ID: 1102099969

View in Genome Browser
Species Human (GRCh38)
Location 12:110270595-110270617
Sequence TTTCTATTGTGGGACATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102099957_1102099969 -7 Left 1102099957 12:110270579-110270601 CCCCCCCCCCTTTTTTTTTCTAT No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099958_1102099969 -8 Left 1102099958 12:110270580-110270602 CCCCCCCCCTTTTTTTTTCTATT No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099954_1102099969 5 Left 1102099954 12:110270567-110270589 CCTCCACCAACACCCCCCCCCCT No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099953_1102099969 15 Left 1102099953 12:110270557-110270579 CCTAAACATGCCTCCACCAACAC No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099955_1102099969 2 Left 1102099955 12:110270570-110270592 CCACCAACACCCCCCCCCCTTTT No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099959_1102099969 -9 Left 1102099959 12:110270581-110270603 CCCCCCCCTTTTTTTTTCTATTG No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099956_1102099969 -1 Left 1102099956 12:110270573-110270595 CCAACACCCCCCCCCCTTTTTTT No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data
1102099960_1102099969 -10 Left 1102099960 12:110270582-110270604 CCCCCCCTTTTTTTTTCTATTGT No data
Right 1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102099969 Original CRISPR TTTCTATTGTGGGACATCAA GGG Intergenic
No off target data available for this crispr