ID: 1102101738

View in Genome Browser
Species Human (GRCh38)
Location 12:110283499-110283521
Sequence CTACAGCAGAAAAAGGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102101735_1102101738 25 Left 1102101735 12:110283451-110283473 CCACTTGAGTGCTATATGGTTGC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1102101738 12:110283499-110283521 CTACAGCAGAAAAAGGGTGTTGG 0: 1
1: 0
2: 0
3: 22
4: 191
1102101734_1102101738 26 Left 1102101734 12:110283450-110283472 CCCACTTGAGTGCTATATGGTTG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1102101738 12:110283499-110283521 CTACAGCAGAAAAAGGGTGTTGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102101738 Original CRISPR CTACAGCAGAAAAAGGGTGT TGG Intronic
904351192 1:29907881-29907903 CTTCAGCAGAAAGAGGAGGTTGG + Intergenic
904602472 1:31681126-31681148 CTGCTGCAGAAAAGGGGTGTAGG + Intronic
904879278 1:33682726-33682748 CTAGAGCAGACCAAGGGTATAGG - Intronic
904922104 1:34015876-34015898 CTTCAGCAGGAAAAGAATGTGGG + Intronic
907212082 1:52832609-52832631 CTACAAAAGAAAAAGGGGGAAGG - Intergenic
908896320 1:68904443-68904465 CTGGAGCAGAAAATGTGTGTGGG - Intergenic
910014665 1:82507166-82507188 ATAAAACAGGAAAAGGGTGTGGG + Intergenic
911573089 1:99541581-99541603 ATATAGCAGAGAAAGGATGTGGG - Intergenic
912118137 1:106433215-106433237 ATACAGGAGAAAAAGAATGTAGG + Intergenic
912143631 1:106763249-106763271 CTACAGACGAGAAAGGGTTTAGG + Intergenic
912971684 1:114289771-114289793 GTAGAGCAGAAAAAGGGGGTGGG + Intergenic
916249888 1:162726759-162726781 CTACAGAAGAACAACAGTGTTGG + Intronic
916724523 1:167510742-167510764 CTACAGCAAAAGAGGGGGGTAGG + Intronic
918436031 1:184513994-184514016 CTACATCAAAAAATGGGAGTGGG + Intronic
919544601 1:198899357-198899379 CTACAGTAAAAAAAGGGGGTGGG + Intergenic
919984530 1:202663668-202663690 CTCCAGAAGAAAAAGTGTGAGGG - Intronic
920946836 1:210537282-210537304 AGACAGCAGAAGAAGGGTGAGGG - Intronic
921407756 1:214799603-214799625 CTGCAGCAGTAGAAGGGAGTAGG + Intergenic
922524718 1:226291813-226291835 CTGGAACAGAAAAAGGATGTTGG - Intronic
923848051 1:237759791-237759813 CTCAAGGAGAAAAAGGATGTGGG + Exonic
924386154 1:243499351-243499373 CTAGAACAAAAACAGGGTGTAGG - Intronic
1062785603 10:262125-262147 CTAAAGCAGAAAAAATTTGTTGG + Intergenic
1064121213 10:12621897-12621919 CTCCAGGAGAAGAAGGGAGTGGG + Intronic
1064565137 10:16632047-16632069 CTACCCCAGAAAGCGGGTGTGGG + Intronic
1064660244 10:17600625-17600647 GTACAGTAGAAGAAGGGTGCTGG - Intronic
1067247998 10:44562284-44562306 CAACAGCAGAATAAGGTGGTCGG - Intergenic
1067776033 10:49165541-49165563 CTACAGCCGTCAAAGGGAGTAGG - Intronic
1070264940 10:74893053-74893075 CCGCAGCAGAAAGAGGTTGTGGG + Intronic
1071542366 10:86498229-86498251 CTACAGCAGGACAAGGGCGCTGG + Intronic
1071923465 10:90377529-90377551 CTAAAGGAGAAACAGGATGTAGG - Intergenic
1073630514 10:105143797-105143819 CTACAGCGGGAGAAGGGAGTAGG - Intronic
1076034933 10:127191627-127191649 CTAGAGAAGAACAAGGGTGGGGG + Intronic
1076166711 10:128287927-128287949 CAACAGCAGAAAAACGGAATGGG + Intergenic
1076540434 10:131211108-131211130 GGACAGCAGCAAAGGGGTGTTGG + Intronic
1076621498 10:131792080-131792102 CCACAGCAGGAAAAGCGTCTGGG + Intergenic
1078465862 11:11549852-11549874 CTACACCTGAAGAAGGGTGGAGG + Intronic
1079545830 11:21630664-21630686 ATTCAGCAGAAAAAGGGGGATGG + Intergenic
1080304439 11:30821135-30821157 CTATGCCAGAAAAAGGGTGAGGG + Intergenic
1080674465 11:34412081-34412103 CTGGAGTAGAAAAGGGGTGTTGG + Intergenic
1080720354 11:34842291-34842313 CTGAAGGAGAAGAAGGGTGTTGG + Intergenic
1081623448 11:44632796-44632818 CTACAGCAGAGCATGAGTGTGGG + Intergenic
1085491768 11:76926237-76926259 ATACAGCAGAAAATGGGTTGGGG - Intronic
1085792582 11:79508642-79508664 CTCCAACACAAAAAGGGAGTGGG - Intergenic
1087259693 11:95996881-95996903 CTTCAGGAGAAAATGTGTGTTGG - Intronic
1087953873 11:104259248-104259270 GTACAGCAGAGAAAAGGTGGTGG + Intergenic
1088621288 11:111686528-111686550 CTAGAGCAGAAAATGTGTGCAGG + Intronic
1093883220 12:24429351-24429373 CAACAACAAAAAAAAGGTGTTGG + Intergenic
1095480527 12:42630379-42630401 CTACAGCAGAAAGAGCTTTTGGG - Intergenic
1098169155 12:67728744-67728766 CAACAGCATAAAAATGGTCTTGG - Intergenic
1099251189 12:80256975-80256997 CTACAGCAGAGAGAGGGTAAAGG + Intronic
1099564730 12:84229193-84229215 CTACAGCAGAAAAATGCCATTGG - Intergenic
1100752592 12:97715608-97715630 CTACAGCAGCAAAATGGTAGAGG + Intergenic
1100999276 12:100341164-100341186 CTGAAGTAGAAAAAAGGTGTAGG - Exonic
1101049278 12:100844468-100844490 GTCCAGGAGAAAAAGGGTGGTGG + Intronic
1102101738 12:110283499-110283521 CTACAGCAGAAAAAGGGTGTTGG + Intronic
1104192244 12:126493415-126493437 CAACAGCAGAAGATGGGGGTAGG - Intergenic
1107186763 13:37531395-37531417 TTACAGCAGAGAAAGAGTTTAGG - Intergenic
1108832775 13:54500036-54500058 CTACAGCATACAGAGGGTGCAGG + Intergenic
1109993517 13:70090391-70090413 CTACAACAGTACAAAGGTGTAGG + Intronic
1111685788 13:91499210-91499232 CAAGAGCAGGAAGAGGGTGTTGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112371099 13:98794297-98794319 CTACAGAAAAAAAAGGTTCTGGG - Exonic
1113916306 13:113876017-113876039 CTGCAGAAGAAAAGGGGTGTGGG + Intergenic
1116430882 14:44844008-44844030 CTACAGCAAAAAGGGGTTGTGGG - Intergenic
1117230670 14:53714776-53714798 CTCCATCAAAAAAAGGGAGTAGG + Intergenic
1117441145 14:55760508-55760530 GTACAGCACAAATAGGGAGTTGG - Intergenic
1121037839 14:90721187-90721209 TTTCAGCAGAAAAATGGGGTGGG - Intronic
1121743866 14:96272759-96272781 CTACAGCAGAGAAAGAATGGAGG - Intergenic
1123460153 15:20462500-20462522 CTACAGGAGAAATAGTGAGTAGG + Intergenic
1123657909 15:22537917-22537939 CTACAGGAGAAATAGTGAGTAGG - Intergenic
1124311820 15:28633116-28633138 CTACAGGAGAAATAGTGAGTAGG - Intergenic
1124901069 15:33823011-33823033 CTAAAGGAGAAAAAGGATGCTGG + Exonic
1126663587 15:51055538-51055560 CCACAGCACAACAATGGTGTAGG - Intergenic
1127334814 15:57973570-57973592 CTACAGCTGAAAAGGGGTTTGGG + Intronic
1127461648 15:59204666-59204688 CTACAGCTGAAACAGGGTCTTGG + Intronic
1128611915 15:69080912-69080934 CAGCAGCAGAAAACGGGTGCAGG - Intergenic
1128984058 15:72206580-72206602 TTACAGCAGCAAGAGGGTGGGGG - Intronic
1129180436 15:73871042-73871064 CTACAGCAGACACAAGGTGACGG + Intergenic
1130044447 15:80432797-80432819 CTGGAGGAGAAAAAGGCTGTGGG - Intronic
1133196850 16:4177205-4177227 CTTCCGCAGAGAACGGGTGTGGG - Intergenic
1134448547 16:14348852-14348874 CTAAAACAGAAAAAGGGCATTGG - Intergenic
1138215647 16:55202830-55202852 CTAGAACAGAAAAAGGATGAGGG + Intergenic
1141118120 16:81329143-81329165 CAACAGGAGAAAAAGGGTGGGGG - Intronic
1144249102 17:13397527-13397549 CTTCAGCAAAACAAGAGTGTTGG + Intergenic
1149383840 17:56122593-56122615 CTGAAGCAGAAGAAGGGAGTAGG - Intronic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1151786980 17:76279826-76279848 TTACAGCAGAGAAAGGGAGGAGG - Intronic
1157123873 18:44936999-44937021 ATCCAGCAGAAATAGGGTCTAGG - Intronic
1160350135 18:78171234-78171256 CTGAAGGAGAAAATGGGTGTGGG + Intergenic
1160952288 19:1673585-1673607 CCACAGCAGGAAGAGGGTGCGGG - Intergenic
1166502555 19:43353048-43353070 CTACTGGAGAAAGAGGGTGGGGG + Intergenic
928211065 2:29324089-29324111 CTACAGCCCAAGAAGGGGGTTGG - Intronic
931037539 2:58260258-58260280 TTACAGAAAAAAAAGGGGGTGGG + Intergenic
931171003 2:59803737-59803759 CTACAGCAGAAAGCAGGAGTGGG - Intergenic
931184893 2:59940220-59940242 CTACAGCAGAATCAGGGCATGGG - Intergenic
931977684 2:67661160-67661182 CTCCAGCATAACTAGGGTGTGGG - Intergenic
931979090 2:67675552-67675574 CTTCAGAATAAGAAGGGTGTGGG - Intergenic
932039803 2:68287211-68287233 CTTCAGCAGAAAAGGAGAGTAGG + Intronic
932087318 2:68774094-68774116 CAAAAGCTGAAAAAGGGGGTTGG + Intronic
932827532 2:74955602-74955624 CTATAGCAGAATAAGAGTCTTGG - Intergenic
932921433 2:75919567-75919589 CTCCAGTTGAAAAAGAGTGTAGG + Intergenic
932977198 2:76617358-76617380 ATAATGCAGAAAAAGGATGTTGG + Intergenic
933626703 2:84609189-84609211 CTATATCAGAAATAGGGTTTTGG + Intronic
935360061 2:102239303-102239325 CTGCAGCAGAAAATAGGTGTAGG - Exonic
935900676 2:107788825-107788847 CTACACCAGCAAAGTGGTGTGGG + Intergenic
936442306 2:112565322-112565344 ATACAGAAGATAAAGGATGTAGG - Intronic
938634449 2:133207946-133207968 GTACAGGAGAGAAAGGGTGGTGG + Intronic
941946079 2:171098891-171098913 TTAAATCAGAAACAGGGTGTTGG - Intronic
944140054 2:196446346-196446368 ATAAAGCAGGAAAAGGGGGTAGG - Intronic
948904878 2:240974668-240974690 TTACAACAAAAAGAGGGTGTTGG - Intronic
1175344162 20:58259519-58259541 TTACAGTAGAAAAAGGTTCTGGG + Intergenic
1178741425 21:35205722-35205744 CTACAGGGGAAAAGGTGTGTAGG - Intronic
1178900117 21:36591784-36591806 CAACAGCAAAAAAAGGGGGTGGG + Intergenic
1183222808 22:36527997-36528019 GGACAGAAGAAAAAGGGTGGTGG + Intronic
1183605431 22:38864845-38864867 CTCCAGGAGAATGAGGGTGTTGG - Exonic
949275236 3:2271700-2271722 CTACAGCAGAAACAGCTAGTGGG + Intronic
952004208 3:28823443-28823465 GAACAGGAGAAAAAGGGTCTGGG - Intergenic
952093837 3:29924329-29924351 ATCTAGCAGCAAAAGGGTGTAGG + Intronic
952206390 3:31184925-31184947 CAACAGAAGAAAATGGATGTTGG + Intergenic
952763207 3:36933837-36933859 CTACAGCTGAGAAAGTCTGTGGG + Intronic
952834109 3:37589754-37589776 CTAGAGCAGAATGAGGGTGTAGG + Intronic
953143058 3:40247520-40247542 CAAAAGAAGAAAAAGAGTGTGGG - Intronic
953510904 3:43537960-43537982 CTACAGACTAAAAAGGGTGGGGG + Intronic
954966396 3:54614959-54614981 CTAAAAAAGAAAAAGGGTGTGGG + Intronic
957337373 3:78848831-78848853 CTTGAGAAGAAAGAGGGTGTGGG + Intronic
957878242 3:86176667-86176689 AGACAGCAGAAAAAAGGGGTTGG - Intergenic
959379893 3:105629237-105629259 CTACAGCAGAAAGAGGGGGCAGG + Intergenic
960194288 3:114746331-114746353 CTACAGTAGAAAAAGGGGAATGG - Intronic
960550813 3:118974159-118974181 CTACAGGAGATAAAGTGGGTTGG + Intronic
961071720 3:123936032-123936054 ATACAGAAGATAAAGGGAGTGGG - Intronic
961452158 3:127007124-127007146 CTACAGGAGAAGCAGGGTGGTGG + Intronic
962023170 3:131521412-131521434 CTCAAGCAGAAAAAAGGTGCTGG + Intergenic
963141080 3:141946572-141946594 CTAAAGAAGAAAAAGTGAGTGGG - Intergenic
963923537 3:150928205-150928227 CAACAGAAGAAACAAGGTGTTGG + Intronic
967014429 3:185468817-185468839 CAACAAAAGAAAAGGGGTGTTGG - Intronic
968334335 3:197900548-197900570 CCACAGCAGAACAAGGCTCTGGG + Intronic
968334354 3:197900671-197900693 CCACAGCAGAACAAGGCTCTGGG + Intronic
970887947 4:21008286-21008308 CTAGAGAACAAAAAGGGTGGAGG - Intronic
972118829 4:35675012-35675034 CTATAGCAGAAAAAGCTTCTAGG + Intergenic
974232204 4:59131436-59131458 GTTCAGCAGAAAGAGGGTATAGG + Intergenic
974738497 4:65973269-65973291 ATACTGCAGAAATAGGGTGTGGG - Intergenic
979877200 4:125907767-125907789 CTACATCACATGAAGGGTGTAGG - Intergenic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
987241787 5:16007396-16007418 CTACAGAAGAACTAGGGTGTGGG + Intergenic
990611036 5:57457083-57457105 CTTTATCAGAAAAAGGATGTAGG - Intergenic
992271503 5:75068886-75068908 CATCAGCAGAAAAAGGATGGTGG + Intronic
993486813 5:88497046-88497068 CTACAGGATGGAAAGGGTGTTGG - Intergenic
996382044 5:122872340-122872362 CTACAGCACAGAAAGGTAGTTGG - Intronic
996881617 5:128303676-128303698 CCACACCAAAAAAAGGGTGGGGG + Intronic
997905139 5:137808839-137808861 CTGCAGCAGAAAAAGGGAGGTGG - Intergenic
998747322 5:145275423-145275445 CTACAACCGGAAGAGGGTGTAGG + Intergenic
999235526 5:150089662-150089684 TTTCTGCAGAAAAAGGCTGTTGG - Intronic
1000655942 5:163877917-163877939 CTACAGCAATAAATGGGTGGGGG - Intergenic
1001116302 5:168943214-168943236 ATACACCAGAAGAAGGGTTTGGG + Intronic
1001801516 5:174548332-174548354 CTAAATCAGAAAGAGGCTGTTGG + Intergenic
1002333779 5:178464033-178464055 TTACGGCAGTAAAAGGGGGTAGG - Intronic
1002634155 5:180598836-180598858 CCAGAGCAGAACAAGGGTGGGGG + Intergenic
1006290092 6:33128204-33128226 CTATAGAAGAAAAATGGGGTCGG - Intergenic
1006818532 6:36871217-36871239 ATAAAGCAGGAAAAGGGTGTGGG - Intronic
1008282572 6:49613998-49614020 AAACAGCAGAAAAAGAGAGTGGG - Intronic
1009688351 6:66992191-66992213 CTGCAGTAGAAAAAGGGAGTTGG - Intergenic
1013421888 6:109974617-109974639 CTACAGCAGAATAAAGGGTTGGG + Intergenic
1013878096 6:114858506-114858528 CTACAGAGGAAGAAGGGGGTGGG + Intergenic
1014628736 6:123762872-123762894 CCACAACAGAAAAAGGATGTAGG + Intergenic
1015101822 6:129490617-129490639 CTAAAGGGGAAAAAGAGTGTAGG + Intronic
1015159337 6:130134924-130134946 ATAAATCAGAAAAAGGATGTTGG - Intronic
1017171958 6:151465368-151465390 ATAAAGCAGGAAAAGGGCGTTGG + Intronic
1017546465 6:155456575-155456597 CTATAGAAGACAAAGAGTGTGGG + Intergenic
1018584968 6:165347775-165347797 CTACAGCAGGTAAAGGCTGGAGG + Intronic
1020416922 7:7957115-7957137 CTAGAAATGAAAAAGGGTGTGGG + Intronic
1021537186 7:21718724-21718746 TTATAGCAAAAAAAGGGTGTGGG - Intronic
1026440540 7:70439881-70439903 ATACACAAGAAAAAGGGTGTGGG - Intronic
1028180875 7:87722711-87722733 CAGCAGCAGAAAAAGAGAGTTGG - Intronic
1028232140 7:88318552-88318574 CTACAGAATAAAAATGGAGTTGG - Intergenic
1029168593 7:98615634-98615656 ATCCAGCTGAAAAAGGATGTAGG + Intergenic
1029414546 7:100434748-100434770 CCACAGCACAAAAAAGGTGCTGG - Intergenic
1029532391 7:101134061-101134083 CTCCAGCAGAAACAGGGGGAGGG - Intronic
1030743417 7:113137003-113137025 GAACATCAGAAAAATGGTGTGGG + Intergenic
1030987622 7:116261143-116261165 CTACAGAAGAAATAGGCTTTGGG + Intergenic
1031639904 7:124149594-124149616 ATACAGCAGAACTTGGGTGTGGG - Intergenic
1032442166 7:131950207-131950229 CCACAGCAGGAAGAGGCTGTGGG + Intergenic
1033026714 7:137781532-137781554 CTAGAGAAGAAAAGGGGTGAAGG + Intronic
1033866762 7:145698515-145698537 CTACATCAGAAAAGGTGGGTTGG - Intergenic
1037584969 8:20269960-20269982 CTCAAGCAGAAAGAGGGTGTTGG + Intronic
1037618504 8:20542927-20542949 TTACATCAGAAAAAGGGTCCAGG + Intergenic
1037829140 8:22177825-22177847 CAAGATCAGGAAAAGGGTGTGGG - Intronic
1042037180 8:64547116-64547138 TAACAGGAGAAAATGGGTGTGGG - Intergenic
1043865655 8:85372308-85372330 ATACAGCAGAAAACAAGTGTTGG + Intronic
1043971799 8:86538085-86538107 CTACAGCAGACCAAGTGTGGTGG + Intronic
1044744771 8:95361541-95361563 CATCAGCAGAAAAAGGGCCTGGG + Intergenic
1044750743 8:95413036-95413058 CTACAGAAGAAAAATGGAATGGG + Intergenic
1044916037 8:97113311-97113333 CAGCAGCAGGAGAAGGGTGTGGG + Intronic
1047700548 8:127445385-127445407 CTGCAACAGACAAAGAGTGTTGG - Intergenic
1048280286 8:133100799-133100821 CTACAGAAAAAAAAGAATGTGGG - Intronic
1048919843 8:139218275-139218297 CTACAGCAGAGGCAGGTTGTAGG - Intergenic
1051737500 9:20216379-20216401 CTAAAGCAGAAAATGGTTGGAGG + Intergenic
1052078537 9:24174947-24174969 GTACAGCAGAAAAACGGAATGGG - Intergenic
1052207373 9:25859031-25859053 TTACAGCAGAAAAAGAAAGTAGG + Intergenic
1052641163 9:31166954-31166976 CTACACCAGAACTGGGGTGTGGG + Intergenic
1052840262 9:33287205-33287227 CTGCAGGAGGAAAAGGGTTTTGG + Intergenic
1053175409 9:35918844-35918866 TTACAGCTGAAGAAGGCTGTTGG + Intergenic
1056735209 9:89203617-89203639 CTAGTGCAGAACAAGGATGTTGG + Intergenic
1057269069 9:93636938-93636960 CTCATGCAGAAAAAGAGTGTGGG - Intronic
1057310998 9:93943231-93943253 ACACAGCTGACAAAGGGTGTGGG + Intergenic
1058415793 9:104787488-104787510 CTACAGAAGAAAAAAGGTCAAGG + Intronic
1059018101 9:110543927-110543949 CTTAAGCAGAAAAAAGGTGGGGG - Intronic
1059256700 9:112937520-112937542 CTAAAGCTGACACAGGGTGTTGG + Intergenic
1061516586 9:131093619-131093641 TTTCAGCAGAAAAGGGGTGTTGG + Intronic
1190287387 X:48970522-48970544 GAAGAGCAGAAAAGGGGTGTGGG + Exonic
1194824405 X:98543580-98543602 TTCCAGAAGAAAAAGGGTGGTGG + Intergenic
1195144512 X:101999902-101999924 CTGCAGCGGGAGAAGGGTGTAGG - Intergenic
1197189319 X:123628273-123628295 ATACAGCAGCAAGAGGGAGTAGG - Intronic
1198660582 X:138964193-138964215 CTACAACAGAAACAGGTTGAGGG + Intronic
1199812003 X:151359449-151359471 CTGCAGCAGGGAAAGTGTGTTGG - Intergenic