ID: 1102099957

View in Genome Browser
Species Human (GRCh38)
Location 12:110270579-110270601
Sequence ATAGAAAAAAAAAGGGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102099957_1102099969 -7 Left 1102099957 12:110270579-110270601 CCCCCCCCCCTTTTTTTTTCTAT No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099957_1102099971 12 Left 1102099957 12:110270579-110270601 CCCCCCCCCCTTTTTTTTTCTAT No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099957_1102099968 -8 Left 1102099957 12:110270579-110270601 CCCCCCCCCCTTTTTTTTTCTAT No data
Right 1102099968 12:110270594-110270616 TTTTCTATTGTGGGACATCAAGG No data
1102099957_1102099972 13 Left 1102099957 12:110270579-110270601 CCCCCCCCCCTTTTTTTTTCTAT No data
Right 1102099972 12:110270615-110270637 GGGAGCAAGCTGGTCAGCTTGGG No data
1102099957_1102099970 3 Left 1102099957 12:110270579-110270601 CCCCCCCCCCTTTTTTTTTCTAT No data
Right 1102099970 12:110270605-110270627 GGGACATCAAGGGAGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102099957 Original CRISPR ATAGAAAAAAAAAGGGGGGG GGG (reversed) Intergenic
No off target data available for this crispr