ID: 1102116005

View in Genome Browser
Species Human (GRCh38)
Location 12:110403464-110403486
Sequence CGGCGGCGGTCTGGGAGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102116005_1102116020 20 Left 1102116005 12:110403464-110403486 CCCCCGCTCCCAGACCGCCGCCG 0: 1
1: 0
2: 1
3: 31
4: 312
Right 1102116020 12:110403507-110403529 AGCTACCCGCCTCAACTCACGGG 0: 1
1: 0
2: 0
3: 40
4: 359
1102116005_1102116019 19 Left 1102116005 12:110403464-110403486 CCCCCGCTCCCAGACCGCCGCCG 0: 1
1: 0
2: 1
3: 31
4: 312
Right 1102116019 12:110403506-110403528 CAGCTACCCGCCTCAACTCACGG 0: 1
1: 0
2: 1
3: 2
4: 115
1102116005_1102116013 -4 Left 1102116005 12:110403464-110403486 CCCCCGCTCCCAGACCGCCGCCG 0: 1
1: 0
2: 1
3: 31
4: 312
Right 1102116013 12:110403483-110403505 GCCGCTTTCTCCTCAGCCCCAGG 0: 1
1: 0
2: 1
3: 40
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102116005 Original CRISPR CGGCGGCGGTCTGGGAGCGG GGG (reversed) Intronic
900003580 1:29388-29410 CGCGGGCGGACTGGGGGCGGCGG - Intergenic
900019989 1:181566-181588 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
900100678 1:960807-960829 GGGCGGGGGTCGGGGCGCGGGGG + Intronic
900109474 1:999491-999513 CGGCGGCGGCTTGGAGGCGGGGG - Intronic
900163747 1:1236582-1236604 CGGCCCCGCTCTGGGTGCGGAGG - Intergenic
900291230 1:1924380-1924402 CGGAGGTGGTCGGTGAGCGGGGG - Exonic
900414735 1:2529763-2529785 CGGCGGCGGTGAGCGGGCGGCGG + Intronic
900502332 1:3012599-3012621 AGGCGGCGGGGTGGGGGCGGTGG - Intergenic
900645252 1:3706111-3706133 CGGAGGCGGGCCGGGGGCGGGGG - Intronic
901109908 1:6785805-6785827 CGGGGGCGGGCTGGGGCCGGAGG + Intronic
901443561 1:9293360-9293382 CGGCGGGGGTCTCGGGGCGCGGG + Intronic
901630285 1:10644665-10644687 GGGCGGCTGTCTGGGGGTGGAGG + Intronic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
903251089 1:22053255-22053277 CGGCGGGGGTGGGGGGGCGGGGG + Intronic
903446419 1:23425021-23425043 AGGCGGCGGTCGCGGCGCGGAGG + Intergenic
903986966 1:27235144-27235166 CGGGGGCGGGGTGGGGGCGGAGG + Intronic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904779760 1:32936922-32936944 AGGCTGCAGTATGGGAGCGGGGG + Exonic
905153100 1:35948462-35948484 CGGCGGTGGGGTGGGGGCGGGGG - Intronic
905449009 1:38045442-38045464 CGGGGGCGGTGGGGGCGCGGAGG + Exonic
905789837 1:40784068-40784090 CGGCGCCGGGCTGGGGGCGCCGG - Exonic
906214261 1:44030157-44030179 CGCGGTCGGTCTGGGAGCAGCGG + Intronic
910827789 1:91428066-91428088 CGGCGGAGGGGTGGGGGCGGTGG - Intergenic
911144737 1:94541588-94541610 CGACGGCGGTCTCGGGGCGCGGG + Exonic
912576202 1:110674754-110674776 CGGTGGCGGGCTGAGGGCGGCGG + Exonic
913565606 1:120069585-120069607 AGGCGGCGGCCGAGGAGCGGCGG - Exonic
913632524 1:120723968-120723990 AGGCGGCGGCCGAGGAGCGGCGG + Intergenic
914286202 1:146228959-146228981 AGGCGGCGGCCGAGGAGCGGCGG - Exonic
914547231 1:148679704-148679726 AGGCGGCGGCCGAGGAGCGGCGG - Intronic
914619273 1:149390642-149390664 AGGCGGCGGCCGAGGAGCGGCGG + Intergenic
915322012 1:155061440-155061462 CGGCAGCGGCCTGGAAGGGGGGG - Exonic
915388446 1:155518681-155518703 CGGGGGCGGTGGGGGGGCGGTGG + Intronic
915519918 1:156436173-156436195 CGGCGGCGGGCAGCGCGCGGAGG - Intergenic
916890253 1:169106606-169106628 CGGCGGCGGGGCGGGGGCGGAGG - Exonic
919990037 1:202703266-202703288 CGGCGGAGGGAGGGGAGCGGTGG - Intronic
921414478 1:214870555-214870577 CGGCTGCGGTCGGGCGGCGGCGG + Intergenic
921472667 1:215567559-215567581 CGGCGGCGGCCGGAGGGCGGGGG - Exonic
921923245 1:220690833-220690855 CGGCGAGGGAATGGGAGCGGGGG - Intronic
922757658 1:228105497-228105519 GGGTGGCGGTCAGGGAGTGGAGG + Intergenic
923412605 1:233725138-233725160 CTGCTGCAGGCTGGGAGCGGTGG + Intergenic
923745193 1:236693590-236693612 CGGCCGTGGTGTGGGAGAGGAGG - Intronic
924436846 1:244049351-244049373 GGGCGGCGGGCTGGGGGAGGGGG + Intronic
1063373864 10:5540144-5540166 CGGGGGAGGCCTGGGAGCTGAGG - Intergenic
1065020068 10:21496123-21496145 CGGTCGGGGTCGGGGAGCGGAGG - Intronic
1065822462 10:29538593-29538615 TGGTGGCGATCTGGGAGCGGCGG - Intronic
1066464562 10:35640935-35640957 GCGCGGCGGGCTGGGCGCGGCGG + Exonic
1071571826 10:86701356-86701378 AGGCTGGGGTCTGGGAGCAGGGG - Intronic
1073297476 10:102450015-102450037 AGGCGGGGGTAGGGGAGCGGTGG + Exonic
1074498637 10:114002341-114002363 CAGCAGCTGTCTGGGAGGGGAGG + Intergenic
1075430236 10:122374535-122374557 CGGCGGCGGCCTCGGCGCGCCGG - Intergenic
1076735856 10:132458643-132458665 CGGCAGCGGGCTGGGCGCTGCGG - Intergenic
1076874599 10:133209860-133209882 CGGCCACGGTCAGGAAGCGGAGG - Intronic
1077065543 11:639577-639599 GGGCGGCGGGCGGGGCGCGGGGG - Intronic
1077264313 11:1641609-1641631 TGGAGGTGGTCTGGGAGTGGAGG - Intergenic
1077976490 11:7252679-7252701 CCGCGGCGGCCTCGGAGCCGTGG + Intronic
1079076657 11:17388930-17388952 CGGGGGCGCTCCGGGAGGGGTGG - Intronic
1080503731 11:32893044-32893066 CGGGGGCGGGCAGGGAGAGGGGG - Intergenic
1081773751 11:45664686-45664708 TCGCAGCGGTCTGGGTGCGGAGG + Intronic
1081805046 11:45885835-45885857 AAGCGGCGGCCTGGGAGGGGGGG + Exonic
1083303271 11:61749835-61749857 CGGGGGCGGTGAGGGAGCTGCGG + Intergenic
1083618029 11:64035988-64036010 CGGTGGCGGGCCCGGAGCGGGGG - Intronic
1083623723 11:64061329-64061351 AGGCTGCGGGCTGGGGGCGGAGG - Intronic
1083679594 11:64344997-64345019 CAGCAGCGGGCCGGGAGCGGAGG + Exonic
1083747622 11:64744603-64744625 CGGCCCGGGTCTGGGAGAGGGGG - Intronic
1083753866 11:64778567-64778589 CGGGGGCGGGCCGGGGGCGGCGG + Intronic
1084295901 11:68213367-68213389 CGGCGGCCGGTTGGGGGCGGGGG - Exonic
1084702904 11:70799108-70799130 CAGCAGAGGTCTGGGCGCGGTGG + Intronic
1085284637 11:75351749-75351771 GGGCGGCGGGCGGGGACCGGGGG - Intergenic
1086064805 11:82733366-82733388 CGGCGGCGCTCGGGGAGGGCGGG + Exonic
1090635507 11:128688280-128688302 AGACGGCAGTCTGGGAGCTGTGG + Intronic
1091373369 12:11180-11202 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1091460812 12:642661-642683 GGGGGGCGGGCTGGGAGTGGGGG + Intronic
1091567899 12:1661872-1661894 CGGCGGGGGGCGGGGGGCGGGGG + Intergenic
1091597078 12:1885376-1885398 GGGCTGTGGTCTGGGAGCCGAGG - Intronic
1095206159 12:39442889-39442911 CGGCGGCGGGCGGCGGGCGGCGG - Intronic
1096101481 12:48972712-48972734 GGGCTGCGGTCTGGCAGGGGCGG - Intergenic
1096627341 12:52903875-52903897 CGGGGGCGGTGTGGGTGGGGTGG - Intronic
1098312108 12:69158762-69158784 GGGCGGCGGGGTGGGGGCGGCGG - Intergenic
1100565636 12:95790940-95790962 GGGCGTCGGTCGGGGCGCGGGGG - Intronic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1102362641 12:112301467-112301489 AGGCGGAGGTCTGGGTGCAGTGG - Intronic
1103085798 12:118061131-118061153 CGGCGGCGGCCTGGCCGGGGCGG - Intronic
1106517082 13:30465181-30465203 CGGCGGCGGCCGGGCGGCGGGGG - Intronic
1106517155 13:30465372-30465394 CGGCGGCGGGAGGGCAGCGGCGG - Intronic
1106597855 13:31161864-31161886 CGGCGCCGGTGTGCGAGCCGCGG - Exonic
1108206454 13:48095015-48095037 GGGAGGCGGTTTGGGAGTGGCGG - Exonic
1108221012 13:48233311-48233333 CGGCGGCGGGCTCGGGGCGCGGG - Exonic
1109667017 13:65553057-65553079 CGGGGGGGGTGGGGGAGCGGTGG + Intergenic
1110199156 13:72828429-72828451 CGGCGCCTGTCGGGGAGTGGGGG - Intronic
1112091865 13:96091044-96091066 CGCCGGAGGAGTGGGAGCGGCGG + Exonic
1112570457 13:100588805-100588827 CGGGGGCGGCCTGGGAGCAGAGG - Intronic
1114473946 14:22981519-22981541 CGGGGCCGGAGTGGGAGCGGCGG - Exonic
1115851699 14:37594826-37594848 CGGGGGAGGCCGGGGAGCGGTGG - Intronic
1115985814 14:39102994-39103016 CGGGGGCGGGCTGGCGGCGGCGG - Intronic
1118186676 14:63543731-63543753 CGGCGGTCGTCTTGGACCGGAGG + Intergenic
1118992558 14:70809478-70809500 CGGCGGCCGGCTGGCAGCGGCGG - Exonic
1122543374 14:102509719-102509741 CGGCGGCGGGCGGCGGGCGGCGG + Exonic
1122959608 14:105088348-105088370 GGGCGGAGGGCTGGGGGCGGGGG + Intergenic
1124392189 15:29269480-29269502 CGGGGGCGGCCTGGGCCCGGCGG + Exonic
1125509135 15:40283346-40283368 CGGCGGCGGTTGCGGGGCGGGGG + Intronic
1126392772 15:48177862-48177884 CGCCTGTGGTCTGGGAGCCGGGG - Intronic
1127415142 15:58749972-58749994 CGCCGGCGGACAGGAAGCGGCGG - Exonic
1127439024 15:58987725-58987747 CGGCGGCTGTAGGGGAGCAGCGG + Intronic
1128245070 15:66127481-66127503 AGGCGGGGGACTCGGAGCGGGGG - Intronic
1129189136 15:73927407-73927429 GGGCGGCGGCGTGGGCGCGGGGG + Exonic
1132453668 16:10731-10753 CGGCGCCGGCCTGGGGGCGGGGG + Intergenic
1132499979 16:280870-280892 CGGCTGGGGTCTGGCAGGGGTGG + Intronic
1132622246 16:873353-873375 CGGCCGGTGGCTGGGAGCGGAGG + Intronic
1132623346 16:878705-878727 CGGCGGTGCTCTGGCAGGGGTGG + Intronic
1132683813 16:1154051-1154073 CGGCGGGGGGCGGGGGGCGGGGG + Intronic
1132764600 16:1527858-1527880 AGGCGGGGGGCTGGGCGCGGTGG - Intronic
1132947191 16:2538146-2538168 CGGCGGCGGACTGGACGCGCCGG + Intronic
1134149866 16:11797172-11797194 CGGCGGCAGGCGGGCAGCGGTGG + Intronic
1135517619 16:23148953-23148975 CGGCGGCGGCGTGGGCGCGGCGG + Exonic
1136111084 16:28063831-28063853 GGGCGGGGGCCTGGGAGTGGAGG + Intergenic
1136188260 16:28600762-28600784 CGGCGGAGGTCGGGGTGCAGCGG + Intergenic
1136190732 16:28613756-28613778 CGGCGGAGGTCGGGGTGCAGCGG + Intronic
1136913022 16:34159630-34159652 CGGAGGCGGTGGGGGAGCCGCGG + Intergenic
1137236327 16:46621317-46621339 GGGCGGCGGTCTGGAGGCAGCGG - Exonic
1137707877 16:50548193-50548215 CTGCCGCGGTCTGGGGCCGGGGG - Intergenic
1138450732 16:57092421-57092443 CGGGCGCGGGCTGGGAGCGGCGG + Intergenic
1139546628 16:67652858-67652880 CGGCGGCGGCGGGGGAGGGGCGG + Intronic
1139664837 16:68448230-68448252 CGGCGGCTGTCCGGGACCCGCGG + Intronic
1139917832 16:70439117-70439139 CGGCGGCGCTCGGGGAGGGTTGG - Intronic
1141683356 16:85556575-85556597 CGGCGGCGCGATGGGGGCGGCGG - Intergenic
1141830703 16:86508733-86508755 CGGGTGCGGGCTGGGGGCGGTGG - Intergenic
1142018643 16:87766134-87766156 CGGCCCCGGGCTGGGCGCGGTGG + Intergenic
1142336054 16:89490214-89490236 CGCCGCTGGTCTGGGGGCGGTGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1142687443 17:1585870-1585892 GGGCTGCGGGCTGGGAGCCGGGG + Intronic
1142812604 17:2402138-2402160 CGGCGGTGGGCGGGGCGCGGGGG + Intergenic
1143002146 17:3801159-3801181 AGGCGGCTGTGTGGGAGCCGAGG + Exonic
1143140524 17:4739662-4739684 CGGCGGCGGGCGAGGAGGGGCGG + Exonic
1143529833 17:7496360-7496382 AGGCTCTGGTCTGGGAGCGGGGG + Intronic
1146358787 17:32157802-32157824 GGGCGGCGGGGTGGGAGCGGGGG - Intronic
1147044472 17:37743084-37743106 CGGCGCGGGGCTGGGTGCGGAGG + Intronic
1148060133 17:44830326-44830348 CCGCCGCGGCCCGGGAGCGGGGG + Intronic
1148826415 17:50397435-50397457 CGGAGGCGGTCTCGCATCGGCGG - Exonic
1149993544 17:61395827-61395849 GGGCGGCGGTGGGGGAGTGGGGG - Intergenic
1152197281 17:78925147-78925169 CGGCGGCGGGCTGGGGGCGCGGG + Exonic
1152728802 17:81960181-81960203 GGTCGGGGGTCGGGGAGCGGCGG - Intronic
1152744179 17:82031588-82031610 CGGCGGGGGGCGGGGGGCGGGGG - Intergenic
1153382487 18:4454944-4454966 CGGCGGCGGTCGCGGCGCGCTGG - Intronic
1153997436 18:10454524-10454546 CGGCGGCTGCCCGGGGGCGGTGG + Intergenic
1160635333 19:70995-71017 CGCGGGCGGACTGGGGGCGGCGG - Intergenic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160930583 19:1567986-1568008 CGGCGGCGGCGTGGGGGCGGCGG - Exonic
1160967703 19:1753839-1753861 CGGCGGCGGTGGGGGCGCCGGGG + Exonic
1161607522 19:5223043-5223065 CCGCGGCGGCCTGGGCGAGGAGG - Exonic
1161681182 19:5680636-5680658 GGGCTGCGGTCTCGCAGCGGAGG + Exonic
1161744703 19:6048861-6048883 GGGCGGGGGCCGGGGAGCGGTGG - Intronic
1161772925 19:6241226-6241248 GGGCGGGGGTCTAGGAGCTGTGG - Intronic
1162174291 19:8819648-8819670 GGGCAGAGGACTGGGAGCGGTGG + Intronic
1162445122 19:10718193-10718215 CGGCGGCGGGCGAGGAGCGCAGG + Exonic
1162683768 19:12365361-12365383 CGGCCGCGGGGTGGGAGCTGGGG - Intronic
1162757921 19:12871319-12871341 GGGCTGCGGGCTGGGCGCGGTGG + Intronic
1163644513 19:18480919-18480941 CTGCTGCGGGCTGGGTGCGGTGG - Intronic
1163694573 19:18757422-18757444 CGGCCTCTGTCTGTGAGCGGTGG + Intronic
1164713371 19:30375001-30375023 GGGCGCGGCTCTGGGAGCGGGGG + Intronic
1165065491 19:33225863-33225885 CGGCGGGGGCCCGGGAGGGGCGG + Intergenic
1165596532 19:37014572-37014594 CGGCGGCGGCTTGGGGGAGGAGG - Intronic
1165747582 19:38239268-38239290 CGGTGGCTGGCTGGGCGCGGTGG + Intergenic
1165924867 19:39320759-39320781 CTGCAGCGGCCCGGGAGCGGCGG - Intergenic
1166375221 19:42324052-42324074 CGGCGGCGGCCGGGGAGCTGGGG - Intronic
1166876653 19:45901877-45901899 GCCCGGCGGTCTGGGAGAGGCGG - Intronic
1202683842 1_KI270712v1_random:31291-31313 CGGCGGCGGGGGGGGAGGGGTGG - Intergenic
925393982 2:3519263-3519285 GGGCAGCGGCCTGGGAGCCGCGG - Intronic
925927638 2:8681784-8681806 GGGCGGGGGGCGGGGAGCGGCGG - Intronic
925984825 2:9207011-9207033 CAGCGGCGGTGTCCGAGCGGCGG + Exonic
926302309 2:11613047-11613069 AGGAGGCGTTCTGGGAGTGGAGG + Intronic
926474744 2:13308405-13308427 CGGCGGTGGGCTGGGCGGGGTGG + Intergenic
926718653 2:15942770-15942792 TGGCGGCCGCCTGGGCGCGGAGG - Exonic
927181093 2:20447278-20447300 CGGGGGCGGTGGGGGCGCGGGGG - Exonic
927810660 2:26178791-26178813 CGGTGGTGGTCTTGGAGGGGTGG + Intronic
932231465 2:70087466-70087488 CCTCGGCGGTCTGGGCGGGGCGG - Exonic
932780219 2:74554648-74554670 CGGCGGGGGCCGGGGAGGGGCGG + Exonic
933728178 2:85437973-85437995 GGGCGGGGGGCTGGGGGCGGGGG + Intergenic
933886307 2:86721136-86721158 CCGGGGCCGGCTGGGAGCGGGGG - Intronic
935064631 2:99636922-99636944 GGGCGGCAGCCTGTGAGCGGAGG + Intronic
935196630 2:100820199-100820221 CGGCTGCGGCCCAGGAGCGGCGG + Exonic
936278885 2:111121503-111121525 CGGCGCCGGCCCGGGAGCTGAGG + Intronic
939613017 2:144332543-144332565 CGGCCGCGGGCCGGGAGGGGCGG - Intronic
941384940 2:164841387-164841409 CGCCCGCGGGCTGGGAGCCGGGG - Exonic
941929962 2:170929414-170929436 CGACGGCGGCCGGGGAGCTGCGG + Intronic
941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG + Intronic
941962674 2:171269243-171269265 CGACCTCGGGCTGGGAGCGGTGG + Intergenic
944060112 2:195563232-195563254 CGGGGGAGGTGTGGGGGCGGGGG - Intergenic
944128290 2:196318670-196318692 TGGGGGAGGTCTGGCAGCGGAGG - Exonic
945466042 2:210171398-210171420 CTGCCGCGGTCTGGGAGCAGTGG + Intergenic
946421949 2:219570358-219570380 CGGCGGCGGTCCGGGAGCAGCGG + Exonic
947536131 2:230941416-230941438 CGTCCTGGGTCTGGGAGCGGGGG - Intronic
947800870 2:232928005-232928027 CGGCGGCGGGGCGGGTGCGGGGG + Intronic
1168804451 20:664215-664237 CGGCGGCGGGGCGGGGGCGGCGG - Exonic
1168830989 20:845220-845242 GGGCGGCGGTCGCGGAGGGGTGG - Exonic
1168992006 20:2103035-2103057 CGGCGACGGCCTGAGGGCGGTGG + Exonic
1171810655 20:29742801-29742823 CGGCGGCGGTGTTGGAGCCGCGG - Intergenic
1173741909 20:45407271-45407293 CGGCCGCGGGCTGGCGGCGGAGG - Intronic
1174263973 20:49318395-49318417 CCACGGGGGCCTGGGAGCGGGGG + Intergenic
1174317452 20:49713734-49713756 AGGCGGCGGACGGGGAGCTGCGG - Exonic
1174357828 20:50010113-50010135 CGGCGGCGGCGAGGGGGCGGCGG + Intergenic
1175399663 20:58693129-58693151 CGGCGGCGGCGGGGGTGCGGCGG - Intronic
1175446365 20:59022961-59022983 TGGCGGGGCTCTGGGAGCAGTGG + Intronic
1176128536 20:63486730-63486752 CGGCTGCAGGCTGGGAGCTGGGG + Intergenic
1176550122 21:8217268-8217290 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176569050 21:8400303-8400325 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176576964 21:8444538-8444560 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1177188076 21:17819497-17819519 CGGCGTCGGTGCAGGAGCGGAGG - Intergenic
1178948220 21:36966045-36966067 CTGTGGCGGGCCGGGAGCGGTGG - Intronic
1180342443 22:11629106-11629128 CGGCGGCGGTGGGGAAGCCGCGG + Intergenic
1180781216 22:18520940-18520962 CGGCGCTGGCCTGGGAGTGGTGG - Intergenic
1181238101 22:21460282-21460304 CGGCGCTGGCCTGGGAGTGGTGG - Intergenic
1183441393 22:37825022-37825044 CGGCGGCGGCCGAGGCGCGGCGG + Exonic
1183720180 22:39557888-39557910 GGGCGGCGGGCGGGGGGCGGCGG - Intergenic
1184276552 22:43412166-43412188 CGGAGGCGGGCGGGGCGCGGCGG + Intronic
1184343067 22:43896656-43896678 CGGGGGCGGTCGGGGGGGGGGGG - Intergenic
1203255015 22_KI270733v1_random:133600-133622 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203263071 22_KI270733v1_random:178679-178701 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
950583847 3:13879602-13879624 TGGGTGCGGTGTGGGAGCGGTGG - Intronic
950729928 3:14948073-14948095 CGGCCGCGGGCGGGGAGGGGAGG - Intronic
951611137 3:24494403-24494425 CGGCGGCAGGCTGGGAGCTACGG - Intronic
952301336 3:32106764-32106786 CGGCGGCGGGCTGGAGGCCGGGG + Intronic
953974388 3:47371384-47371406 CGGCGGCGGGGTGGGGGTGGGGG - Intergenic
954702028 3:52455553-52455575 CGGCGGGGGCCGGGGGGCGGTGG + Exonic
955856497 3:63278570-63278592 GGGCGGCTGGCTGGGAGCAGGGG + Intronic
955916530 3:63912822-63912844 TGGCGACGGTCGGGGAGCGCAGG + Exonic
957962794 3:87280487-87280509 CGGGGCCTGTCTGGGAGTGGGGG + Intergenic
958092595 3:88895210-88895232 TGGAGGCTGTCTGGGCGCGGTGG - Intergenic
958977289 3:100682422-100682444 CGTCGGCGGGTTGGGCGCGGTGG - Intronic
961827473 3:129606574-129606596 CGGCGGGGGGCTGGCGGCGGCGG + Exonic
962240255 3:133746103-133746125 CTACGGCGGGCTGGGAGCCGGGG - Exonic
962575573 3:136752294-136752316 CGCCGGGGGTTCGGGAGCGGGGG + Exonic
965571793 3:170181158-170181180 CGGCGTGGGCCTGAGAGCGGCGG - Intronic
966874610 3:184314995-184315017 GGGCGGCGGGCCGGGAGCCGTGG - Intronic
967008684 3:185410182-185410204 AGTCTGCGGTCTGGGAGCTGGGG + Intronic
967165566 3:186776566-186776588 TGGCGGGGGTCTGGGGGTGGAGG + Intergenic
968473160 4:791175-791197 GGGCGGGGGGCGGGGAGCGGGGG + Intronic
968582899 4:1403159-1403181 CGGGGGCGGACCGGGACCGGGGG - Exonic
968674899 4:1871838-1871860 GGGCGGCGGCCTGCGGGCGGCGG + Intronic
968701833 4:2061176-2061198 GGGCGGAGGTCGGGGAGCGGCGG - Intronic
969413385 4:7043554-7043576 GGGCGGCGGGCGGCGAGCGGGGG + Exonic
969912257 4:10457365-10457387 CGCCGGCGGTCTGCGGCCGGCGG - Intronic
971457812 4:26860800-26860822 CGGCGGCGGCGCGGGAGCTGGGG + Intronic
975702025 4:77075789-77075811 CGGCGGGGGCCGGGGAGAGGCGG + Exonic
976226336 4:82798069-82798091 CCGCGGCGGGGTGGGGGCGGGGG + Intronic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
986338908 5:6773961-6773983 CGGGGGCTGTGAGGGAGCGGCGG - Intergenic
986338923 5:6774001-6774023 CGGGGGCTGTGAGGGAGCGGCGG - Intergenic
986338936 5:6774043-6774065 CGGGGGCTGTGAGGGAGCGGCGG - Intergenic
986339033 5:6774298-6774320 CGGGGGGTGTGTGGGAGCGGCGG - Intergenic
987132482 5:14872053-14872075 CGGCGGCGCTGAGGGCGCGGCGG + Intergenic
991676564 5:69094300-69094322 CGGCGGCGGCCTTGGGCCGGTGG + Exonic
992939647 5:81750477-81750499 CGGCGGGGGCCTGGGCGCTGGGG - Intronic
994525440 5:100900867-100900889 CGCCGGCGCTCTGGCAGCAGGGG + Intronic
995525012 5:113043802-113043824 AGCCAGCGGTCTGGGAGCAGAGG - Intronic
996290987 5:121852098-121852120 CGGCTGCGGCCAGGGGGCGGCGG - Exonic
997618332 5:135268510-135268532 CGGATGCTGGCTGGGAGCGGTGG + Intronic
998406235 5:141876287-141876309 CCGCGGTGGCCTGGGTGCGGGGG - Intronic
999264541 5:150257708-150257730 CAGTGACTGTCTGGGAGCGGGGG - Intronic
1002105956 5:176879541-176879563 CGGCGGCGGGGTGGGTGAGGTGG + Intronic
1002196891 5:177506023-177506045 GGGAGGCGGGCTGGGCGCGGTGG - Intronic
1002645297 5:180649697-180649719 CCGCGGCGGGCTGGGAGGGACGG - Intergenic
1005583104 6:27251589-27251611 GGGCGGGGGCCTGGGGGCGGGGG + Intronic
1005648863 6:27867655-27867677 CGGCGGCGGCCAGAGGGCGGTGG - Intergenic
1005875507 6:30007433-30007455 CCGCGGCGGTCCAGGAGCGCAGG - Intergenic
1006043081 6:31271211-31271233 CCGCGGCGGTCCAGGAGCGCAGG + Exonic
1006052674 6:31356305-31356327 CCGCGGCGGTCCAGGAGCGCAGG + Exonic
1006725381 6:36196457-36196479 CGGTGGCGGTGCGGGCGCGGCGG - Intergenic
1007111137 6:39314049-39314071 CGGCGTCGGCCTGGGCGCGGCGG - Intronic
1010187270 6:73158052-73158074 CGGCGGCGTCCTGGAAGAGGAGG - Intronic
1013116729 6:107109160-107109182 GGGGGGCGGTCTGGGCGTGGTGG + Intronic
1013369170 6:109455284-109455306 GCGCGGCGGGCTGGGAACGGAGG - Intronic
1013709988 6:112885930-112885952 GGGGGCCGGTCTGGGGGCGGGGG + Intergenic
1015328546 6:131951205-131951227 TGGCGGCGAGCGGGGAGCGGCGG + Exonic
1015999642 6:139029472-139029494 CGGCGCCGGGCCGGGAGCTGCGG + Intronic
1017738221 6:157381941-157381963 CGGCGGCGGTCGTGGCTCGGCGG + Exonic
1019320558 7:413627-413649 AGGTGTCGGTCCGGGAGCGGTGG - Intergenic
1020101063 7:5394670-5394692 AGGCGGCGGTCTCGGGGCGGTGG - Intronic
1020224902 7:6272426-6272448 CGCCGGCGGCCTGGGGTCGGGGG - Intronic
1020274301 7:6615513-6615535 CGGCGGGGGCCGGGGCGCGGGGG + Intergenic
1021106691 7:16646097-16646119 CGGGGGCGGTCTAGGAGACGGGG + Intergenic
1025069783 7:55887848-55887870 CGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025827947 7:65025799-65025821 AGGTGGAGGGCTGGGAGCGGTGG - Intergenic
1026360541 7:69598403-69598425 CGGCGGTGGGCTGGCCGCGGAGG + Intergenic
1029169163 7:98618379-98618401 GGGCGGAAGTCTGGGGGCGGAGG + Intronic
1029453712 7:100656474-100656496 CGGCGGCGCCGTTGGAGCGGGGG - Intergenic
1031162449 7:118184300-118184322 AGGCCGCGGTCGGGGATCGGTGG + Intronic
1031895934 7:127347848-127347870 CGGCGGCGCTCACGGAGCCGCGG + Intronic
1034469715 7:151248741-151248763 CGGCGGCGGGCGGGCGGCGGCGG - Exonic
1034470455 7:151251889-151251911 GGGCGGCGGCCGGGGAGCTGGGG + Intronic
1035717031 8:1763291-1763313 GGGCGGCGGCATGGGGGCGGTGG - Intronic
1035717077 8:1763409-1763431 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717086 8:1763426-1763448 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717095 8:1763443-1763465 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717104 8:1763460-1763482 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717113 8:1763477-1763499 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717122 8:1763494-1763516 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717131 8:1763511-1763533 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717140 8:1763528-1763550 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717149 8:1763545-1763567 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717158 8:1763562-1763584 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1035717167 8:1763579-1763601 CGGCGGGGGGCGGGGCGCGGCGG - Intronic
1036723649 8:11200751-11200773 GGGCGGCGGGCTGGGCGCCGTGG - Exonic
1037883929 8:22586436-22586458 AGGAGGCGTTCTGGGAGGGGAGG + Intronic
1039322267 8:36445385-36445407 GGGTGTGGGTCTGGGAGCGGTGG + Intergenic
1044591445 8:93917269-93917291 CGTCGGGGGGCTGGGGGCGGGGG + Intronic
1047262377 8:123274418-123274440 CAGCGGCCGTCCGGGGGCGGAGG + Exonic
1049694615 8:143977217-143977239 CGGGCGAGGTCTGGGAGCGGCGG + Exonic
1049762280 8:144336911-144336933 CGGCGGCGGGCGGGGGGCGGGGG + Intergenic
1049788561 8:144462726-144462748 CGGCGGCGGCAGGAGAGCGGCGG - Intronic
1049801131 8:144517974-144517996 CGGCGCCGGGCGGGGAGCGGCGG + Intronic
1049883077 9:11154-11176 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1049973753 9:842664-842686 CATCGCCGGTCTGGGAGCGCCGG + Intronic
1049998375 9:1051714-1051736 CGGCGGCGGGCTGGGCCCGGGGG - Exonic
1053139894 9:35675889-35675911 AGGCGCAGTTCTGGGAGCGGCGG - Exonic
1053560460 9:39188459-39188481 GGGAGGGGGTCTGGGAGTGGTGG - Intronic
1053824563 9:42008701-42008723 GGGAGGGGGTCTGGGAGTGGTGG - Intronic
1054136658 9:61430496-61430518 GGGAGGGGGTCTGGGAGTGGTGG + Intergenic
1054606008 9:67178662-67178684 GGGAGGGGGTCTGGGAGTGGTGG + Intergenic
1055000782 9:71446972-71446994 CGGCGGCGGTAACGGAGCGCGGG - Intergenic
1056643347 9:88388832-88388854 CGGCGGCGGCCGGGGAACTGGGG - Intronic
1056950134 9:91035226-91035248 CAGCGGCTGGCTGGGTGCGGTGG - Intergenic
1057259591 9:93576441-93576463 GGGCGGCGGGCGGGGAGCCGCGG - Exonic
1057758289 9:97853857-97853879 CCGCGGCTGTCGGGGGGCGGGGG - Exonic
1060477919 9:123999598-123999620 CGGCGGCGGGCGGGGTGGGGAGG + Intergenic
1060974309 9:127755380-127755402 GGGCGAGGGGCTGGGAGCGGGGG - Intronic
1061268523 9:129522759-129522781 TGGCTGCTGTCTGGGAGGGGAGG - Intergenic
1061325756 9:129863173-129863195 CAGCGGCGGGCTGGGTGCAGGGG - Exonic
1061519708 9:131110929-131110951 AGGCGGAGGGGTGGGAGCGGGGG + Intronic
1061808620 9:133149686-133149708 CGGCGGATGGCTGGGAGCTGGGG + Intergenic
1061843679 9:133375489-133375511 CGGAGGCGGGCTGGGAGCTCGGG - Intronic
1061846473 9:133391198-133391220 GGGCGGCTGTCTGGGCGGGGGGG - Intronic
1061914101 9:133740096-133740118 CAGCTCCGGTCTGGGAGAGGTGG + Intergenic
1062162475 9:135087843-135087865 CGGCGGCGGGCGGGCGGCGGCGG + Exonic
1062544150 9:137054171-137054193 CGGCGGAAGCTTGGGAGCGGAGG - Intergenic
1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203479236 Un_GL000220v1:160712-160734 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203361294 Un_KI270442v1:220745-220767 CGGCGGCGATGTGGGAGCCGCGG - Intergenic
1189323441 X:40099193-40099215 CGGCGCGGCTCTGGGCGCGGGGG + Intronic
1189726171 X:43969829-43969851 AGGGGGCGGGCTGGGAGCAGTGG + Intronic
1193148921 X:78104798-78104820 CTGCGACGGTCTAGGAGCGTGGG - Intronic
1195344346 X:103934493-103934515 TGGGGCCTGTCTGGGAGCGGGGG - Intronic
1197415266 X:126165972-126165994 CGGCGGCGGCCCGGCGGCGGTGG + Intergenic
1200100712 X:153688154-153688176 CGCCCGCGGTCTGCAAGCGGCGG - Exonic
1200233555 X:154458017-154458039 AGGCGGCGGGCGGGGAGCCGGGG + Intergenic
1200402724 X:156028987-156029009 CGGCGCCGGGCTGGGGGCGGGGG - Intergenic