ID: 1102099959

View in Genome Browser
Species Human (GRCh38)
Location 12:110270581-110270603
Sequence CAATAGAAAAAAAAAGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102099959_1102099969 -9 Left 1102099959 12:110270581-110270603 CCCCCCCCTTTTTTTTTCTATTG No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099959_1102099970 1 Left 1102099959 12:110270581-110270603 CCCCCCCCTTTTTTTTTCTATTG No data
Right 1102099970 12:110270605-110270627 GGGACATCAAGGGAGCAAGCTGG No data
1102099959_1102099972 11 Left 1102099959 12:110270581-110270603 CCCCCCCCTTTTTTTTTCTATTG No data
Right 1102099972 12:110270615-110270637 GGGAGCAAGCTGGTCAGCTTGGG No data
1102099959_1102099968 -10 Left 1102099959 12:110270581-110270603 CCCCCCCCTTTTTTTTTCTATTG No data
Right 1102099968 12:110270594-110270616 TTTTCTATTGTGGGACATCAAGG No data
1102099959_1102099971 10 Left 1102099959 12:110270581-110270603 CCCCCCCCTTTTTTTTTCTATTG No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102099959 Original CRISPR CAATAGAAAAAAAAAGGGGG GGG (reversed) Intergenic
No off target data available for this crispr