ID: 1102099971

View in Genome Browser
Species Human (GRCh38)
Location 12:110270614-110270636
Sequence AGGGAGCAAGCTGGTCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102099967_1102099971 4 Left 1102099967 12:110270587-110270609 CCTTTTTTTTTCTATTGTGGGAC No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099955_1102099971 21 Left 1102099955 12:110270570-110270592 CCACCAACACCCCCCCCCCTTTT No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099954_1102099971 24 Left 1102099954 12:110270567-110270589 CCTCCACCAACACCCCCCCCCCT No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099960_1102099971 9 Left 1102099960 12:110270582-110270604 CCCCCCCTTTTTTTTTCTATTGT No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099964_1102099971 6 Left 1102099964 12:110270585-110270607 CCCCTTTTTTTTTCTATTGTGGG No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099956_1102099971 18 Left 1102099956 12:110270573-110270595 CCAACACCCCCCCCCCTTTTTTT No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099958_1102099971 11 Left 1102099958 12:110270580-110270602 CCCCCCCCCTTTTTTTTTCTATT No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099961_1102099971 8 Left 1102099961 12:110270583-110270605 CCCCCCTTTTTTTTTCTATTGTG No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099966_1102099971 5 Left 1102099966 12:110270586-110270608 CCCTTTTTTTTTCTATTGTGGGA No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099962_1102099971 7 Left 1102099962 12:110270584-110270606 CCCCCTTTTTTTTTCTATTGTGG No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099957_1102099971 12 Left 1102099957 12:110270579-110270601 CCCCCCCCCCTTTTTTTTTCTAT No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data
1102099959_1102099971 10 Left 1102099959 12:110270581-110270603 CCCCCCCCTTTTTTTTTCTATTG No data
Right 1102099971 12:110270614-110270636 AGGGAGCAAGCTGGTCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102099971 Original CRISPR AGGGAGCAAGCTGGTCAGCT TGG Intergenic
No off target data available for this crispr