ID: 1102099953

View in Genome Browser
Species Human (GRCh38)
Location 12:110270557-110270579
Sequence GTGTTGGTGGAGGCATGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102099953_1102099969 15 Left 1102099953 12:110270557-110270579 CCTAAACATGCCTCCACCAACAC No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099953_1102099968 14 Left 1102099953 12:110270557-110270579 CCTAAACATGCCTCCACCAACAC No data
Right 1102099968 12:110270594-110270616 TTTTCTATTGTGGGACATCAAGG No data
1102099953_1102099970 25 Left 1102099953 12:110270557-110270579 CCTAAACATGCCTCCACCAACAC No data
Right 1102099970 12:110270605-110270627 GGGACATCAAGGGAGCAAGCTGG No data
1102099953_1102099963 4 Left 1102099953 12:110270557-110270579 CCTAAACATGCCTCCACCAACAC No data
Right 1102099963 12:110270584-110270606 CCCCCTTTTTTTTTCTATTGTGG No data
1102099953_1102099965 5 Left 1102099953 12:110270557-110270579 CCTAAACATGCCTCCACCAACAC No data
Right 1102099965 12:110270585-110270607 CCCCTTTTTTTTTCTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102099953 Original CRISPR GTGTTGGTGGAGGCATGTTT AGG (reversed) Intergenic
No off target data available for this crispr