ID: 1102098412

View in Genome Browser
Species Human (GRCh38)
Location 12:110258515-110258537
Sequence ACCGTGGGTGCTCACTCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102098412_1102098418 15 Left 1102098412 12:110258515-110258537 CCACGTGAGTGAGCACCCACGGT No data
Right 1102098418 12:110258553-110258575 GGTGGGCTACAACAGACCCGAGG No data
1102098412_1102098417 -2 Left 1102098412 12:110258515-110258537 CCACGTGAGTGAGCACCCACGGT No data
Right 1102098417 12:110258536-110258558 GTGCTGTTGAATTTAGAGGTGGG No data
1102098412_1102098415 -6 Left 1102098412 12:110258515-110258537 CCACGTGAGTGAGCACCCACGGT No data
Right 1102098415 12:110258532-110258554 CACGGTGCTGTTGAATTTAGAGG No data
1102098412_1102098419 23 Left 1102098412 12:110258515-110258537 CCACGTGAGTGAGCACCCACGGT No data
Right 1102098419 12:110258561-110258583 ACAACAGACCCGAGGCCCCCAGG No data
1102098412_1102098420 27 Left 1102098412 12:110258515-110258537 CCACGTGAGTGAGCACCCACGGT No data
Right 1102098420 12:110258565-110258587 CAGACCCGAGGCCCCCAGGAAGG No data
1102098412_1102098416 -3 Left 1102098412 12:110258515-110258537 CCACGTGAGTGAGCACCCACGGT No data
Right 1102098416 12:110258535-110258557 GGTGCTGTTGAATTTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102098412 Original CRISPR ACCGTGGGTGCTCACTCACG TGG (reversed) Intergenic
No off target data available for this crispr