ID: 1102096614

View in Genome Browser
Species Human (GRCh38)
Location 12:110246314-110246336
Sequence GAGGGTGTCAAAGGCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102096614_1102096622 8 Left 1102096614 12:110246314-110246336 CCTTACAGGCCTTTGACACCCTC No data
Right 1102096622 12:110246345-110246367 AGCAGTTGATGACCAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102096614 Original CRISPR GAGGGTGTCAAAGGCCTGTA AGG (reversed) Intergenic
No off target data available for this crispr