CTCTAGAAGCTAAACCAGGGAGG + Intergenic
1102657617 12:114495922-114495944 TTACAGAAGCTATCTCTGGGTGG + Intergenic
1107603270 13:42034635-42034657 CCATAAAAGCTCTGGCTGGGTGG + Intergenic
1117832201 14:59763286-59763308 TTATAGATGCGATAGCTCGGAGG - Intronic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1122236404 14:100332895-100332917 CAATAGATGCTGTGGCTGGGTGG + Intergenic
1202839784 14_GL000009v2_random:111105-111127 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202909162 14_GL000194v1_random:101245-101267 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202884105 14_KI270722v1_random:87972-87994 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1123916811 15:25039331-25039353 GTATAGAAGTTATATCTTGGTGG + Intergenic
1124694859 15:31855989-31856011 CTATAGGAGCCATGCCTGGGAGG + Intronic
1126134447 15:45377542-45377564 CTATAAAATCTAGAGCAGGGAGG + Intronic
1128095482 15:64950741-64950763 CTATAGCAGCTATGGGGGGGGGG - Intronic
1131128435 15:89876678-89876700 CATAAGAAGCTTTAGCTGGGAGG + Intronic
1134801844 16:17091752-17091774 CTCTGGAAGGTAGAGCTGGGCGG + Intergenic
1135711328 16:24719923-24719945 CTTTAGAATATATAACTGGGAGG + Intergenic
1141265052 16:82489019-82489041 CCACAGCAGCTATAACTGGGAGG - Intergenic
1146320237 17:31841168-31841190 TTATAGAAGGTAGAGCTGGCAGG - Intergenic
1148890273 17:50802053-50802075 CTATAGCAGCCACAGCTGGATGG + Intergenic
1153240508 18:3027326-3027348 TTTTAGAAGCTATAGAGGGGAGG + Intergenic
1153571161 18:6475057-6475079 CTAAAGTAGCAAAAGCTGGGTGG - Intergenic
1156332324 18:36134123-36134145 CTAAAAAAGCAATAGCTGGCCGG - Intronic
1157776363 18:50399706-50399728 CTATAGTAGCTTTATCTGGATGG + Intergenic
1158505429 18:58043434-58043456 CTAGAGAAACGGTAGCTGGGTGG + Intergenic
1162336180 19:10061940-10061962 CTAGAGAAGCAGGAGCTGGGAGG + Intergenic
1164614918 19:29661559-29661581 CTTTAGGAGGTAAAGCTGGGAGG + Intergenic
1202652609 1_KI270707v1_random:20577-20599 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202659523 1_KI270708v1_random:55106-55128 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
925075354 2:1012402-1012424 CCTTAGAACCTACAGCTGGGTGG + Intronic
926952483 2:18258402-18258424 CCATAGAGGCTATATCTGGCCGG + Intronic
932391959 2:71400163-71400185 CTAAAGAAGCTATTTCTGGTAGG + Exonic
935465000 2:103385879-103385901 CTATAGAAACTGTGGCAGGGAGG - Intergenic
940274322 2:151923221-151923243 GAATAGAAGCAATAGCTAGGAGG - Intronic
940709922 2:157149859-157149881 CTATACAAGCAGTAGCTGGCAGG + Intergenic
942553128 2:177141766-177141788 TTATAGAAGAGAAAGCTGGGGGG + Intergenic
1176599543 21:8779077-8779099 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1176628516 21:9115958-9115980 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1180326991 22:11438667-11438689 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1180378628 22:12117488-12117510 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1180418893 22:12795829-12795851 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1182188649 22:28435519-28435541 CTGTAGAAGCTAAAGCTGACAGG + Intronic
950972626 3:17203911-17203933 GTATAGAAGCTCTAGCTATGAGG + Intronic
954563919 3:51582220-51582242 CTTAAGAAGTTATAGCTGTGTGG + Intronic
954703087 3:52462354-52462376 CTTTAGTTGCCATAGCTGGGTGG - Intronic
955954955 3:64279521-64279543 CTATGGAAGCTGGACCTGGGTGG - Intronic
959942962 3:112098768-112098790 CCATAGAAGATATAGCTAGAAGG - Intronic
973362894 4:49181448-49181470 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
973398205 4:49615406-49615428 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
974232021 4:59128802-59128824 CTGTAAAAACTCTAGCTGGGAGG - Intergenic
976952875 4:90854892-90854914 CTACAGAAAGTATGGCTGGGAGG + Intronic
977646334 4:99416869-99416891 CTATAGAAGGAATAGATTGGGGG - Intronic
979737784 4:124109164-124109186 ATATAGAAGCTAAAGCAGAGAGG - Intergenic
979887124 4:126042134-126042156 CTAAAGTAGCTATAGATGTGAGG - Intergenic
981428534 4:144633302-144633324 TTAAAGAAGCAATAGCTGAGAGG + Intergenic
981710970 4:147708705-147708727 CTAAATAAGTTAGAGCTGGGAGG + Intergenic
1202760246 4_GL000008v2_random:102955-102977 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
986543264 5:8869524-8869546 CTCTAGGAGCTACAGCTGTGGGG + Intergenic
988795099 5:34646352-34646374 CTAGAGAAGCTCGAACTGGGTGG - Intergenic
992866507 5:80961311-80961333 CTAGAGAAGCAATAGATGGTTGG - Intronic
996490048 5:124084103-124084125 CTAGAGGACTTATAGCTGGGTGG - Intergenic
1001378759 5:171288192-171288214 CTATAAAAGCCTTAGGTGGGAGG + Intronic
1002304811 5:178276894-178276916 CTGTAGGAGCTTCAGCTGGGTGG + Intronic
1018109262 6:160519865-160519887 CTACAGAAGTTCTGGCTGGGTGG + Intergenic
1023571978 7:41581880-41581902 GGATAGGAGCCATAGCTGGGTGG - Intergenic
1027410942 7:77916971-77916993 CTATAGATGCTAAAGCTAGAAGG - Intronic
1034214975 7:149398354-149398376 CTGTAGAGGGTATAGCTTGGTGG - Intergenic
1035016798 7:155773757-155773779 CTTTAGGATCTAGAGCTGGGAGG - Intronic
1035269101 7:157709567-157709589 CCATAGAAGACAGAGCTGGGGGG - Intronic
1037715374 8:21392962-21392984 CTGAAGAAGCTATTTCTGGGTGG + Intergenic
1039105031 8:33981001-33981023 CTATAGAATTTATAGAAGGGAGG + Intergenic
1041300391 8:56405457-56405479 CAATAGAAGAAATAGCTGGCTGG + Intergenic
1041373737 8:57191801-57191823 AGACAGAGGCTATAGCTGGGAGG - Intergenic
1042667501 8:71222552-71222574 CTGCAGAAGCTATTGCTGTGGGG - Intronic
1046017040 8:108617588-108617610 CAAAAGAAGATATAGCTGAGGGG + Intronic
1048328047 8:133453584-133453606 CTATAGAACGGATGGCTGGGTGG + Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1062713294 9:137988365-137988387 CTGTAGAAGCTGTTGCAGGGAGG + Intronic
1203751361 Un_GL000218v1:83637-83659 CTGTAGAAGCTGTTGGTGGGAGG - Intergenic
1203482626 Un_GL000224v1:20717-20739 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1203541022 Un_KI270743v1:87849-87871 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1190526469 X:51333383-51333405 CTGGAGAAACTAAAGCTGGGCGG + Exonic
1190542772 X:51496005-51496027 CTGGAGAAACTAAAGCTGGGCGG - Exonic
1191197793 X:57743473-57743495 GTATAGAAGGCATAGCTGGGAGG - Intergenic
1194236524 X:91390818-91390840 CTATAGTCCCTATAGTTGGGAGG + Intergenic
1196375482 X:115028305-115028327 CATAAGGAGCTATAGCTGGGAGG + Intergenic