ID: 1102109576

View in Genome Browser
Species Human (GRCh38)
Location 12:110354761-110354783
Sequence CCTTCTGAGCTGACAGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102109576_1102109579 7 Left 1102109576 12:110354761-110354783 CCTTGTACTGTCAGCTCAGAAGG 0: 1
1: 1
2: 4
3: 30
4: 237
Right 1102109579 12:110354791-110354813 CACACTTGGCTTCCAGTGTTAGG 0: 1
1: 0
2: 2
3: 14
4: 175
1102109576_1102109578 -7 Left 1102109576 12:110354761-110354783 CCTTGTACTGTCAGCTCAGAAGG 0: 1
1: 1
2: 4
3: 30
4: 237
Right 1102109578 12:110354777-110354799 CAGAAGGCAATGAACACACTTGG 0: 1
1: 0
2: 3
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102109576 Original CRISPR CCTTCTGAGCTGACAGTACA AGG (reversed) Intergenic
900015173 1:143757-143779 GCTGCTGATCTGACAGGACATGG + Intergenic
900045441 1:502366-502388 GCTGCTGATCTGACAGGACATGG + Intergenic
900067639 1:744096-744118 GCTGCTGATCTGACAGGACATGG + Intergenic
900380568 1:2381944-2381966 CCTCCTGGGCTGACAGCACCAGG - Intronic
901712959 1:11130134-11130156 CATTCTGAACTGACAGCCCAAGG + Intronic
901929131 1:12585750-12585772 CCTGCACAGCTGACAGGACAAGG + Intronic
902196886 1:14804491-14804513 CCATATGAGTTGAGAGTACAGGG + Intronic
903557794 1:24206179-24206201 CCCTCTCAGCTGACAGGGCAGGG - Intergenic
905434440 1:37946989-37947011 CCTCCTGAGCTGTCACCACAGGG + Exonic
906133100 1:43473613-43473635 CCTTCTCAGCTGACAGAGTAAGG - Intergenic
906922440 1:50078891-50078913 CCTTCTGAGCTCACAATGGAAGG - Intronic
907988787 1:59558574-59558596 ACTTCTGAGGAAACAGTACAAGG + Intronic
909755366 1:79219529-79219551 CCCTCTGAGCTGACAGAACAAGG - Intergenic
909755371 1:79219632-79219654 CCCTCTCAGCTGACAGAACAAGG - Intergenic
909988568 1:82192934-82192956 GCTTCTGTGCTAACAGTAGACGG - Intergenic
911381330 1:97118724-97118746 ACTTCTGAGTCGACAGTAAAAGG - Intronic
911565648 1:99460760-99460782 CCTTCTCAGCAGACAGAACAAGG - Intergenic
912065612 1:105737279-105737301 CCTTCTCAGCTGATAAAACAAGG + Intergenic
912834776 1:112986444-112986466 CCTGCAGAGCTGGCAGCACAAGG + Intergenic
912889681 1:113516184-113516206 CCTTGTCAGCTGACAGAACAAGG - Intronic
913974425 1:143443269-143443291 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
914068815 1:144268883-144268905 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
914110340 1:144697471-144697493 CCTTAAGAGCTGAGAGTACAGGG + Intergenic
915066477 1:153229211-153229233 CCCTCTGAGCTGGCCCTACAGGG - Intergenic
915242980 1:154537074-154537096 CCTTCTGGGCTGACAATAGTAGG - Intronic
916353980 1:163883776-163883798 GCTTATAAGCTGTCAGTACAAGG + Intergenic
917629743 1:176879949-176879971 CTTTCTGAGATGACCGCACATGG - Intronic
917725604 1:177824707-177824729 CCTTCTGGGCTGACTGTGCACGG - Intergenic
921190586 1:212704552-212704574 CCTTCTGAGCTGTCGTGACAGGG - Intergenic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
921352421 1:214249811-214249833 CCTTCTGAGCCGAACGTTCATGG - Intergenic
922103002 1:222489490-222489512 GCTGCTGATCTGACAGGACATGG + Intergenic
922263322 1:223961978-223962000 GCTGCTGATCTGACAGGACATGG + Intergenic
922720109 1:227895999-227896021 CCTCCTGAGCTGAGAGTGCCTGG - Intergenic
923522718 1:234748319-234748341 CATTGTGGGCTGACAGTACAGGG - Intergenic
924345163 1:243066992-243067014 GCTGCTGATCTGACAGGACATGG + Intergenic
1063171835 10:3516285-3516307 CCTTGAGAGCTGACTGTGCAGGG + Intergenic
1063911982 10:10839224-10839246 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1066691676 10:38034876-38034898 CCATCTCAGCTGACAGAACAGGG + Intronic
1066731173 10:38437817-38437839 GCTGCTGATCTGACAGGACATGG - Intergenic
1067001028 10:42613783-42613805 CTGTCTCAGCTGACAGAACAGGG - Intronic
1067804419 10:49383077-49383099 TCTTCTGAGCTGCCAGTCCCTGG - Intronic
1068509369 10:57944791-57944813 CCTGCTGAGCTGGGACTACAGGG - Intergenic
1069613877 10:69793722-69793744 CCCTCAGAGCTGTCAGTCCATGG - Intergenic
1069668304 10:70180060-70180082 CCTTCTCAGCTGACATAGCAAGG - Intergenic
1071232675 10:83606870-83606892 CCTTTTTAGTTGACATTACATGG - Intergenic
1071717375 10:88110909-88110931 CCTGCTTTGCTGGCAGTACATGG - Intergenic
1074286429 10:112102192-112102214 AGTTCTGAGCTGTCAGTCCAGGG - Intergenic
1076161990 10:128251480-128251502 ACTTCTGAGCTGAGGCTACAAGG - Intergenic
1076358914 10:129873062-129873084 CCTTCGGAGCTGACTGGACCAGG + Intronic
1076971767 11:138857-138879 GCTGCTGATCTGACAGGACATGG + Intergenic
1077396676 11:2327261-2327283 CCTTCTGGGCTGGCAGCCCAAGG + Intergenic
1078777789 11:14409791-14409813 CCTACTTAGCTGACAGCATAAGG + Intergenic
1078804527 11:14684454-14684476 GCTTCTGAGGAAACAGTACAAGG + Intronic
1079105092 11:17566048-17566070 CCTTCTCAGCTGACAGAGAAAGG + Intronic
1079348872 11:19676077-19676099 CCTTCTGATGTGCCAGAACAAGG - Intronic
1080114093 11:28602373-28602395 CCTTCTGAGGTAACATGACAGGG - Intergenic
1081609492 11:44551746-44551768 GATTCTGACCTGACAGTCCATGG + Intergenic
1082262521 11:50088199-50088221 GCTGCTGATCTGACAGGACATGG + Intergenic
1082599172 11:55128240-55128262 CAGTCTGAGCTCACACTACAAGG + Intergenic
1082696071 11:56366235-56366257 CCTTCTCAGCTGACAGATCAAGG - Intergenic
1082793329 11:57362476-57362498 CCTTCTGTCCTGACACTGCATGG + Intronic
1083169737 11:60915961-60915983 CCTTCTGGGCTTACAGGCCATGG - Intronic
1084528007 11:69709304-69709326 CCTTCTGAACCGGCAGTAAAGGG - Intergenic
1086992800 11:93324085-93324107 CCCTCTCAGCTGACAGAACAAGG - Intergenic
1091927200 12:4362729-4362751 CCCTCTCAGCTGACAGAACAAGG + Intergenic
1093340584 12:17968169-17968191 CCTTCTAAGCTGACAGAGCAAGG + Intergenic
1093477972 12:19575651-19575673 CCTTCTGAGATTAGAGTAAAGGG - Intronic
1093978467 12:25449996-25450018 ACTTCTCAGCTGACAGAGCAGGG + Intronic
1095781304 12:46063584-46063606 CCCTCTTAGCTGACAGAGCAAGG - Intergenic
1095981827 12:47978521-47978543 GCTTCTGAGCTCACAGAGCATGG - Intronic
1097050103 12:56217718-56217740 GCTGCTGATCTGACAGGACATGG - Intronic
1097316866 12:58180917-58180939 TCCTCTGAGCTGACATTCCATGG + Intergenic
1097887470 12:64743377-64743399 TCTGGTGAGCAGACAGTACAGGG + Intronic
1098652804 12:72994209-72994231 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1099351002 12:81568223-81568245 CTCTCTGAGATGACAGTGCAGGG + Intronic
1099746549 12:86711327-86711349 CCATCTTAGCTGCCAGTACCAGG + Intronic
1101269220 12:103125413-103125435 CCATCTGAGCTCACAGGAGAGGG - Intergenic
1102109576 12:110354761-110354783 CCTTCTGAGCTGACAGTACAAGG - Intergenic
1105894841 13:24709137-24709159 CCTTCAGAACTGCCAGCACAGGG + Intronic
1107260974 13:38490788-38490810 CTTTCTCAGCTGAGAGAACAAGG + Intergenic
1107415642 13:40197629-40197651 CAAACTGAGCAGACAGTACAAGG - Intergenic
1109443137 13:62400363-62400385 CCTTCAGAGCTGACAGAGGAGGG - Intergenic
1109558396 13:64012952-64012974 CCTTCTCAGCTGACACAACAAGG + Intergenic
1110651777 13:77950475-77950497 CCTTCAGAGCTGACAGAAGGAGG + Intergenic
1111367252 13:87264844-87264866 TCCTCTCAGCTGACAGAACAAGG + Intergenic
1111793277 13:92885625-92885647 CCTGCTGATCTGACAGGAGATGG - Intergenic
1112943455 13:104894837-104894859 GCTTCTCAGCTGACAGGGCAAGG + Intergenic
1115333049 14:32218945-32218967 GGTTCTGAGCTGACATTCCAGGG - Intergenic
1119324179 14:73749792-73749814 CTTTCTGAGCTGAGAGAACTTGG - Intronic
1120249421 14:82044298-82044320 CCTTCTAGACTGACAGTACCTGG - Intergenic
1124199881 15:27670074-27670096 CCTTCTCAGCTGACAGAACAAGG - Intergenic
1127299043 15:57634630-57634652 CCTTATGAGGGGACAGTACAGGG - Intronic
1127494259 15:59494878-59494900 CCTTCTGAGCTGGATTTACAGGG - Intronic
1127499986 15:59546346-59546368 CCTTGAGAGCTGACAGTCAATGG - Intergenic
1128469282 15:67938417-67938439 CCTTCTCAGCTGACAGCAAGAGG - Intergenic
1131381627 15:91968920-91968942 ACCTCTGAGCTGACTCTACATGG - Intronic
1131888818 15:96950115-96950137 CCTTTTTAGCTAACAGAACATGG + Intergenic
1132245819 15:100295415-100295437 CCTACTGAGCTGAAAACACAAGG - Intronic
1134096271 16:11420943-11420965 CCCTCTGGGATGACAGCACAGGG + Intronic
1134772004 16:16817207-16817229 CCTTCTGAGCTTTGAGCACAAGG - Intergenic
1136407725 16:30058301-30058323 CCTTCTGGGCTGTTATTACAAGG - Intronic
1139921462 16:70463226-70463248 CATCCTGACCTGCCAGTACAAGG + Exonic
1140188248 16:72793390-72793412 GCTGCTGAGCTGCCAGTCCAAGG + Exonic
1141564626 16:84893063-84893085 CCTTCTGAGCTGTGAGTTCTAGG - Intronic
1142448480 16:90158665-90158687 GCTGCTGATCTGACAGGACATGG - Intergenic
1142459005 17:76624-76646 GCTGCTGATCTGACAGGACATGG + Intergenic
1143756611 17:9072282-9072304 CCTTCTTGGCAGACAGTCCACGG - Intronic
1144200591 17:12937974-12937996 CCTCCTGAGCTGGGACTACAGGG - Intronic
1147839198 17:43358593-43358615 CCTTCAGAGCTGACAGAAAGGGG + Intergenic
1148692614 17:49540009-49540031 CCTTCTCATCTGACAGAGCAAGG + Intergenic
1148911595 17:50945964-50945986 CCTGTGGAGCTGACAGTCCAAGG + Intergenic
1149176104 17:53872274-53872296 CCTTATGGGCTGAAAGTTCATGG + Intergenic
1149619143 17:58029059-58029081 CCCTCTCAGCTGACAGAGCAAGG - Intergenic
1151485284 17:74395110-74395132 CCATCTGAGCTGCCAGTCCTGGG - Intergenic
1151634497 17:75336025-75336047 TTTTCTGTGCTGCCAGTACAGGG - Intronic
1152413573 17:80144295-80144317 CCTGAGGAGCTCACAGTACAGGG - Intronic
1152687389 17:81701266-81701288 CCTTCTCAGCAGACAGAACGAGG + Intronic
1153127375 18:1810761-1810783 CCCTTTCAGCTGACAGAACAGGG + Intergenic
1153225151 18:2894221-2894243 CCTCCTGAGCTGCCAGGACCTGG - Intronic
1158527391 18:58227425-58227447 TCTTCTGAGCTGTCAGTATTTGG + Intronic
1159182571 18:64927808-64927830 CCCTCTAAACTAACAGTACAAGG - Intergenic
1160292735 18:77609175-77609197 CCTTCTGAGTTGGCAGGGCAGGG + Intergenic
1160367289 18:78337231-78337253 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1160648724 19:209137-209159 GCTGCTGATCTGACAGGACATGG + Intergenic
1162087679 19:8258319-8258341 CCTTGTGAGCAGACATTGCATGG + Intronic
1163546565 19:17944286-17944308 CCTTCTGAGATTCCAGTTCAGGG + Intergenic
1164757256 19:30699266-30699288 CCCTCTCAGCTGACAGAATAAGG + Intronic
1168417079 19:56175955-56175977 CCTTCTGAGGAGACAATAGAAGG - Intergenic
928605634 2:32943244-32943266 CCATCTCAGATGATAGTACATGG + Intergenic
928642639 2:33316503-33316525 CCTGCTGAGCAGACAAAACATGG + Intronic
928667459 2:33564203-33564225 CCTTGGGAGCTGACAGCCCATGG + Exonic
928737351 2:34307686-34307708 CCTTCTCACCTGACAGCAAATGG + Intergenic
929688874 2:44058205-44058227 CCTTATCAGCTGACAGTAACTGG - Intergenic
930244883 2:48973382-48973404 CCGCCTGAGCTGACATTGCATGG + Intronic
933433757 2:82218178-82218200 CCTGCTGAAATTACAGTACAAGG + Intergenic
933506885 2:83187962-83187984 CCTTCTGAGGTGACAGAAAGTGG - Intergenic
933874849 2:86609258-86609280 GCTTCTGTGCTGCCAGAACATGG - Intronic
934179131 2:89604244-89604266 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
934289415 2:91678512-91678534 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
934969761 2:98753761-98753783 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
935751195 2:106235289-106235311 CCTTCTGAGGAAACAGGACAAGG + Intergenic
940731108 2:157393455-157393477 CCTTGTGAGGTGCCAGAACAGGG - Intergenic
941411106 2:165158116-165158138 CCCTCTCAGCTGACAGAACAAGG + Intronic
942040178 2:172053332-172053354 CCTTCTGAGCTTACTGTAGGAGG + Intronic
942129711 2:172866072-172866094 CCTTCTCATCTGAGTGTACATGG + Intronic
943183780 2:184578330-184578352 TCCTCTCAGCTGACAGAACAAGG - Intergenic
943716305 2:191155809-191155831 GCTTCTGAGATGGCAGTAGAGGG - Intergenic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
944452950 2:199861643-199861665 CCTTCTTTGCTGATTGTACATGG - Intergenic
944503858 2:200389916-200389938 CCTTAAGAGCTAACATTACAAGG - Intronic
945510632 2:210698042-210698064 CCTTCTCAGCTGACAGAGCAAGG + Intergenic
947116354 2:226775584-226775606 CCTTCTCAGCTGACAGAGCATGG - Intronic
1169334359 20:4743252-4743274 CCTTCTCAGATGACAGAGCAAGG - Intergenic
1171448200 20:25219307-25219329 CCTCCTGTGCTGTCTGTACAAGG - Intronic
1176902602 21:14461431-14461453 TTTTCTGAGCTCAAAGTACAGGG + Intergenic
1179790565 21:43753804-43753826 CCTGCTGAGCTGACAGGGCATGG + Intronic
949296242 3:2527326-2527348 ACTTCTAAGGTGACAGAACAGGG - Intronic
949296861 3:2534736-2534758 ACTTCTAAGGTGACAGAACAGGG - Intronic
950433574 3:12965793-12965815 CCCTCTGAGCTGAAAGTAACTGG - Intronic
950458013 3:13104120-13104142 CCATCGGAGCTGACAGGCCATGG - Intergenic
951849661 3:27125003-27125025 CCTTCTGAGTTGACAATAATAGG + Intronic
953017428 3:39091380-39091402 TCTTCTTAGATAACAGTACAAGG - Intronic
954041678 3:47892432-47892454 CTTACTGAGCTGACCGTACGCGG + Intronic
955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG + Exonic
956397504 3:68841428-68841450 CCTTCTTTCCTGACAGGACAAGG + Intronic
956862877 3:73341529-73341551 CCTTCCAAGCTTACAGCACAAGG + Intergenic
958918072 3:100071801-100071823 CCTTGAGAGCTGACAGGAAAAGG - Intronic
959396643 3:105848075-105848097 CATTCTGAGCTGACATTTCTGGG - Intronic
961092690 3:124128554-124128576 CCCTCTGAGTTGACAATACAGGG + Intronic
961497085 3:127301443-127301465 TCTGCTCAGCTGACAGAACAAGG + Intergenic
962428098 3:135292384-135292406 CCTTCTCAACTGACAGAGCAGGG - Intergenic
963237774 3:142972497-142972519 TCTTCTGAGCAGACAGCCCAAGG - Intronic
965954397 3:174351203-174351225 TCCTCTCAGCTGACAGAACAAGG + Intergenic
968369126 3:198210978-198211000 GCTGCTGATCTGACAGGACATGG - Intergenic
969271946 4:6108947-6108969 CCCTCTCAGCTGCCAGAACAAGG - Intronic
969830151 4:9789372-9789394 CCTTAAGAGCTGAGAGTACAGGG + Intronic
970459069 4:16254819-16254841 CTTTCTGAGCTGGTAGTAGAGGG + Intergenic
971981832 4:33761620-33761642 ACCTCTAAGCTGACAGAACAAGG - Intergenic
972599072 4:40555826-40555848 CCTTCACAGGTGACAGCACAAGG - Intronic
973982823 4:56320550-56320572 CCTTCGGTGCTCACAGCACACGG + Intronic
977910142 4:102524835-102524857 ACTGCTGATCTGACAGGACACGG + Intronic
979257552 4:118620687-118620709 GCTGCTGATCTGACAGGACATGG - Intergenic
979423759 4:120538820-120538842 CCTTCTGAGCTGACAGCGCAAGG + Intergenic
980487398 4:133476393-133476415 ACTTGTGAGTTTACAGTACAGGG + Intergenic
981764080 4:148228026-148228048 CCTTCTCAGTAGACAGAACAAGG + Intronic
981801316 4:148660368-148660390 CCATCTCAGCTGACAGAGCAAGG + Intergenic
982284202 4:153717467-153717489 ACCTCTTAGCTGACAGAACAAGG + Intronic
984836530 4:184027516-184027538 TCTTCTCAGCTGACAGAGCAAGG + Intergenic
985569074 5:634182-634204 CCTTCTGAGATCACAGGAAAAGG + Intronic
985932615 5:3070519-3070541 CCTTCTGGGCTGACTGTCAAGGG + Intergenic
986515264 5:8555473-8555495 CCTTCTCAGTTGATAGAACAAGG - Intergenic
986947176 5:13036919-13036941 TCTTCTCAGTTGACAGAACAGGG - Intergenic
988398189 5:30724623-30724645 TCTTCTTAGCTGACAGAGCAAGG + Intergenic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
990794687 5:59526139-59526161 CATTCTGAAATAACAGTACAGGG + Intronic
990798171 5:59567948-59567970 CCTTCTTGGCTGACAGAGCAAGG - Intronic
993923383 5:93835249-93835271 CTACCTGAGCTGACAGCACATGG + Intronic
997510475 5:134450447-134450469 CCTTCTGGGCTGACAGAGAAGGG - Intergenic
998437009 5:142119033-142119055 CCTTCTAAGCTGACAGAGCAAGG + Intronic
998748390 5:145288632-145288654 CTTTCTTAGCTGACAGAGCAAGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999247807 5:150164607-150164629 CTTTCTGAGCTGAGAGAACTGGG - Intergenic
1000425322 5:161083508-161083530 CCCTTTCAGCTGACAGAACAAGG - Intergenic
1000514512 5:162223862-162223884 CCCTCTCAGCTGACAGAGCAAGG - Intergenic
1000870746 5:166574275-166574297 CCTTCTGAGGTGACCGTATTTGG - Intergenic
1001870239 5:175148118-175148140 CCCTCTCAGCTGACAGATCAGGG - Intergenic
1002554333 5:180023277-180023299 CCTTCTCAGCTGACAGAACAAGG - Intronic
1002591945 5:180296542-180296564 CCATCTCAGCTGACAGAGCAAGG - Intergenic
1002728402 5:181316563-181316585 GCTGCTGATCTGACAGGACATGG - Intergenic
1003027407 6:2567684-2567706 CCTTCTCAGCTAACAGAGCAAGG + Intergenic
1003400178 6:5784412-5784434 CCTCCAGAGCTGACACTTCACGG + Intergenic
1005002089 6:21251878-21251900 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1010463055 6:76134951-76134973 CATTCTGAGCTGACAGAATCAGG - Intergenic
1011907965 6:92396147-92396169 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1014565961 6:122947708-122947730 CTTTATGACCTGACTGTACAGGG - Intergenic
1016007065 6:139099858-139099880 CCCTCTTAGCAGACAGTGCAAGG + Intergenic
1016657349 6:146536650-146536672 CCATCTCAGCTGAAAGAACAAGG - Intergenic
1018236178 6:161725898-161725920 CCTCCTGCTCTGACAGTATATGG - Intronic
1018979128 6:168588953-168588975 CCTTCAGAGCTGAGACTACAGGG - Intronic
1019331213 7:461782-461804 CATGCTGAGCTGGCAGGACAAGG - Intergenic
1023399536 7:39781962-39781984 GCTGCTGATCTGACAGGACATGG - Intergenic
1023940229 7:44764767-44764789 CTATGTGAGGTGACAGTACAAGG - Intronic
1024072473 7:45797751-45797773 GCTGCTGATCTGACAGGACATGG - Intergenic
1024298365 7:47864268-47864290 CCTTCTGTGGTGACAGAGCATGG + Intronic
1024534619 7:50419905-50419927 CCTTCAGAGCTGACTCTGCAAGG + Intergenic
1024650861 7:51402429-51402451 GCTGCTGATCTGACAGGACATGG + Intergenic
1025133052 7:56388231-56388253 GCTGCTGATCTGACAGGACATGG + Intergenic
1025910933 7:65827819-65827841 GCTGCTGATCTGACAGGACATGG - Intergenic
1026885633 7:73942190-73942212 CATTCTGAGCTGATCTTACAGGG + Intergenic
1028134653 7:87212702-87212724 CATTCTGAGCTCACAGTAGAAGG - Intronic
1028650964 7:93150484-93150506 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
1030524853 7:110640631-110640653 TTTTCTGAGCTGACACAACAAGG - Intergenic
1031869017 7:127072192-127072214 CTTGCTGAGCTGAGACTACAGGG - Intronic
1031880730 7:127195607-127195629 CCTTCTAAGTTGACAGGAGAGGG - Intronic
1032049866 7:128641456-128641478 GCTGCTGATCTGACAGGACATGG - Intergenic
1037326464 8:17696174-17696196 CAGTCTGAGCTGACGGTAAATGG - Intronic
1038551494 8:28473060-28473082 CCCTCTGAGCTCTCAGTACCAGG + Intronic
1039501664 8:38022445-38022467 GCTTCTGAGCAAACAGGACAAGG + Intergenic
1040092153 8:43409316-43409338 CCTTGTGAGCCCACACTACAGGG - Intergenic
1041440764 8:57894037-57894059 GCTTCTCAGCTGACAGGGCAAGG + Intergenic
1042782205 8:72504328-72504350 CCTTCTCAGCTGATAGAGCAAGG - Intergenic
1046899519 8:119509035-119509057 CCTTTGGAGCTCACAGTCCATGG + Intergenic
1048095226 8:131284877-131284899 CCTCCTGAGAGGACAGTTCATGG - Intergenic
1048194666 8:132322473-132322495 CCTCCTGAGCTGTAAGGACATGG + Intronic
1049206386 8:141365574-141365596 CTTTCCGAGCTGACAGCTCAGGG + Intronic
1052143282 9:25016046-25016068 ACTTCTGAGCTGACAGTACAAGG - Intergenic
1055261215 9:74436353-74436375 AGATCTAAGCTGACAGTACACGG - Intergenic
1055636683 9:78286060-78286082 CAATCTGAGATGACAGGACAGGG + Intergenic
1056479497 9:86986621-86986643 CCCTATGAGGTGACAGCACAAGG + Intergenic
1056538528 9:87551840-87551862 CCCTCAGAGATGACAGCACAGGG - Intronic
1057008182 9:91578942-91578964 CCTTCTGAGCAGACTGCCCAAGG - Intronic
1057746350 9:97754883-97754905 CCTTCTCAGCAGACAGAGCAAGG + Intergenic
1057828112 9:98386647-98386669 CCTTCTGAGCTGATTGTGCTGGG - Intronic
1057931768 9:99199816-99199838 CCCTCTCAGCTGACAGAGCAAGG + Intergenic
1058103632 9:100945223-100945245 ACTTCTGAGCAGACAAAACAAGG - Intergenic
1058878960 9:109270023-109270045 CCTGCTGCGGTGACATTACATGG - Intronic
1060165418 9:121409976-121409998 CCCACTCAGCTGACAGAACAAGG + Intergenic
1060539263 9:124418869-124418891 CCTCCTGAGCTCACAGTCCAGGG + Intergenic
1060834457 9:126744651-126744673 GCTTCTCAGGTGACAGTGCAAGG - Intergenic
1061804638 9:133131200-133131222 CCAGCTGAGCAGACAGTTCAGGG + Intronic
1062753467 9:138273662-138273684 GCTGCTGATCTGACAGGACATGG - Intergenic
1203575978 Un_KI270745v1:8441-8463 GCTGCTGATCTGACAGGACATGG - Intergenic
1187393442 X:18900984-18901006 CCTTTTGAACTGACCGCACAGGG - Intronic
1188094786 X:26008036-26008058 CCCTCTGAGCAGACAGAGCAAGG - Intergenic
1197879348 X:131148887-131148909 CCGTCTCAGCTGACAGAGCAAGG + Intergenic
1198571043 X:137957296-137957318 CCTTCTGAGAAGACAGTATGTGG + Intergenic
1198723023 X:139644857-139644879 CCTTCTGAGCTGGCAAGATATGG - Intronic
1199217306 X:145275251-145275273 TCTTCTCAGATGACAGGACATGG + Intergenic
1199254838 X:145707752-145707774 CCATCTTAGCTAACAGAACAAGG - Intergenic
1199891699 X:152089609-152089631 CCCTCTCAGCTGACAGAACAAGG + Intergenic
1200084000 X:153593951-153593973 CCTTCTGAGCTGCCCGTGCATGG + Intronic
1201626250 Y:16017937-16017959 CTTTCTGAGATGACAGAAGATGG + Intergenic