ID: 1102113315

View in Genome Browser
Species Human (GRCh38)
Location 12:110381640-110381662
Sequence AACTCTGTTAGAATAATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102113315_1102113320 -10 Left 1102113315 12:110381640-110381662 CCCCAGATTATTCTAACAGAGTT 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1102113320 12:110381653-110381675 TAACAGAGTTTGGGAAGTGCTGG 0: 1
1: 0
2: 7
3: 46
4: 813
1102113315_1102113323 15 Left 1102113315 12:110381640-110381662 CCCCAGATTATTCTAACAGAGTT 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1102113323 12:110381678-110381700 TAATGAAACCTTCCATCTGAGGG 0: 1
1: 0
2: 1
3: 11
4: 175
1102113315_1102113322 14 Left 1102113315 12:110381640-110381662 CCCCAGATTATTCTAACAGAGTT 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1102113322 12:110381677-110381699 CTAATGAAACCTTCCATCTGAGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102113315 Original CRISPR AACTCTGTTAGAATAATCTG GGG (reversed) Intronic
901949259 1:12728259-12728281 TACTCTGTAAGATTAATGTGAGG - Exonic
904669996 1:32157103-32157125 AACTTTGTTAGATATATCTGAGG + Intronic
905849348 1:41261876-41261898 ACTTGTGTCAGAATAATCTGAGG - Intergenic
909477768 1:76100762-76100784 AGTTCTGGTAGAATTATCTGGGG + Intronic
911927057 1:103846639-103846661 AACTCTGGAAAAATAATCAGAGG + Intergenic
913938289 1:125077483-125077505 GAATCTTTTAGAATAATCTAAGG + Intergenic
913944547 1:125146518-125146540 GAATCTTTTAGAATAATCTAAGG - Intergenic
914358589 1:146910334-146910356 AACTCTGTTAGTAGAATTTCAGG + Intergenic
914494835 1:148186655-148186677 AACTCTGTTAGTAGAATTTCAGG - Intergenic
915127104 1:153673481-153673503 TACTATGTTAGACTAAACTGAGG - Intergenic
916280535 1:163046572-163046594 GAGTCTGATAGAATAAACTGTGG - Intergenic
916347433 1:163809645-163809667 AAATCATTTAGAATAATTTGTGG - Intergenic
917015333 1:170524998-170525020 AACTCTGTTATAATAATAACAGG - Intergenic
919859110 1:201727077-201727099 TACTCTGTAAGATTAATGTGAGG + Intronic
922545094 1:226450739-226450761 GGCTGTGTTAGAATGATCTGGGG - Intergenic
923646999 1:235833704-235833726 AACTTTGTTAAAATTATTTGTGG - Intronic
1066650369 10:37649456-37649478 AACTGGGTTAGAATCAACTGTGG - Intergenic
1067033322 10:42895295-42895317 AACTGGGTTAGAATCAACTGTGG - Intergenic
1067980596 10:51080059-51080081 AACTCTATTAGAATAACATTAGG - Intronic
1068201649 10:53791053-53791075 TACTGTGTTATAATTATCTGAGG - Intergenic
1070120946 10:73576218-73576240 AAGCCTGTTTGAATCATCTGAGG + Intronic
1070581941 10:77727682-77727704 AACTCTGTTAAAATATTCACTGG - Intergenic
1073712592 10:106061576-106061598 TACTCCCTTAGAGTAATCTGTGG - Intergenic
1074326645 10:112456958-112456980 TAATTTGTTAGAATAATGTGGGG - Intronic
1076270187 10:129145617-129145639 AACCCTGTTTAAATAATTTGGGG + Intergenic
1078300572 11:10127397-10127419 GACTCTTTTAGAATATTGTGAGG - Intronic
1078486671 11:11729545-11729567 AACTCTGTTTGAATAACTTAAGG - Intergenic
1079649257 11:22906428-22906450 ACCTGTGTTAGAATCACCTGGGG + Intergenic
1084230626 11:67750121-67750143 AACCCTGTTAGAAAAATAAGTGG + Intergenic
1084738859 11:71124958-71124980 ATATCTGTTAGGATGATCTGTGG + Intronic
1084741840 11:71145329-71145351 AACTCTCTTAAAACATTCTGAGG - Intronic
1086664001 11:89457225-89457247 AGCTCTGTTTGCATCATCTGTGG - Intronic
1092571825 12:9733680-9733702 AACTCTGTTAAAATAATTCAAGG + Intergenic
1094103004 12:26783697-26783719 AACTCTGTTGGTATCATATGAGG + Intronic
1094119542 12:26955864-26955886 AACTCTGTTAAAATTTTTTGAGG + Intronic
1095190639 12:39254512-39254534 TACAGTGTTAGAATATTCTGAGG + Intergenic
1095492842 12:42753333-42753355 AACTTTGTAAGAATATTTTGTGG + Intergenic
1096000322 12:48124385-48124407 AACCTTGGTAGAATGATCTGTGG + Intronic
1097119740 12:56722054-56722076 GACTCTGTTAGAATAGTTTTGGG + Intronic
1100156018 12:91801417-91801439 AACTCTGTTATATTTGTCTGAGG + Intergenic
1101355991 12:103978128-103978150 GACACTGTTTGAATAATCTAGGG + Intronic
1102113315 12:110381640-110381662 AACTCTGTTAGAATAATCTGGGG - Intronic
1105233999 13:18528800-18528822 GAATCTTTTAGAATAATCTAAGG - Intergenic
1106549599 13:30759807-30759829 AACAGTATTAGAATCATCTGTGG + Intronic
1107759165 13:43657888-43657910 AAATCTGTTGGAATTATCAGAGG + Intronic
1109661010 13:65460311-65460333 AACTCTATTAGTATAATCAATGG - Intergenic
1110127814 13:71969225-71969247 AACACTCTTAGAATAATATTCGG + Intergenic
1110850198 13:80236805-80236827 ATCTCTGTTACCAAAATCTGAGG + Intergenic
1110920712 13:81080778-81080800 AACTCTGATACAAGAATCTAAGG + Intergenic
1111691399 13:91567692-91567714 AAGTCTGTTGGAACATTCTGTGG + Intronic
1112557127 13:100478847-100478869 AATTCTGTTACTATAATATGAGG - Intronic
1113897166 13:113772433-113772455 AACTCTTCTAGAAAAATCTAGGG - Intronic
1115229529 14:31144827-31144849 AACTCAGTTAGAGTCATCTTGGG - Exonic
1115586255 14:34816386-34816408 AACTATTTTAGAAACATCTGGGG - Intronic
1116993851 14:51302678-51302700 GACTGTGTTAGCATGATCTGAGG + Intergenic
1119958211 14:78823848-78823870 AGCTGTGTTAGCATGATCTGAGG + Intronic
1120724168 14:87919296-87919318 ATGTATGTTAGAATAATCTGAGG - Intronic
1128928283 15:71679232-71679254 AACTCTAATAGGATAATCAGAGG + Intronic
1130681372 15:85999960-85999982 AACTCTCTTACAGTCATCTGTGG + Intergenic
1131144905 15:90004271-90004293 AACTCTGCTAGAAATATCTCTGG - Intronic
1136541382 16:30929299-30929321 CACTGTGTTAGAATACTGTGAGG + Intronic
1136935306 16:34457384-34457406 GAATCTTTTAGAATAATCTAAGG + Intergenic
1136938136 16:34495147-34495169 GAATCTTTTAGAATAATCTAAGG + Intergenic
1136949230 16:34695045-34695067 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136961679 16:34853410-34853432 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136964512 16:34891196-34891218 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136968653 16:34945756-34945778 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137089116 16:36166306-36166328 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137093654 16:36225524-36225546 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137368543 16:47882728-47882750 AACTCAGTTGGAAAAATATGGGG - Intergenic
1145179459 17:20733229-20733251 ATCTCTGTTAGTAAAATCTTAGG + Intergenic
1146852238 17:36232468-36232490 ATCTCTGTTAGTAAAATCTTAGG - Intronic
1146868146 17:36356339-36356361 ATCTCTGTTAGTAAAATCTTAGG - Intronic
1147071020 17:37956957-37956979 ATCTCTGTTAGTAAAATCTTAGG - Intergenic
1147082546 17:38036483-38036505 ATCTCTGTTAGTAAAATCTTAGG - Intronic
1147098490 17:38160451-38160473 ATCTCTGTTAGTAAAATCTTAGG - Intergenic
1147408680 17:40233021-40233043 CCCTCTGTTAGAGTAAGCTGTGG + Intronic
1149771653 17:59327246-59327268 AGCACTGTTACCATAATCTGCGG + Intergenic
1149839169 17:59943211-59943233 ATCTCTGTTAGTAAAATCTTAGG + Intronic
1150080029 17:62229477-62229499 ATCTCTGTTAGTAAAATCTTAGG - Intergenic
1150304206 17:64070608-64070630 AACTCAGTGAGACTAATCTTGGG - Intronic
1203184215 17_KI270729v1_random:97091-97113 GAATCTTTTAGAATAATCTAAGG - Intergenic
1154462990 18:14614853-14614875 AATACTGATAAAATAATCTGGGG + Intergenic
1154515538 18:15161077-15161099 GAATCTTTTAGAATAATCTAAGG + Intergenic
1156014029 18:32527487-32527509 AGATTTGTTAGAATCATCTGGGG + Intergenic
1156508543 18:37615544-37615566 AACTCAGATAGAATAATCTGTGG + Intergenic
1157041814 18:44048740-44048762 AACTCAGTTAATATAATCTTAGG + Intergenic
1158643289 18:59220771-59220793 TACTCTCCTAGAATAATCTTGGG + Intronic
1159118843 18:64145959-64145981 AAAGCTGTTAGAAAAATGTGGGG + Intergenic
1159512544 18:69414927-69414949 CACTCTTTTAGAATCAACTGAGG + Intronic
1166648744 19:44553805-44553827 AACCCAGTTAGAATTCTCTGTGG - Intergenic
1168667503 19:58215479-58215501 AACTCTGGGAGGATCATCTGAGG + Intergenic
927052430 2:19343999-19344021 GACTCTATGAGGATAATCTGAGG + Intergenic
927104948 2:19815974-19815996 AAAACTGTTAGAATAATATTAGG + Intergenic
930351702 2:50264679-50264701 AACTGTGTTATAATATTCTGGGG - Intronic
930648232 2:53935467-53935489 ACCTGTGGTAGAATAACCTGTGG - Intronic
931904479 2:66827453-66827475 AAATATGTTAGAATTATCAGTGG + Intergenic
934332170 2:92079105-92079127 GAATCTTTTAGAATAATCTAAGG - Intergenic
938000967 2:127736833-127736855 AACTCTTTTACAATAACGTGGGG + Intronic
938515800 2:132005848-132005870 GAATCTTTTAGAATAATCTAAGG + Intergenic
939366309 2:141236855-141236877 AAATCTCTGAGAATTATCTGGGG - Intronic
940015984 2:149104641-149104663 AAATCTTTTATTATAATCTGTGG + Intronic
940345969 2:152628991-152629013 AAGTTTGTTATAATAAACTGTGG + Intronic
940369478 2:152884484-152884506 AACTCTCTGAGAATAAAATGTGG - Intergenic
942380009 2:175380611-175380633 AAATTTGATAGAATAATCTGTGG + Intergenic
942707816 2:178796610-178796632 AACCAAGTTAGAATAATGTGTGG + Intronic
944056941 2:195532147-195532169 AACTCTGTTTGAATGCTCTATGG - Intergenic
946237107 2:218330776-218330798 ACCTATATTAGAATGATCTGGGG - Intronic
946640078 2:221774600-221774622 AACTCTGTGAGACCAAGCTGCGG - Intergenic
947137892 2:226993343-226993365 AACTCTGTTAGAACTAGCTGAGG - Intronic
947280220 2:228443805-228443827 AACACTTTTACAATAAACTGGGG + Intergenic
948305315 2:236942492-236942514 AACTATGATATAATAATCTCTGG - Intergenic
1169588052 20:7109123-7109145 AAGTCTTTTAGATTAATCTGTGG - Intergenic
1170607171 20:17882974-17882996 CATTCTGTTAGAATCATCTGAGG - Intergenic
1171123466 20:22583916-22583938 AACTCTGTTAGGATAGTGCGTGG + Intronic
1176777986 21:13157062-13157084 GAATCTTTTAGAATAATCTAAGG - Intergenic
1176811536 21:13543519-13543541 AATACTGATAAAATAATCTGGGG - Intergenic
1177350895 21:19939883-19939905 AGCTATGTTGTAATAATCTGAGG + Intergenic
1177975606 21:27846078-27846100 GAATCTTTTAGAATAATCTAAGG - Intergenic
1178429033 21:32502931-32502953 AACCCTGTTAGAAAAATAAGTGG - Intronic
1178469521 21:32879762-32879784 ATCTCTGGTAGGAGAATCTGGGG + Intergenic
1180525764 22:16258488-16258510 GAATCTTTTAGAATAATCTAAGG - Intergenic
1182501336 22:30750121-30750143 AAATTTGGTAGAATATTCTGTGG + Intronic
1203322608 22_KI270737v1_random:82415-82437 GAATCTTTTAGAATAATCTAAGG + Intergenic
950351279 3:12355925-12355947 AACTCTGTTAGGATAATCCTGGG + Intronic
952625363 3:35396349-35396371 AAGTCTGTTAGAATCACCCGAGG - Intergenic
952947548 3:38489323-38489345 AACTTTATAAAAATAATCTGTGG - Exonic
952982064 3:38744371-38744393 AACACTGTTAGCAAAATTTGGGG - Intronic
955388777 3:58503076-58503098 CTCTCTGTGAGAATATTCTGAGG + Intergenic
956981988 3:74649743-74649765 AACTCTATTAGAATTACCTGGGG + Intergenic
957006675 3:74956594-74956616 AACTGTTTTTGAAAAATCTGAGG + Intergenic
957047187 3:75385141-75385163 AACCCTGTTAGAAAAATAAGAGG + Intergenic
957411768 3:79850489-79850511 GACTTTGTTAGAATAATCATGGG + Intergenic
957438271 3:80208652-80208674 AACTATTCTAAAATAATCTGAGG - Intergenic
957570993 3:81947375-81947397 AATGATGTTAGCATAATCTGAGG + Intergenic
957572897 3:81970875-81970897 ATATCTGTTATGATAATCTGTGG + Intergenic
958217343 3:90604398-90604420 AACTCTTTTTGTAGAATCTGAGG - Intergenic
959289965 3:104461155-104461177 AACTGGGATAGAATAAACTGTGG - Intergenic
959466076 3:106689408-106689430 AATTCTGTTAGATAAATGTGTGG + Intergenic
959650142 3:108743589-108743611 AGCTCTGCTAGAAGAATCTGTGG + Intronic
961326414 3:126111936-126111958 ACCTCTGTTAGAAAACACTGTGG - Intronic
961879258 3:130049237-130049259 AACCCTGTTAGAAAAATAAGTGG + Intergenic
962056091 3:131873299-131873321 ATCTCTCTTAAAATAATGTGTGG + Intronic
964131897 3:153298463-153298485 AACTCTGATATAATAATGTAAGG + Intergenic
964472289 3:157068343-157068365 CAGTCTGTTCCAATAATCTGTGG + Intergenic
965576959 3:170227258-170227280 AACTCAGTTTGAATGATCTCTGG - Intronic
966574906 3:181489758-181489780 AACTCAGATGGAATAATCTAGGG + Intergenic
967847999 3:194059172-194059194 AACTGCGTTAAAAAAATCTGGGG - Intergenic
968991487 4:3916261-3916283 AACCCTGTTAGAAAAATAAGTGG + Intergenic
969823862 4:9741260-9741282 AACCCTGTTAGAAAAATAAGAGG - Intergenic
970072937 4:12183082-12183104 AAAGCTGTTAGAATAATGTCTGG - Intergenic
970106203 4:12587861-12587883 AACACTGTGATAATAAGCTGAGG - Intergenic
971348942 4:25839042-25839064 AAGTCTGTAAGCAAAATCTGCGG + Intronic
974779994 4:66542536-66542558 AAATATGATAAAATAATCTGAGG + Intergenic
977076844 4:92464279-92464301 AATCCTGTTAGAATACTGTGGGG - Intronic
977821252 4:101474728-101474750 ATCTGTGTTAGACTAATCTGGGG - Intronic
979144768 4:117230687-117230709 AAATCTGTTAAGATAACCTGGGG - Intergenic
979675550 4:123406680-123406702 ACCTGTATTAGAATAATCTCCGG + Intergenic
979848864 4:125551784-125551806 TACTCTGTAAGAATAACCTGTGG + Intergenic
980475909 4:133315984-133316006 AACTCTCTTAAAATAATTTTTGG - Intergenic
982431472 4:155326801-155326823 AACATTGTTAAAAAAATCTGTGG - Intergenic
983782967 4:171696424-171696446 AGCTCTGACAAAATAATCTGAGG - Intergenic
984038567 4:174700398-174700420 ATATCTGTAATAATAATCTGTGG + Intronic
984178514 4:176450985-176451007 AACTCTGGTAGAACACTCTGGGG - Intergenic
984417529 4:179480000-179480022 AATTCTGTGAGGATAATCTGTGG - Intergenic
985045159 4:185933336-185933358 AACAGTGTTTGAATCATCTGTGG + Intronic
985089545 4:186349346-186349368 AATTCTGCCAGAATACTCTGTGG + Intergenic
987546693 5:19319756-19319778 AACTCTGTTGTAATTATCTAGGG - Intergenic
987556101 5:19452284-19452306 AACTCTGTTAGGAAAATGAGTGG - Intergenic
988465315 5:31485256-31485278 AACTGTGTCAGAATCTTCTGAGG + Intronic
990127212 5:52533277-52533299 TACTCTGATAGAATATTTTGAGG - Intergenic
991978013 5:72201699-72201721 AAATCTGATAGAGTAATCTTTGG + Intronic
993971461 5:94425079-94425101 TACTCTTTTAGAATAGTTTGAGG - Intronic
995249319 5:109972103-109972125 AATTCTGGTAGAAAAATGTGTGG + Intergenic
996262036 5:121483570-121483592 ACCTCTGTTAGAATATTTTTGGG - Intergenic
997745418 5:136295671-136295693 ATCTCTGTTAGGGTAATCTAGGG + Intronic
999878927 5:155839784-155839806 AAGTCTATTGGAATAGTCTGTGG - Intergenic
1001764500 5:174234738-174234760 AACACTGATAGAATCTTCTGAGG + Intronic
1002693129 5:181064998-181065020 AACTGTGTTTAAATAATCAGTGG + Intergenic
1004215906 6:13703988-13704010 AACTCTGTTAGGATGATGTTTGG - Intronic
1005043836 6:21623106-21623128 AATTCTATTAAAATAATCTAAGG + Intergenic
1007465237 6:42047205-42047227 AACTCTGCTACAATTATCAGAGG + Intronic
1008216099 6:48791507-48791529 AAATCTGTTATAATAAAATGAGG + Intergenic
1009286213 6:61821221-61821243 ACCTCTGTTAGAATCTACTGGGG + Intronic
1010070723 6:71741103-71741125 AAGGCTGATAGAATAATATGTGG + Intergenic
1010180547 6:73081938-73081960 AATTATGTTAGGAAAATCTGAGG - Intronic
1010401393 6:75450346-75450368 AATTATTTTAGAATAATCAGAGG + Intronic
1012637809 6:101568031-101568053 AACTTTGTAAAAATAATCTTGGG + Intronic
1016456272 6:144234314-144234336 CAGTATGTTAGAATCATCTGGGG + Intergenic
1016933457 6:149430893-149430915 AACTCTGTAAGGATGATCTGTGG - Intergenic
1017619217 6:156278095-156278117 AACTATGTTTGTATAATGTGAGG + Intergenic
1017857305 6:158361315-158361337 TGCTCTATTAGAATAATCAGTGG - Intronic
1017975103 6:159350226-159350248 AATGCTGTTAGCATGATCTGAGG + Intergenic
1020314319 7:6894150-6894172 AACCCTGTTAGAAAAATAAGAGG + Intergenic
1020510552 7:9051202-9051224 AAAGATGTTAGAATTATCTGAGG - Intergenic
1022004237 7:26252522-26252544 AACACTTTTAGAATAAATTGAGG - Intergenic
1022340893 7:29467282-29467304 TACTCTGTTAAAATCATCTTAGG - Intronic
1023265034 7:38395588-38395610 GACTATGTTAGAAGAATCTCAGG + Intronic
1025321947 7:58104129-58104151 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025475089 7:60909456-60909478 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025487809 7:61073533-61073555 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025511911 7:61580438-61580460 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025556469 7:62315510-62315532 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025563460 7:62400791-62400813 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025868982 7:65413392-65413414 AATTCTGTGACAATAAACTGGGG + Intergenic
1026736595 7:72952938-72952960 ACATCTGTTAGATTAAACTGGGG + Intergenic
1027107139 7:75412125-75412147 ACATCTGTTAGATTAAACTGGGG - Intergenic
1027721739 7:81751253-81751275 AACTCTGTTAGAAAATTGTTAGG - Intronic
1030025815 7:105323772-105323794 AACACTGTAAGAATAATTTGAGG + Intronic
1030158363 7:106480858-106480880 AACTCTGCTAGACTAAAGTGTGG - Intergenic
1034007262 7:147486996-147487018 AAATCTGTTTGTATAATCGGAGG - Intronic
1037076460 8:14725817-14725839 GACTTTATTAGAATAATGTGTGG + Intronic
1037343157 8:17869527-17869549 AACCCTTTAAGAATAATTTGAGG + Intronic
1038081025 8:24136282-24136304 AAGTCTATTAGAAAAATATGGGG + Intergenic
1038953840 8:32446067-32446089 AAAGCTGTTAAAATAAACTGAGG - Intronic
1040117792 8:43644456-43644478 AACTCTTTTTGTAGAATCTGAGG + Intergenic
1040321859 8:46314826-46314848 CACTCTTTTTGAAGAATCTGTGG - Intergenic
1040347043 8:46514327-46514349 AACTATTTTTGTATAATCTGTGG + Intergenic
1041476384 8:58272003-58272025 CACTCTGTGAGACTACTCTGAGG - Intergenic
1041607655 8:59802138-59802160 ATGTCTATAAGAATAATCTGAGG - Intergenic
1042993906 8:74672115-74672137 AACTGTTTTATAATAATATGTGG - Intronic
1044781757 8:95750648-95750670 CACTCTGTTCCAATCATCTGTGG + Intergenic
1046680118 8:117159435-117159457 AAGGCTGTTAGAATGACCTGAGG - Intronic
1047434045 8:124820072-124820094 AAGTCTGTTAGATGAATATGTGG + Intergenic
1049993513 9:1012207-1012229 AACTCAGTTAGAAAAGTCTGTGG - Intergenic
1051130481 9:13854540-13854562 AAGTCTGTTATTATAGTCTGTGG + Intergenic
1051181592 9:14417673-14417695 ACCTCTGTCAAAATCATCTGGGG + Intergenic
1052427662 9:28325881-28325903 AACTCTGTTTAAATAAAATGTGG - Intronic
1053261009 9:36664352-36664374 AACTCTATGGGAATTATCTGAGG + Intronic
1053307028 9:36991987-36992009 CCCTGTGTTAGAATAAACTGTGG - Intronic
1053946676 9:43316525-43316547 GAATCTTTTAGAATAATCTAAGG - Intergenic
1058925568 9:109660141-109660163 AACTCTTTCAGAAAAATGTGTGG + Intronic
1203589806 Un_KI270747v1:45083-45105 GAATCTTTTAGAATAATCTAAGG - Intergenic
1187355112 X:18561556-18561578 AACTGTTTTAAATTAATCTGAGG - Intronic
1188699404 X:33239360-33239382 AACTGTGTCTAAATAATCTGGGG - Intronic
1190790066 X:53690670-53690692 AACTCTATTCGAATAATTTGTGG - Intergenic
1195539782 X:106049871-106049893 AAGTCTATTGGAATATTCTGTGG - Intergenic
1196492372 X:116283091-116283113 AACTCAGTTGGAATAATTAGAGG + Intergenic
1196639455 X:118041162-118041184 CACTGTGTTATAATATTCTGTGG - Intronic
1197418278 X:126204102-126204124 AACTCTGTAATAATAAAATGAGG + Intergenic
1201231623 Y:11870509-11870531 AAGTTTGTTAGATTAAACTGGGG - Intergenic