ID: 1102119627

View in Genome Browser
Species Human (GRCh38)
Location 12:110429993-110430015
Sequence CTGGAGAAGTAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1621
Summary {0: 1, 1: 3, 2: 12, 3: 191, 4: 1414}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102119627_1102119643 29 Left 1102119627 12:110429993-110430015 CCCTCCTCTTCCTACTTCTCCAG 0: 1
1: 3
2: 12
3: 191
4: 1414
Right 1102119643 12:110430045-110430067 CTGGAGTTATGGTGGTTTTCCGG 0: 1
1: 1
2: 4
3: 12
4: 129
1102119627_1102119644 30 Left 1102119627 12:110429993-110430015 CCCTCCTCTTCCTACTTCTCCAG 0: 1
1: 3
2: 12
3: 191
4: 1414
Right 1102119644 12:110430046-110430068 TGGAGTTATGGTGGTTTTCCGGG 0: 1
1: 2
2: 3
3: 19
4: 201
1102119627_1102119634 -2 Left 1102119627 12:110429993-110430015 CCCTCCTCTTCCTACTTCTCCAG 0: 1
1: 3
2: 12
3: 191
4: 1414
Right 1102119634 12:110430014-110430036 AGTTTTTTGGGTCTGCCCCTTGG 0: 4
1: 2
2: 1
3: 8
4: 124
1102119627_1102119640 21 Left 1102119627 12:110429993-110430015 CCCTCCTCTTCCTACTTCTCCAG 0: 1
1: 3
2: 12
3: 191
4: 1414
Right 1102119640 12:110430037-110430059 TTTCCTTCCTGGAGTTATGGTGG 0: 1
1: 4
2: 2
3: 33
4: 402
1102119627_1102119639 18 Left 1102119627 12:110429993-110430015 CCCTCCTCTTCCTACTTCTCCAG 0: 1
1: 3
2: 12
3: 191
4: 1414
Right 1102119639 12:110430034-110430056 TGGTTTCCTTCCTGGAGTTATGG 0: 1
1: 4
2: 4
3: 14
4: 195
1102119627_1102119635 10 Left 1102119627 12:110429993-110430015 CCCTCCTCTTCCTACTTCTCCAG 0: 1
1: 3
2: 12
3: 191
4: 1414
Right 1102119635 12:110430026-110430048 CTGCCCCTTGGTTTCCTTCCTGG 0: 5
1: 1
2: 1
3: 41
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102119627 Original CRISPR CTGGAGAAGTAGGAAGAGGA GGG (reversed) Intergenic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900680125 1:3911992-3912014 CTGGAGACAAAGGAAGAGAAAGG - Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900858262 1:5203709-5203731 CAGGAGCAGGAGGAAGAGGGTGG + Intergenic
900915467 1:5635279-5635301 CTGGAGAAGGAGGAAAAGGGGGG - Intergenic
900921927 1:5678218-5678240 CTTGAGAAGTGGGGTGAGGAAGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901469189 1:9443871-9443893 GAGGAGAAGGAGGGAGAGGAAGG - Intergenic
901567767 1:10132905-10132927 CTGGAGAAGAGTGAACAGGAGGG + Intronic
901685000 1:10938885-10938907 CGGGAGAAGAAGGAAGACAAAGG - Intergenic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902170407 1:14605679-14605701 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902314328 1:15606508-15606530 CTGGAGAATGAGGGAGAGGGAGG - Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
902606811 1:17573591-17573613 CAGGAGGAGGAGGTAGAGGAGGG + Intronic
902798395 1:18814552-18814574 GTGGGGAAGTGGGAAGAGAAAGG - Intergenic
903036547 1:20496684-20496706 CCGGAGCAGGAGGAAGTGGAGGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903705129 1:25280029-25280051 CAGGAGAAGTGGGAGGATGAGGG + Intronic
903817570 1:26075950-26075972 CTGGAGCAGTTGGCAGAGGCAGG + Intergenic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904115790 1:28160834-28160856 CAGCAGAAGTAGGAAGAGCCAGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904271975 1:29356109-29356131 CTGTGGAAGTAGGAAGAGAAGGG - Intergenic
904303484 1:29571465-29571487 CTGGAGCAGTGGGAAGAAAATGG + Intergenic
904424799 1:30416406-30416428 CTGGAGTAGGAGGCAGAGGTGGG - Intergenic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904500428 1:30909601-30909623 TTGGAGAAGTAAGAACAGCATGG - Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904634130 1:31866646-31866668 AAGGTGAAGTAGGAACAGGAAGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904886393 1:33741894-33741916 CTGGCGGAGTAGGAAGAACAAGG - Intronic
904920155 1:34001037-34001059 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
904944489 1:34189424-34189446 CTGGAGGAGAAGGAAGATGGAGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905343567 1:37295797-37295819 CTGGGGAAGTAGTAAGTGGGAGG + Intergenic
905401795 1:37708965-37708987 GAGGAGGAGGAGGAAGAGGAGGG - Exonic
905492138 1:38352986-38353008 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
905687314 1:39917823-39917845 GGGGAGAGTTAGGAAGAGGAAGG + Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906612326 1:47212153-47212175 GGGGAGAGGTAGGAAGAGAAAGG + Intergenic
906795737 1:48695232-48695254 CTGGGGAACTAGGAACTGGAAGG - Intronic
906848263 1:49218451-49218473 CTGGAGAAGTAGTCAGAAAATGG + Intronic
906958597 1:50398881-50398903 CAGGAGGAGGAGGAAGATGAAGG - Intergenic
907640826 1:56188613-56188635 CTGGTGAAGTAGGGAGTGGGTGG + Intergenic
907758395 1:57333492-57333514 GTGGAGAAATAAGAATAGGAAGG - Intronic
908007441 1:59741374-59741396 CTGGAGCGGGAGGAAGTGGAGGG - Intronic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
908353160 1:63306231-63306253 GAGGAGAAGGAGGAAGGGGAAGG + Intergenic
908539958 1:65112869-65112891 ATTGAGAAGTAGGACCAGGATGG + Intergenic
908629684 1:66088762-66088784 TTGGAGATGGGGGAAGAGGAGGG - Intronic
908792699 1:67798576-67798598 GAGGAGAAGGAGGAAGGGGAGGG - Intronic
908878434 1:68703551-68703573 CTTGAGGAATAGGAAGAGGCTGG - Intergenic
909320083 1:74274287-74274309 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
909681092 1:78293188-78293210 GAGGAGAAGGAGGAAAAGGAAGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910181372 1:84486676-84486698 CTGGAGAGGTAAGTAGAGAAAGG + Intronic
910274803 1:85437429-85437451 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
910457881 1:87417343-87417365 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
910478487 1:87633992-87634014 CCGGGGAAGTGAGAAGAGGATGG + Intergenic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910664559 1:89710162-89710184 CTTGGGAAGTAGGCAGAGGGAGG - Intronic
911165948 1:94724337-94724359 CACGAGGAGGAGGAAGAGGAAGG - Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912208511 1:107533929-107533951 GTGGAGAAGTAGGCAGAAAATGG - Intergenic
912250544 1:108007976-108007998 TTGGAGGAGGAGGAAGAGGTAGG + Intergenic
912280917 1:108312472-108312494 AGAGAAAAGTAGGAAGAGGATGG + Intergenic
912410808 1:109479614-109479636 TTGGAGGAGGAGGAAGAGAAAGG - Exonic
912759315 1:112352837-112352859 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
912773756 1:112490270-112490292 CTGGGGGACTTGGAAGAGGAGGG + Intronic
912933677 1:113985019-113985041 CTGGAGGAGGAGGAAAAGGAGGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913320409 1:117584146-117584168 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
913502848 1:119487997-119488019 GTGGAGAAGGAGGAAGAGCAGGG + Intergenic
913564391 1:120057667-120057689 CTGAATAAGTAAGAAGTGGATGG - Intronic
913633737 1:120735897-120735919 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914244619 1:145876442-145876464 CAGGAGGAGAAGGAAGAGAAGGG + Intronic
914284978 1:146217016-146217038 CTGAATAAGTAAGAAGTGGATGG - Intronic
914315148 1:146503820-146503842 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
914499206 1:148229556-148229578 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
914546009 1:148667755-148667777 CTGAATAAGTAAGAAGTGGATGG - Intronic
914620555 1:149402911-149402933 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
915269888 1:154746517-154746539 GAGGAGAAGGAGGAAGAAGATGG - Intronic
915361619 1:155289400-155289422 CAGGAGGAGTAGGAGGAGGCAGG + Exonic
915481764 1:156191338-156191360 CTGGAGATTGAGGGAGAGGATGG - Intergenic
915713646 1:157924725-157924747 CAGGAGTGGTAGGAAGAGCATGG - Intergenic
915838357 1:159196218-159196240 CATGAGAAGTAGGAGAAGGAAGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916676573 1:167068879-167068901 CAGGAGTTGTAGGAAGAGGGTGG - Intronic
916852206 1:168714922-168714944 CTGGATAAGTAGGAAGAATCTGG - Intronic
916944851 1:169716220-169716242 CTGGTGAAGTAAGATGAGGATGG - Intronic
916984974 1:170181469-170181491 CTTGTGAGGTAGGAAGAGGTAGG - Intergenic
917390739 1:174533470-174533492 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917864854 1:179184579-179184601 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
918033254 1:180838307-180838329 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
918056394 1:181025320-181025342 CTGGAGTAGAAGGAAAAGGATGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918626363 1:186660301-186660323 CTGGAGCAGAAGGAAGAGAGAGG + Intergenic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
918999881 1:191816729-191816751 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
920228188 1:204453047-204453069 CTGGAGATGCTGGAAGAGGTGGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921280048 1:213557462-213557484 CTGGAGAGGGAAGAAGAGGCAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921405315 1:214772631-214772653 CTGGAGCAGAAGGAAGAGCGAGG - Intergenic
921458167 1:215396582-215396604 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922576870 1:226666671-226666693 CTGGAGAGATAGGAAGAGCAAGG - Intronic
922741199 1:228015302-228015324 CTGGAGATATTGGAAGAGCAGGG + Intronic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923092992 1:230753697-230753719 CTGGAAAAGTGGGAAGAGGTGGG + Intronic
923152750 1:231248376-231248398 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923474827 1:234322532-234322554 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
923498983 1:234549150-234549172 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
923920679 1:238561133-238561155 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924278676 1:242413721-242413743 ATGGAAAGGTAGGAAGAGGCAGG + Intronic
924291126 1:242537559-242537581 CTGGAGGAGTAGGAGGAGATAGG - Intergenic
924389634 1:243539211-243539233 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
924609237 1:245560094-245560116 CTGGAGAAGGGACAAGAGGAAGG - Intronic
924645228 1:245871495-245871517 CTGGGGAATAAGGAAAAGGAAGG + Intronic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063075381 10:2711340-2711362 CTGGATAAGTAGGTCAAGGAGGG - Intergenic
1063132833 10:3193427-3193449 CTGGGGCAGGAGGCAGAGGAAGG - Intergenic
1063260166 10:4378860-4378882 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1063343127 10:5286990-5287012 GAGGAGAAGGAGGAAGATGAAGG - Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1063900407 10:10726975-10726997 CTGGAGTAGGAGGAAGAGAGAGG + Intergenic
1063905127 10:10773799-10773821 CATGTGAAGAAGGAAGAGGAGGG - Intergenic
1064001894 10:11670630-11670652 CTGGAGAACTAGGATGAAGTGGG - Intergenic
1064040788 10:11961495-11961517 CAGCAGAAGAGGGAAGAGGAGGG + Intronic
1064262718 10:13798939-13798961 CTGGGGAAGAAGGAAGGGAAAGG - Intronic
1064265744 10:13823888-13823910 CTGGAAAAGTAGCAAGTGGCTGG - Intronic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1064672361 10:17729678-17729700 CTGTAGAAGTGGGCATAGGAAGG + Intergenic
1065202792 10:23330913-23330935 CGGAAGAAGTAAGAAAAGGAAGG + Intronic
1065397791 10:25259088-25259110 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1065446302 10:25805113-25805135 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1065865631 10:29912831-29912853 CTGGAGCAGGAGGAAGGGGCTGG - Intergenic
1065966995 10:30778761-30778783 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1066252765 10:33650320-33650342 CTGGAGCAGGAGGAAGTGGGTGG + Intergenic
1066295748 10:34052807-34052829 CGGGAGAAGGAGCAAGAGGGTGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067144892 10:43687832-43687854 GGGCAGAAGTAGGAAGAAGAGGG + Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1067973432 10:50996608-50996630 CTAGAGAAGTTGGATGAGGAAGG - Intronic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068299679 10:55122031-55122053 CTGGAGGAATAGGAAAAAGAAGG + Intronic
1068435735 10:56989022-56989044 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1068435743 10:56989043-56989065 GGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1068636436 10:59353129-59353151 CTGAAGAAGATGGAAGAGGGCGG + Intronic
1068765033 10:60753478-60753500 CTGGAGCAGGAGGCAGTGGAAGG - Intergenic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1069265594 10:66453489-66453511 CATCAGAAGTAGGAAGATGAGGG + Intronic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069948504 10:72003366-72003388 CAGGAAAATTAGGAAGAGGCAGG + Intronic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070164385 10:73886942-73886964 CTGGAGAAGGAAGAGCAGGAAGG - Intergenic
1070326106 10:75390333-75390355 GTGAAGGAGGAGGAAGAGGAGGG - Intergenic
1070393250 10:75989384-75989406 CTGGAGGAGGAGGGAGAGAAGGG + Intronic
1070686832 10:78491191-78491213 CTGGACAGGTGGGAAGAGGAAGG + Intergenic
1070711667 10:78687438-78687460 CTGGAGATGGAGGAAGGGAAAGG + Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070819689 10:79347657-79347679 CCGGAGGAGGAGGAAGAGGACGG - Exonic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071014052 10:80973716-80973738 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1071284124 10:84128661-84128683 CTGGGGTTGTAGAAAGAGGAAGG - Intergenic
1071292994 10:84200900-84200922 CTGGGGACGTTGGAAGAGGGAGG - Intronic
1071474684 10:86015918-86015940 CTGTGGAAGTAGGAAGCTGAGGG + Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071718159 10:88117537-88117559 CTGGGGGAGGAGGAAGAGCACGG + Intergenic
1071805054 10:89109613-89109635 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1072727771 10:97825150-97825172 CTGGTGCAGTAGGAAGAGTGCGG + Intergenic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1072843947 10:98807335-98807357 CTGGATAGGTGGGAAGTGGATGG - Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073562248 10:104506804-104506826 CCGGAAAAGAAGGAAAAGGAGGG - Intergenic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1074910570 10:117904986-117905008 ATGGTGGAGTAGGAAGAGGCTGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075652021 10:124133561-124133583 CTGGTGTAGTGGGAAGGGGAGGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076098924 10:127758193-127758215 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076182785 10:128423467-128423489 CAGGAGAAGTATAAAGACGAAGG + Intergenic
1076372582 10:129964762-129964784 AAGGAGAAGTGGGAAGAGGCAGG + Intergenic
1076495178 10:130892605-130892627 GAGGAGAGGGAGGAAGAGGAGGG - Intergenic
1076588287 10:131565682-131565704 CTGTAGAACTAGGAAAATGAGGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077649394 11:3956386-3956408 CTGGAAAAGTAGGAAGGTTAGGG + Intronic
1077768525 11:5189348-5189370 CTGGAGCAGGAAGAAGAGGCAGG - Intergenic
1077915550 11:6609358-6609380 CTGGAGTACAAGGAAGAGCAGGG + Exonic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1079131066 11:17747299-17747321 CTGGGGATGGAGGAAGAGCAGGG - Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079386667 11:19986181-19986203 CTGGAGATGGAGGATGAGGGTGG + Intronic
1079411146 11:20189183-20189205 CTGGAGCAGATGGAACAGGAAGG - Intergenic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079796167 11:24805799-24805821 ATGGAGAAGTAAGACGAGAAAGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080110094 11:28557051-28557073 ATGCAGAATTGGGAAGAGGAGGG - Intergenic
1080247505 11:30196220-30196242 CCTGAGAGGTAAGAAGAGGAGGG + Intergenic
1080352500 11:31401494-31401516 TGGGAGAGGTAGGCAGAGGAAGG - Intronic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1082762088 11:57136891-57136913 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1082771053 11:57207596-57207618 GTAGAGAAGTAGCAGGAGGAAGG - Intergenic
1082775221 11:57239444-57239466 CAGGAGAAGAACCAAGAGGATGG + Intergenic
1083068043 11:59945938-59945960 CTGGAGCAGGAGGAAGTGGTCGG + Intergenic
1083201340 11:61122884-61122906 CTGGGGAAGGAGGAAGAGTTAGG - Intronic
1083266722 11:61550356-61550378 GTGGAGAAATAGGAAAGGGAAGG + Intronic
1083424539 11:62576245-62576267 CTGGAGGAGGAGGAAGAGTGGGG + Intronic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084665029 11:70571720-70571742 CTGGAGGAGTCGGCAAAGGAGGG + Intronic
1084736114 11:71106806-71106828 CTCAAGAAGAAGGAAGGGGAGGG + Intronic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1085129551 11:74026394-74026416 CTGAGGAGGTTGGAAGAGGATGG + Intronic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085582536 11:77667365-77667387 GAGGAGGAGGAGGAAGAGGAAGG - Exonic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1085959266 11:81440480-81440502 CAGGAGGAGTGGGAAGAGCAGGG - Intergenic
1086057733 11:82666956-82666978 CTCGGGAAGTAGGAAGAAGCTGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086393663 11:86391929-86391951 CTGGAGCAGGAGTAAGAGGGAGG + Intronic
1086651924 11:89302169-89302191 GTGGAGGAGTGGGAGGAGGATGG + Intergenic
1086722514 11:90138277-90138299 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1086998900 11:93392926-93392948 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1087304157 11:96469488-96469510 GTGGAGTAGAAAGAAGAGGAGGG + Intronic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1087825615 11:102761765-102761787 CTGGAGATGTCTGGAGAGGAAGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089390531 11:118098784-118098806 CTGGATAAGTAAGAAGAGGCAGG + Intronic
1089546990 11:119235524-119235546 GAGGAGGAGTAGGAAGAGGAGGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089949069 11:122508660-122508682 CAGCCGACGTAGGAAGAGGATGG + Intergenic
1090364172 11:126192438-126192460 CTGGAGAAGTAGGGTGACAAGGG + Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090839106 11:130473883-130473905 CTGGAGTAGCGGGCAGAGGACGG + Exonic
1091078918 11:132647680-132647702 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091601084 12:1918154-1918176 CGGGAGGAGTGGGCAGAGGATGG + Intronic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091702087 12:2670225-2670247 CTGGAAGTGTAGGAAGGGGAAGG - Intronic
1091842053 12:3628332-3628354 GTGGAGGAGGAGGAAGAAGAAGG + Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092084084 12:5741480-5741502 AAGGAGCGGTAGGAAGAGGAGGG - Intronic
1092530308 12:9338578-9338600 CTGGAGGACAAGGAAGGGGAGGG + Intergenic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1092940383 12:13402319-13402341 CTGGAGAAGGTGGAAGAGAGAGG - Intergenic
1093144599 12:15550358-15550380 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093440332 12:19187725-19187747 TTAGAGAAGTAGGAAAAGAATGG + Intronic
1094088137 12:26616815-26616837 CAGGAGGAGGAGGAAGAGGGAGG - Intronic
1094234393 12:28146899-28146921 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1094400040 12:30052729-30052751 CTGGACAAGTAGTAAGATGATGG + Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095290377 12:40472817-40472839 AGGGAGGAGGAGGAAGAGGAGGG - Intronic
1095329171 12:40937151-40937173 ATGGATGAGTAGGAAGAGGGTGG - Intronic
1095514964 12:42995362-42995384 CTGGAGAAGAATGCAGAGAAGGG + Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095575665 12:43735375-43735397 CTGGACAAGGAGGAAATGGAAGG + Intronic
1095889378 12:47221803-47221825 CTAGAGAAGTGGGAAGTGGCTGG + Intronic
1095903914 12:47357759-47357781 CTGGAGCAGTAGCACGATGAAGG + Intergenic
1096040927 12:48516750-48516772 GAGGAGGAATAGGAAGAGGAGGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096181678 12:49554603-49554625 CTGGTGAAGTGGGCAGAGGCTGG + Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096878268 12:54647092-54647114 CTGGGGCAGGAGGAAGAGAAAGG + Intronic
1097544947 12:60986928-60986950 CTAGAGTAGTAGGAAGAGGAAGG - Intergenic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098580097 12:72089414-72089436 CCGGAGAAGTAAGGAGAGTATGG - Intronic
1098582306 12:72114571-72114593 GTGGAGGAGAAGGAAGAAGAGGG + Intronic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099146393 12:79050306-79050328 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100120217 12:91360875-91360897 CTGGAGAAGTAGGTAGATAATGG - Intergenic
1100176728 12:92039048-92039070 CTGTAGAAGTTGGAAGGGTAAGG - Intronic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1101292095 12:103381223-103381245 CATGAGAAGTAGGAAGGGAAGGG - Intronic
1101447918 12:104751033-104751055 GTGGAGAAGAAGGAAATGGAGGG + Intronic
1101608460 12:106268438-106268460 ATGGAGAAATAGGAACAGAAAGG + Intronic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1101822728 12:108196193-108196215 CGGGAGAAGGAGGAAGAGCGAGG + Exonic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102735689 12:115157322-115157344 CTGGAGATGTAGCAAAAGAAAGG + Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103102099 12:118186673-118186695 TTGAAGAATTAGGAAAAGGAAGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104092699 12:125529081-125529103 CAAAAGAAGAAGGAAGAGGAAGG - Intronic
1104253255 12:127116817-127116839 CTCTAGAAGTCGGAAGAGGCAGG - Intergenic
1104374321 12:128250523-128250545 CAGGACAAGAAGGCAGAGGAAGG + Intergenic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1104769415 12:131351650-131351672 CAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1105269081 13:18854080-18854102 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106232062 13:27828117-27828139 TTGGAGAATTAGGCAGAGGGCGG - Intergenic
1106243038 13:27925301-27925323 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106243051 13:27925350-27925372 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106243105 13:27925544-27925566 GAGGAGGAGGAGGAAGAGGACGG - Exonic
1106273123 13:28173799-28173821 CTGCAGAGGTAGCAATAGGATGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106555085 13:30802659-30802681 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1106577151 13:30985826-30985848 TTGGCGAACTAGGAAGAGAAAGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106736607 13:32593786-32593808 GAGGAGAAGGAGGAAAAGGAAGG + Intronic
1106985779 13:35347666-35347688 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107298425 13:38939752-38939774 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107720196 13:43240360-43240382 CTGGAGAAGTAGGTAGATCATGG + Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108650206 13:52470788-52470810 CTTGAGAAGGAGGGAGAGAAGGG + Intronic
1108753743 13:53475414-53475436 CTGCAGAGCTAGGAAGATGACGG - Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1109279352 13:60338289-60338311 GAGGAGGAGGAGGAAGAGGATGG - Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1110634570 13:77751667-77751689 CTGGAGAAGTATAAAGAGCCTGG + Intronic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1111276599 13:85956100-85956122 GCTGAGAAGTAGGAAAAGGAGGG + Intergenic
1111374091 13:87355156-87355178 CTGGGGGAGTGGGTAGAGGAAGG + Intergenic
1111743505 13:92234780-92234802 CTGGTGCAGGTGGAAGAGGAGGG + Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1113792244 13:113035011-113035033 CGGGAAAAGGAGGAAGAGCATGG + Intronic
1114197986 14:20495714-20495736 AGGGAGAGGAAGGAAGAGGAGGG - Intergenic
1114248217 14:20934412-20934434 CTAGAGAAGTGGGAGGAGAAGGG - Intergenic
1114262365 14:21046933-21046955 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1117089936 14:52239363-52239385 GGGAAGAAGTAGGAAGAAGAGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117463620 14:55971235-55971257 CTGGAGAAGGAAGCAGAGGTTGG - Intergenic
1117480505 14:56139234-56139256 GTGGAGGAGGAGGGAGAGGATGG + Intronic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117838558 14:59832871-59832893 CTGGAGCAGTGAGGAGAGGAGGG - Intronic
1118168955 14:63366374-63366396 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1118388175 14:65274076-65274098 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1118893546 14:69927997-69928019 CTGGGCAAGTAGGGAAAGGAGGG + Intronic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119067367 14:71542508-71542530 GAGGAGGAGGAGGAAGAGGAAGG - Intronic
1119168518 14:72515260-72515282 CTGGAGGAAGAGGAAGGGGAGGG - Intronic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119967819 14:78936518-78936540 CTAGAGGAGCAGGGAGAGGAAGG + Intronic
1120161359 14:81148725-81148747 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1121641566 14:95487909-95487931 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121727933 14:96166512-96166534 GTGGGGAAGGAGGAAGAGAAGGG + Intergenic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1122139102 14:99651697-99651719 CTGGAGAGGTGGGGAGAGGCAGG + Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122476286 14:102011931-102011953 CTCGGGAAGTGGGAAGAGCATGG + Exonic
1122886934 14:104714343-104714365 CTGGAGCAGTTGGAGGAGGGTGG + Exonic
1122927714 14:104915231-104915253 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1202830226 14_GL000009v2_random:19908-19930 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1124162171 15:27282382-27282404 CTGGGGAAATAAGAAGAGCAGGG - Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124403487 15:29372211-29372233 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1124406782 15:29399913-29399935 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124701147 15:31913355-31913377 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1124833044 15:33167871-33167893 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1124957790 15:34370959-34370981 CGGAAGAAGGAAGAAGAGGAGGG - Intergenic
1125086393 15:35735118-35735140 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126817589 15:52469480-52469502 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127400661 15:58582186-58582208 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1127547430 15:60004200-60004222 TGGGAGGAGGAGGAAGAGGAGGG - Exonic
1128035169 15:64518408-64518430 CTGGAGGAGGAGGAATAGAATGG + Intronic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128276021 15:66354631-66354653 CTGGTGAGGTAGTAAGAGGCTGG - Intronic
1128304164 15:66587049-66587071 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304173 15:66587076-66587098 GGGGAGAAGGAGGAAGAGGAAGG - Intronic
1128304189 15:66587127-66587149 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128749812 15:70140800-70140822 CTGGAGAAGAAGGCAGGGCAGGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128939533 15:71777160-71777182 CTGGACCAGTGGGAAGAGAAAGG - Intronic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129603494 15:77013585-77013607 CGGGAGAGGTTGGAAGTGGAAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130166480 15:81465990-81466012 CTAAAAAAGTAGGAAGAAGAGGG - Intergenic
1130245065 15:82239434-82239456 TTGTAGAAATAGGAAGAGGTAGG - Intronic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1131011144 15:89019507-89019529 TGGGTGAAGTAGGAAGGGGAAGG - Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131339528 15:91584158-91584180 GAGGAGGAGAAGGAAGAGGAGGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131901113 15:97088690-97088712 AAGGAGGAGGAGGAAGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133904974 16:10013848-10013870 CTGGATTTCTAGGAAGAGGAAGG - Intronic
1133922574 16:10166803-10166825 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1134034639 16:11020444-11020466 CTGGAGAAGCAGGGAAAGAAAGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134096832 16:11423938-11423960 CTGGAGAGGAAGGCAGAGGGTGG - Intronic
1134102345 16:11461092-11461114 CTGGAGAGGAAGGAGGAGAATGG - Exonic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134403843 16:13938045-13938067 CTGGAGATGAAGGAAGAGACGGG - Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135464354 16:22672422-22672444 CTGGAAAAGCAGGAAGAGTGGGG - Intergenic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136173806 16:28504051-28504073 CTGGAGAGATGGGAAGAGGGTGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137739901 16:50758596-50758618 CTGGGGTGGTATGAAGAGGATGG + Intronic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138130597 16:54476343-54476365 CAGGAGAAGGAGGTAGAGGGTGG + Intergenic
1138157937 16:54722991-54723013 CTGGAGGTGGAGGATGAGGATGG + Intergenic
1138280457 16:55768918-55768940 CTGGTTAAGTAGGCAGAGGCAGG + Intergenic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138890450 16:61137691-61137713 GCTGAGGAGTAGGAAGAGGAGGG - Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139142972 16:64290813-64290835 ATGGAGAAGTGGGAAGAGAGAGG + Intergenic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1139254468 16:65527876-65527898 CTGAAGAAAAATGAAGAGGAAGG + Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139830084 16:69790440-69790462 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139946317 16:70644861-70644883 AGGAGGAAGTAGGAAGAGGAAGG + Intronic
1139946386 16:70645155-70645177 GAAGAGAAGGAGGAAGAGGAAGG + Intronic
1140058480 16:71546489-71546511 CTTGAGAAGGTGGGAGAGGATGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141737823 16:85866653-85866675 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142001725 16:87668151-87668173 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142577826 17:921194-921216 CTGTAGGTGGAGGAAGAGGAAGG - Intronic
1142632061 17:1231498-1231520 CTGGAAAAGTGGGACCAGGACGG - Intergenic
1142637350 17:1266318-1266340 CTTGAGCAGAAGGAAGAGGCAGG + Intergenic
1142755753 17:2015490-2015512 TTGGAGAGGTGGCAAGAGGAGGG + Intronic
1143079363 17:4369922-4369944 CTGGAGTAGAATGAAGAGAAGGG - Intergenic
1143080168 17:4375764-4375786 CTGGAGTAGAAGGAAGAGAAGGG + Intergenic
1143080420 17:4377313-4377335 CTGGAGTAGAAGGAAGAGAAGGG - Intergenic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143391314 17:6560892-6560914 GATGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391583 17:6561840-6561862 GTGGAGGAAGAGGAAGAGGATGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143664048 17:8346070-8346092 CTAGAGGAGGAGGGAGAGGAAGG + Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143755089 17:9061191-9061213 CTGGTGGAGGAGGAAGGGGAGGG + Intronic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1144285754 17:13772344-13772366 GTGGGGAAGTAAGAGGAGGAAGG + Intergenic
1144479567 17:15617680-15617702 CAAGAGAAGTAGCAAGAGAAGGG - Intronic
1144580453 17:16456128-16456150 TAGGAGGAGGAGGAAGAGGAGGG + Intronic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144734530 17:17547646-17547668 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1144918735 17:18746059-18746081 CAAGAGAAGTAGCAAGAGAAGGG + Intronic
1145034287 17:19529569-19529591 TTGGAGATGGAGGAAGAGGGAGG + Intronic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145248138 17:21283352-21283374 CAGGAGACGCAGGAAGAGAATGG + Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145895490 17:28455344-28455366 CTGGAGAACCAGGAAGGTGAGGG - Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1146616276 17:34359644-34359666 GTGGACATATAGGAAGAGGAGGG - Intergenic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147282794 17:39376556-39376578 TTGCAGAAGTAGGAAGTTGAAGG + Intronic
1147330357 17:39695664-39695686 CTGGTGAAGTAGGTAGAGGGAGG + Intronic
1147727185 17:42573310-42573332 GTGGAGGAAGAGGAAGAGGATGG - Exonic
1148017715 17:44534086-44534108 CTGGAGAAGTTGGAATAGGATGG - Intergenic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148448718 17:47759107-47759129 GGGGAGATGGAGGAAGAGGAGGG + Intergenic
1148488097 17:48004153-48004175 GCGGAGAAGGAGGAAGAAGACGG - Intergenic
1148536390 17:48442581-48442603 CTAGAGAAGTTGGAAGGAGAAGG - Intergenic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1148744697 17:49911761-49911783 CTGGAGAGGAGGGAAGAAGAGGG + Intergenic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1148796184 17:50198003-50198025 CTTGAGAAGAAGGAAAAAGATGG + Intronic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1149754343 17:59174954-59174976 CTGGAGTAGTTGGAGGAGGTAGG - Intronic
1150621047 17:66807892-66807914 CTGCAGTAGGAGGGAGAGGAAGG + Exonic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151351383 17:73534080-73534102 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1151507190 17:74537130-74537152 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1151707209 17:75775531-75775553 CTGCAGAATAAGGAAAAGGAAGG - Intergenic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152277624 17:79367345-79367367 GAGGAGGAGTAGGAGGAGGAGGG - Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1153521002 18:5953850-5953872 AGTGAGAAGTGGGAAGAGGAAGG + Intergenic
1153602235 18:6792143-6792165 CTGGAGATGGACGTAGAGGAAGG + Intronic
1153794092 18:8607078-8607100 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154269516 18:12907151-12907173 CTGGAGGGGTGGGAAGAGGGTGG - Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1155317212 18:24583990-24584012 CCGGAGAAAAAGGAAGAGAAAGG - Intergenic
1155545433 18:26909781-26909803 GAGGAGGAGGAGGAAGAGGAGGG + Exonic
1155578661 18:27278035-27278057 CTAGAGAGGTAGGAAGTTGAGGG - Intergenic
1155756249 18:29500349-29500371 GAGGAGAAGGAGGAAAAGGAGGG + Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1156254079 18:35378247-35378269 CTGAGGAATTAGGGAGAGGACGG + Intergenic
1156368509 18:36451604-36451626 CCGGAGGAGAAGGAAGAGGAGGG - Intronic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157239757 18:45998001-45998023 TTGGTGAAGTAGGCAAAGGAGGG + Intronic
1157278439 18:46329323-46329345 CTGGAAAAGGTGGAAGTGGAGGG - Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157315179 18:46580906-46580928 CTGGAGTAGAAGGAATGGGAAGG + Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157520349 18:48341252-48341274 CCGGAGATGTGGGCAGAGGAAGG + Intronic
1157793140 18:50550832-50550854 CAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1157910806 18:51615750-51615772 CTGTAGAGATAGGAAGTGGAGGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158012630 18:52746944-52746966 GTGGAGAAGGAGGAAGTGTAAGG + Intronic
1158667660 18:59447571-59447593 GGGGAGCAGTAGGAAGAGGCTGG + Intronic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1159848281 18:73493294-73493316 GAGGAGGAGAAGGAAGAGGACGG - Intergenic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160393885 18:78558281-78558303 CTGGAGATGTAGGGTGGGGAGGG - Intergenic
1160701824 19:511237-511259 AGGGAGGAGGAGGAAGAGGAAGG - Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160866253 19:1257509-1257531 GAGGAGGAGGAGGAAGAGGAGGG - Exonic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1161027993 19:2045515-2045537 GAGGAGAAGGAGGAAGAAGAGGG - Intronic
1161223826 19:3133107-3133129 CTGGAGAAGTGGGCAGAGCCTGG + Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161502239 19:4622780-4622802 CTGGAGAAGGTGGGAGAGGCTGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161607355 19:5222446-5222468 GTGGAGGAGGAGGAAGAGGGGGG + Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162579968 19:11523155-11523177 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164292773 19:23882245-23882267 CAGGCGGAGTAGGAAAAGGAGGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164845378 19:31427977-31427999 CTGGGGAAGTAGGAAACTGATGG + Intergenic
1165255880 19:34577032-34577054 CTGGGGAAGGAGGGATAGGATGG + Intergenic
1165441731 19:35832058-35832080 CTGGAGGCGTGGGAAGAGGCTGG - Intronic
1165942625 19:39422834-39422856 GAGGAGGAGGAGGAAGAGGAAGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166137859 19:40788055-40788077 CTGGAGAACTATGAATGGGAGGG - Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1166783292 19:45353237-45353259 CTGGAGAAGTACCAGGAGGTGGG - Exonic
1166794395 19:45417599-45417621 CTGGAGAACTGGGTAGAGGTTGG + Intronic
1166894315 19:46014670-46014692 CTGGCGAGGTGGGAGGAGGAGGG + Intronic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1167115934 19:47489080-47489102 CTGGGGCAGGAGGAACAGGATGG + Intronic
1167194115 19:48015240-48015262 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1167556871 19:50202302-50202324 CTGGAGCAGTATGAAGGGGAGGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167969925 19:53182913-53182935 CTGGAAGAAGAGGAAGAGGAAGG - Exonic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168503580 19:56914186-56914208 GCGGAGAAGGAGGAAGAGGAGGG + Intergenic
1202642465 1_KI270706v1_random:107864-107886 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925434969 2:3828955-3828977 TTTGAGAATTAGGAAGCGGAGGG + Intronic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
925696530 2:6585895-6585917 CTGCAGAAGTTTGAAGAGGCAGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
925902075 2:8515905-8515927 GAGGAGCAGGAGGAAGAGGAGGG - Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926133542 2:10320430-10320452 CTGGAGCAGAAGGGAGAGCAGGG - Intronic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926975588 2:18513919-18513941 GTGGAGGAGTAGGAAAAGGTGGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927370934 2:22354539-22354561 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
927446180 2:23163954-23163976 CCTGAGGAGTAGGAAGAGGGGGG - Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927848717 2:26485682-26485704 CGGTAGAAGGTGGAAGAGGAGGG - Intronic
928000664 2:27520472-27520494 GTGAAGAAGTAGGAAGGGGAGGG + Intronic
928005684 2:27559423-27559445 CTAGAGAAAAAGGAAGTGGAGGG - Intronic
928168575 2:28988707-28988729 CTGGAGAATTTGGATGAGAAAGG - Intronic
928192152 2:29181283-29181305 GAGGAGAAGGAGGAAGAGAAGGG + Intronic
928345937 2:30496091-30496113 CTAGAGCAGGAGGAAGAGAAAGG + Intronic
928409367 2:31042656-31042678 GTGGAGAGTAAGGAAGAGGAAGG - Intronic
928416721 2:31098947-31098969 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
928822701 2:35381212-35381234 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
929005639 2:37390408-37390430 CAGAAGGAGTAGGCAGAGGAAGG + Intergenic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929578997 2:43070044-43070066 CTGGAGAAGCTGGGAGAAGAGGG - Intergenic
929606645 2:43239229-43239251 CTGGGGCAGTAGCAAGATGAAGG - Intronic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930105911 2:47639308-47639330 CTGGAGAACTAGGGAGTGGGAGG + Intergenic
930198301 2:48530149-48530171 CAGGAGGCGGAGGAAGAGGAGGG - Intronic
930342635 2:50136009-50136031 CTGGGCAAGTAGGAAAAGTAGGG - Intronic
930344682 2:50165162-50165184 GTGGAGAAGTATGAAGTAGAAGG + Intronic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930664426 2:54088112-54088134 CTGGAAAGGTGAGAAGAGGAGGG + Intronic
930798533 2:55419354-55419376 CTGGAGGAGGAGGAAGGGAAAGG + Exonic
930818536 2:55622473-55622495 CTGGAGAGGTAGGCAGAAGCAGG - Intergenic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
930940799 2:57012494-57012516 CTGGAGCAGGAGGAAGAGTTGGG - Intergenic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
931285707 2:60829911-60829933 CTGGGGAAGTAGGTCAAGGATGG + Intergenic
931517021 2:63055963-63055985 CCGCCAAAGTAGGAAGAGGAGGG - Exonic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
931903659 2:66819925-66819947 GCGGAGGAGGAGGAAGAGGAGGG + Intergenic
932127600 2:69157963-69157985 CTGGAGAAGTGGGGCCAGGATGG - Intronic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932832637 2:75005919-75005941 CTTAAGAGGGAGGAAGAGGACGG + Intergenic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933861966 2:86478479-86478501 CTGGAGCAGGATGAAAAGGAGGG + Intronic
934498305 2:94831304-94831326 CTGTAGAAGAAGGAAGAACATGG - Intergenic
934624925 2:95838537-95838559 CTAGAGAGGTAGGAAGAGAGGGG + Intronic
934757408 2:96833622-96833644 TTAGAGAAGTGGGAACAGGAAGG + Exonic
934828859 2:97494415-97494437 CTAGAGAGGTAGGAAGAGAGGGG + Intronic
934924670 2:98373926-98373948 CTGGAGAAGTGGGATGAAAATGG - Intronic
935230272 2:101090004-101090026 GGGGAGAGGAAGGAAGAGGAGGG + Intronic
935441150 2:103097313-103097335 CTAGCCAAGTAGGAAAAGGATGG - Intergenic
935441554 2:103103919-103103941 ATGGAAAAGGAGGAAGAGAAAGG - Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936113756 2:109685865-109685887 CTGGAGAGTTGGGAAGAGCATGG + Intergenic
936155503 2:110044032-110044054 CTGGAGAGGTGGGAAGAACAGGG + Intergenic
936189183 2:110327402-110327424 CTGGAGAGGTGGGAAGAACAGGG - Intergenic
936371015 2:111902508-111902530 CTGGAGTGGTAGGAACAAGAGGG - Intronic
937245163 2:120487857-120487879 CTGAAGAGGTAAGAAGAGCATGG - Intergenic
937546703 2:123030894-123030916 GAAGAGAAGGAGGAAGAGGAGGG - Intergenic
937573936 2:123396241-123396263 TGGGAGGAGTGGGAAGAGGAGGG - Intergenic
937582987 2:123512037-123512059 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939415294 2:141888326-141888348 CCTGAGAAGTGTGAAGAGGAAGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940084683 2:149845670-149845692 CTGGATAAGTAGTAATAGGTTGG - Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941387849 2:164875069-164875091 CAGGAGGAGGAAGAAGAGGAGGG + Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941577236 2:167248421-167248443 CTGGAGGTGGAGGAAGAGGGAGG - Exonic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
941780717 2:169441591-169441613 CTGGAGAACTAAAAAGATGAAGG + Intergenic
942132534 2:172894598-172894620 CCAGAGAAGTAGGAAAAGAATGG + Intronic
942321755 2:174742149-174742171 CTGGGGAAGGAGGCAGAGGGAGG - Intergenic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943628164 2:190221733-190221755 GAGGAGAAGTAGCAAGACGACGG + Intronic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944095178 2:195958217-195958239 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944495180 2:200300196-200300218 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945221140 2:207485481-207485503 CTGGAAAGGAAGGTAGAGGAAGG + Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945283019 2:208054818-208054840 GAGGAGAAGGAGGTAGAGGAGGG + Intergenic
945342458 2:208673258-208673280 CTGGAGATCTAGGAAGATGGAGG - Intronic
945639758 2:212409239-212409261 ATGGACAAGTAGGTAGAGAAGGG - Intronic
945958216 2:216105933-216105955 GAGGAGCAGGAGGAAGAGGAAGG + Intergenic
946070281 2:217029053-217029075 CTGGAGAGGTAGGCAGGGGCCGG + Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946173527 2:217909148-217909170 CTGGAAAAGAAGGGAGAGGCTGG - Intronic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946705399 2:222453535-222453557 GAGGAGAAGGAGGAAAAGGAGGG - Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946768991 2:223068751-223068773 CTGGGGGTGTGGGAAGAGGAAGG - Intronic
947536289 2:230942280-230942302 CAGGAGAAGGAGGCAGAAGAAGG - Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948155579 2:235778482-235778504 CTGGGGCAGGAGGAAGAGCACGG - Intronic
948182827 2:235996280-235996302 CTGGAGAGGTGGGCAGTGGACGG - Intronic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948483294 2:238263922-238263944 CTGAAGGAGGAAGAAGAGGAAGG + Intronic
948810961 2:240478104-240478126 CTGGAGCGGGAGGAAGGGGAGGG - Intergenic
948814984 2:240505948-240505970 CTGGATATTTAGGAAGGGGAAGG - Intronic
948819189 2:240529962-240529984 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
948883827 2:240873326-240873348 CAGAAGCAGTGGGAAGAGGAAGG + Intronic
949025375 2:241765278-241765300 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025393 2:241765328-241765350 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025411 2:241765378-241765400 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025429 2:241765428-241765450 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025465 2:241765528-241765550 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025483 2:241765578-241765600 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025501 2:241765628-241765650 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025519 2:241765678-241765700 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025537 2:241765728-241765750 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025555 2:241765778-241765800 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025574 2:241765828-241765850 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025592 2:241765878-241765900 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025610 2:241765928-241765950 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025628 2:241765978-241766000 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025646 2:241766028-241766050 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025680 2:241766128-241766150 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025698 2:241766178-241766200 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025716 2:241766228-241766250 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025734 2:241766278-241766300 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025752 2:241766328-241766350 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025771 2:241766378-241766400 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025789 2:241766428-241766450 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025807 2:241766478-241766500 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025825 2:241766528-241766550 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025843 2:241766578-241766600 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025861 2:241766628-241766650 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025879 2:241766678-241766700 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025897 2:241766728-241766750 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025915 2:241766778-241766800 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025933 2:241766828-241766850 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025951 2:241766878-241766900 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025969 2:241766928-241766950 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949025987 2:241766978-241767000 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026005 2:241767028-241767050 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026023 2:241767078-241767100 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026041 2:241767128-241767150 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026059 2:241767178-241767200 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026077 2:241767228-241767250 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026095 2:241767278-241767300 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026113 2:241767328-241767350 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026131 2:241767378-241767400 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026149 2:241767428-241767450 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
949026167 2:241767478-241767500 CTGAGGGAGTAGGAAGAGGGGGG + Intronic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1169672729 20:8121306-8121328 CAGGAGAAAGAGGGAGAGGATGG + Intergenic
1169677083 20:8166413-8166435 CTGGAGAGGTAGGAAGAGGTAGG - Intronic
1169777652 20:9273600-9273622 GTGAAGGAGGAGGAAGAGGAAGG + Intronic
1169840163 20:9926818-9926840 GTGGAGAAGTAAGACAAGGAAGG - Intergenic
1169933195 20:10856091-10856113 CTGGACAAGTAGTCAGTGGAAGG + Intergenic
1170404008 20:16017569-16017591 GTGGAGAAGGAGGGAGAGAAAGG - Intronic
1170466575 20:16627842-16627864 CTGGAGAAGGAGCAAGAGAGAGG + Intergenic
1170682260 20:18536964-18536986 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1170761206 20:19253151-19253173 CTATAGGAGTAGGTAGAGGAGGG + Intronic
1170912731 20:20590882-20590904 CTGGAGTAGAAGGAAGACGGAGG - Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1171889568 20:30698047-30698069 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172787016 20:37475154-37475176 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1172861898 20:38060790-38060812 CTCGAGGACTAGGAAGAGGTGGG - Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173285848 20:41670905-41670927 CTGGAGTGGTAAGGAGAGGAGGG - Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173891504 20:46514918-46514940 CAGGAGAAGTAGGAAGTGAGAGG + Intergenic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174101074 20:48126596-48126618 CTGGAGACGCAGGGAGAAGATGG - Intergenic
1174397524 20:50257009-50257031 CTGGAGGAGGTGGAAGAGGCTGG - Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175371179 20:58494139-58494161 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1175814496 20:61876459-61876481 CCGGAGAACTGGGAAGGGGAAGG + Intronic
1176037868 20:63049159-63049181 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1176062013 20:63176589-63176611 CTGGAGAGGGTGGAAAAGGAAGG + Intergenic
1176415340 21:6471480-6471502 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1176609413 21:8864746-8864768 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1176854359 21:13953375-13953397 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1176982830 21:15403046-15403068 CTTGAGTAGCAGGAAGATGAAGG + Intergenic
1177258731 21:18700665-18700687 CTGGAGCAGGAGGAAGTGCAGGG - Intergenic
1177470301 21:21552658-21552680 CTGGAGAAGGAGGAAGAGAGTGG - Intergenic
1177608599 21:23415971-23415993 CTGGAGAGGAAGGAATAGGAAGG + Intergenic
1177758314 21:25373705-25373727 GAGGGGGAGTAGGAAGAGGATGG - Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179391505 21:40996434-40996456 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179550259 21:42139336-42139358 CTGGAGCAGGAGGAAGGGGTTGG + Intronic
1179588924 21:42392359-42392381 CAGGAGATGGAGGAAGAGCAGGG + Intronic
1179690840 21:43079813-43079835 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1179986215 21:44921595-44921617 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1180210987 21:46295479-46295501 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180359507 22:11874592-11874614 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1181426916 22:22849709-22849731 TTGGAGGAGGAGGAAGATGATGG + Intronic
1181462632 22:23094573-23094595 CTGCAGAAGGAGGTAGAGGGGGG - Intronic
1181608789 22:23998996-23999018 CTGGAGAAGTGGGAAGTGCCTGG - Intergenic
1181927344 22:26370571-26370593 CTGGAGAAGAAAGAAAGGGATGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182858156 22:33536065-33536087 CTGCAGATGTTGCAAGAGGATGG - Intronic
1182900337 22:33893274-33893296 CTGGGGTGGTGGGAAGAGGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182961902 22:34483292-34483314 CTGGAGAGGTAAGCAGAGGCTGG + Intergenic
1183096889 22:35557630-35557652 CTGGAGACTTGGGAAGAGAAGGG + Intergenic
1183237014 22:36626462-36626484 GGGAAGAAGGAGGAAGAGGAAGG - Intronic
1183279577 22:36924709-36924731 CTGGTCAAGTAGGAAGAAGGCGG - Intronic
1183284036 22:36951596-36951618 CTGGTCAAGTAGGAAGAAGGCGG + Intergenic
1183483811 22:38078707-38078729 GGGGAGGAGGAGGAAGAGGAGGG + Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183680949 22:39328827-39328849 CTGGAGCAGTAGGACAAGCAAGG + Intergenic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184174540 22:42780328-42780350 CTTGAGAAGTAAAAACAGGAAGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949515442 3:4803117-4803139 CTGGAACAGGAGGAAGCGGATGG + Intronic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950221017 3:11196185-11196207 CTGGAGACTTAGGCAGAGGCTGG - Intronic
950387934 3:12674550-12674572 GAGGAGAATTAGTAAGAGGAAGG + Intergenic
950419781 3:12892090-12892112 CTGGAAGAGAAGGAAGAGAAAGG - Intergenic
950430436 3:12947820-12947842 CTGGAGAAGGGGGAAGAGCTTGG - Intronic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950610209 3:14121981-14122003 GTGGAGAAGACGGAAGGGGAGGG + Exonic
951185352 3:19706206-19706228 CTAGTTAAGGAGGAAGAGGAAGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952814725 3:37437205-37437227 CTGGAGAAGTAAGACAGGGAAGG + Intergenic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953230260 3:41058362-41058384 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954366440 3:50148757-50148779 CTGGAGTGGGAGGAAGAGGGAGG + Intergenic
954367399 3:50154001-50154023 GAGGAGAAGGAGGAAAAGGAGGG + Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954989999 3:54832428-54832450 CTGCAGAAGAAGGAAAAGAAAGG + Intronic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955491716 3:59489605-59489627 CTGGAGATGTAGGGACAGTACGG + Intergenic
955772087 3:62395229-62395251 CTGGAGAAGTAGGCAAGGGTTGG + Intergenic
955846184 3:63165178-63165200 GAGGAGGAGGAGGAAGAGGAAGG - Intergenic
955855516 3:63268663-63268685 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955959616 3:64326841-64326863 GAGGAGGAGGAGGAAGAGGATGG + Intronic
956397074 3:68837441-68837463 CTGGAGTGGAAGGAAGGGGAGGG - Intronic
956514003 3:70025940-70025962 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
957212082 3:77272393-77272415 CAGGAGCAGGAGGAAGAGAAGGG + Intronic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957265955 3:77966111-77966133 CTGGAGTAGGGGGAAGGGGAAGG + Intergenic
957390329 3:79558194-79558216 GTAGAGAAGTTGGAAGGGGAAGG - Intronic
957501710 3:81066521-81066543 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958196804 3:90251644-90251666 CCGGAGAAATAGGAAGAAGAGGG + Intergenic
958420229 3:93921512-93921534 CGGGAGAAATAGGAAGAAGAGGG + Intronic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
959668434 3:108947346-108947368 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961075987 3:123982429-123982451 CTGGTGGAGGAGGGAGAGGATGG + Intronic
961172695 3:124809442-124809464 CTGGAGAAGCAAGCAGGGGATGG - Intronic
961348391 3:126279940-126279962 GAGGAGGAGGAGGAAGAGGAAGG - Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962189444 3:133295304-133295326 ATGGAGAAGTAAGGAGAGCAAGG + Intronic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
963005488 3:140723105-140723127 GTGAAGAAGTTGGGAGAGGAAGG - Intergenic
963018570 3:140849529-140849551 TTGGAGGAGAAGGTAGAGGAAGG - Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963152651 3:142062037-142062059 GAGAAGGAGTAGGAAGAGGAGGG - Intronic
963546518 3:146666072-146666094 CTGTGGAAGTAAGAAGAAGAGGG - Intergenic
963798933 3:149658142-149658164 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
964066661 3:152587991-152588013 GTGGCAAAGTAGGAAGAGCAAGG - Intergenic
964091446 3:152881018-152881040 TTTGAGAGGTAGGGAGAGGATGG - Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
964847515 3:161059839-161059861 CTGGAGCAGAAGGAAGTGGGTGG - Intronic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965451576 3:168845384-168845406 GAGGAGGAGTAGGAGGAGGATGG - Intergenic
965611400 3:170547625-170547647 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
965924058 3:173956390-173956412 GGGAAGAAGGAGGAAGAGGAAGG - Intronic
966265142 3:178031359-178031381 TTGGAGAGGTAGGATAAGGAAGG - Intergenic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
967154502 3:186680189-186680211 CTGGAGAAGAATGAAGAGTTTGG - Intergenic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
968348007 3:198027507-198027529 CTGGGGGAGGAGGAAGAGGGAGG - Intronic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968689859 4:1984825-1984847 CTGGGGATGTAGGAGGAGGCGGG + Exonic
968817963 4:2831548-2831570 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
968904493 4:3445143-3445165 CTGGAGCAGTGGGAAGAGAGTGG - Intronic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969582405 4:8072867-8072889 CTGGGGAAGTAGGGAGGGGTCGG + Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969996980 4:11323415-11323437 CAGAAGAAGTAGGAAGATGAAGG + Intergenic
970000556 4:11361524-11361546 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970807141 4:20050239-20050261 GAGGAAAAATAGGAAGAGGAGGG - Intergenic
970859939 4:20690743-20690765 CTGCAGAATAAGGAAGAGCATGG - Intergenic
971025233 4:22582833-22582855 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
971129878 4:23796071-23796093 ATGGATATATAGGAAGAGGATGG + Intronic
971345436 4:25807787-25807809 CTGGAGAAGAAGGAACAAAAAGG + Intronic
971357985 4:25912259-25912281 GGGAAGAAGTAGGATGAGGATGG + Intronic
971436592 4:26632530-26632552 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
971571681 4:28220069-28220091 CTAGCAAAGTAGGAACAGGAAGG + Intergenic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
972319425 4:37959447-37959469 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
972789489 4:42357308-42357330 GGGGAGAAGAAGGGAGAGGAGGG + Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973698469 4:53513971-53513993 CTGAAGAAGTAGGAACATGGTGG - Intronic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
974229273 4:59088939-59088961 GGGGAGGAGGAGGAAGAGGAGGG - Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974487003 4:62518318-62518340 CTGGAGAAGTGAGAAGCTGAAGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974686984 4:65243108-65243130 GAGGAGAAGGAGGAAGAAGAAGG + Intergenic
975043827 4:69777538-69777560 ATGGAGAAAGAGGAAGACGATGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975443927 4:74441043-74441065 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
975533553 4:75425443-75425465 ATGGGGAAGTAAGAAAAGGAAGG - Intergenic
975665928 4:76735110-76735132 CTGGAGAAGTAGCCAGACCATGG + Intronic
975803212 4:78084679-78084701 CAGGAAATGTATGAAGAGGACGG - Intronic
975955388 4:79831051-79831073 ATGGAAAATTAGGAAGAGGGAGG + Intergenic
977034170 4:91928299-91928321 CTGGAGCAGGAGGAAGGGGGTGG - Intergenic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
977631814 4:99251420-99251442 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978420423 4:108526819-108526841 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
978804921 4:112789759-112789781 CTAGAGAAGAAGGAAGAATAAGG + Intergenic
978867569 4:113532609-113532631 CTAGAGAAGTTGGAGAAGGATGG - Intronic
979441978 4:120760955-120760977 CTGGAGAAGTGGGCAGGTGAAGG + Intronic
979547175 4:121951604-121951626 CCGGAGGAGGAGGAAGACGAGGG - Exonic
979720575 4:123895293-123895315 CAGCAGAAGAAGGAAGAGCAAGG - Intergenic
979970347 4:127127291-127127313 CTGAGGAAGTAGGGAAAGGAGGG - Intergenic
980018917 4:127684624-127684646 AAGGAGGAGGAGGAAGAGGAAGG - Intronic
980183474 4:129432091-129432113 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
980489319 4:133505391-133505413 ATGGAGAGGAAGGAAGAGCAGGG + Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981056306 4:140365658-140365680 GAGGAGAAGGAGGAAGAGAAGGG - Intronic
981127135 4:141119752-141119774 ATAGAGAAGTAGGAAAAGGGTGG - Intronic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981426661 4:144611332-144611354 CTGGAGCAGGAGGAAGTGGGGGG - Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982080334 4:151783485-151783507 ATGAAGAAGTAGGCAGAGGTGGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982168245 4:152636048-152636070 CTCCAGAAGAAGGAAGAGGCTGG + Intronic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
984019701 4:174470242-174470264 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
984049310 4:174843972-174843994 CTGGAGACCTGGGAACAGGAAGG + Intronic
984156291 4:176199202-176199224 GAGGAGACGGAGGAAGAGGAGGG - Intergenic
984701783 4:182822971-182822993 TTGTGGAAGTAGGAAGAGCAAGG + Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985106887 4:186508928-186508950 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
985142328 4:186854372-186854394 CAGGAGTAGAAGGAACAGGATGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
1202769830 4_GL000008v2_random:193762-193784 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986222093 5:5776922-5776944 CTGGAGAGGGAGGAATAGCAGGG - Intergenic
986285308 5:6354524-6354546 CGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986988091 5:13521873-13521895 CTGTCGAAGTAAGAAAAGGAGGG - Intergenic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987064995 5:14281305-14281327 TTGGAGCAGGAGGAAGAGGGTGG + Intronic
987202267 5:15589406-15589428 CTGGAGAAGGAGGAAGAGAGAGG - Intronic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
987705690 5:21459943-21459965 CTGGAGAGAAAGGAAGAGAAAGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987906020 5:24078303-24078325 GAGGAGGAGTAGGGAGAGGAGGG + Intronic
987968221 5:24905150-24905172 CTTGAGCAGTAGGAAGCTGAGGG - Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989051708 5:37326953-37326975 GCTGAGGAGTAGGAAGAGGAAGG - Intronic
989057579 5:37379754-37379776 CTGGAGAGAGAGGAAGAGAAAGG + Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989193146 5:38690685-38690707 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989255403 5:39361271-39361293 CTGTAGAGGTAGGATGAGGTGGG + Intronic
989325572 5:40189696-40189718 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
989425026 5:41287086-41287108 CTGGAGTAGTCTGATGAGGAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989746391 5:44835133-44835155 CTGGAGGAGTAGGGAAAGGTGGG + Intergenic
990186703 5:53217963-53217985 GAGGAGAAGGGGGAAGAGGAGGG + Intergenic
990363536 5:55046151-55046173 CTACAGAGGTAGGAAGAGGCAGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991961703 5:72051195-72051217 CTAGAGAGGGAGGAAGAGCATGG + Intergenic
992023930 5:72652433-72652455 GTGGAGAAGTGGGACAAGGATGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992363288 5:76064658-76064680 CCGGAGAAGAAGGAAAACGATGG - Intergenic
992381850 5:76245284-76245306 TTGGAGGAAGAGGAAGAGGAAGG + Intronic
992446181 5:76835985-76836007 TTGGAGAAATAGGAATGGGATGG + Intergenic
992763125 5:79969435-79969457 GTGGAAAGGTAGGAAGAGAATGG - Intergenic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993084896 5:83351136-83351158 CCGGAGAAGGAGGAAGCGGGGGG - Intronic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993837754 5:92835602-92835624 ATGGAGAAGGAGGAAAAGCAGGG - Intergenic
993840903 5:92877149-92877171 CTGGGAAAGGAGGAAGAGCATGG - Intergenic
993854819 5:93061080-93061102 ATCAAGAATTAGGAAGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994104086 5:95926230-95926252 GTGGAGGAGTAGGAAGGGGAGGG + Intronic
994209289 5:97070280-97070302 CTGGAGAAAGAGGAAGGGTAAGG - Intergenic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995478886 5:112575847-112575869 GTGGAGAAGTAAGAAGATGCAGG + Intergenic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
996033921 5:118737196-118737218 CTCAAGAAGTAGGGAAAGGAAGG - Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997362207 5:133302318-133302340 CTTGATAAGCAGGAAGAGAAAGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998551422 5:143081263-143081285 ATTTAGAAGTGGGAAGAGGAGGG + Intronic
998610784 5:143685856-143685878 TTAGAGGAGTAGGAGGAGGATGG + Intergenic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999053476 5:148549082-148549104 CTGGAGAAGTCAGGAGAGGCTGG - Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999909560 5:156182914-156182936 CAAGAGCAGGAGGAAGAGGAAGG - Intronic
999993882 5:157073311-157073333 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000193298 5:158934487-158934509 CTGGAGAAAGAGGAAGAAAAAGG - Intronic
1000268468 5:159660051-159660073 CTGGATGAGATGGAAGAGGAGGG + Intergenic
1000694476 5:164363041-164363063 GAGGAGCAGGAGGAAGAGGAGGG - Intergenic
1000847551 5:166300367-166300389 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1000876459 5:166644836-166644858 CTCAAGAACAAGGAAGAGGAAGG - Intergenic
1000915432 5:167075424-167075446 TTGGGAAAGTAGGTAGAGGATGG + Intergenic
1000922367 5:167153454-167153476 CAGGAGGAGAAGGAAGATGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001411883 5:171518065-171518087 CTGGAGGAGTAGCCAGAGGCAGG + Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001778444 5:174346868-174346890 ATAGAGAAGGAGGAAGAGCATGG - Intergenic
1002041984 5:176521241-176521263 CTGGAGAAGACGGGAGAGGAGGG + Intergenic
1002106361 5:176881209-176881231 CTGGAGAAGCTGTGAGAGGAGGG + Exonic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1002719125 5:181247148-181247170 CTGGATGAGAAGGAAGAGGCCGG - Intronic
1002817104 6:691416-691438 GTGGAGGAGGAAGAAGAGGAGGG - Intronic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1002966766 6:1974451-1974473 CTAGAGAAGTAGGCACAGGAGGG + Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003393219 6:5731270-5731292 GAAGAGAAGGAGGAAGAGGAAGG - Intronic
1003406748 6:5832545-5832567 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1003545232 6:7052590-7052612 TGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1003872791 6:10415152-10415174 GAGGAGGAGGAGGAAGAGGAGGG + Exonic
1004306558 6:14506588-14506610 ACGGTGCAGTAGGAAGAGGAAGG + Intergenic
1004357322 6:14941365-14941387 CCAGAGTAGTAGGAAAAGGAGGG - Intergenic
1004523559 6:16384712-16384734 CTGGAGCAGGAGGAAGGGAAAGG - Intronic
1004584006 6:16981950-16981972 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1004648725 6:17588164-17588186 CTGGAAAAGTAGGGAGGGGTTGG - Intergenic
1004719551 6:18255419-18255441 CTGGAAGAATAGGAAGAGGTTGG - Intronic
1005214084 6:23504632-23504654 CTGGAGAAGAAGTAAGTGTACGG - Intergenic
1005495398 6:26383558-26383580 CCCGAGAAGTGGGAAGAGGAAGG + Intronic
1005648973 6:27868901-27868923 CTGGAGAAGTTGGCAGACTATGG + Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1005994135 6:30921566-30921588 CTGCAAAAGTAGGAAGGGGTTGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006371169 6:33644490-33644512 CTGGAGAAGGCAGGAGAGGAAGG - Intronic
1006382072 6:33704782-33704804 CTAGAGAAGTTGGAGCAGGAAGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006590317 6:35150443-35150465 CTGATGAAGTACAAAGAGGAGGG - Intergenic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006805963 6:36789295-36789317 GGGAAGAAGGAGGAAGAGGAAGG + Intronic
1007682528 6:43644533-43644555 CTGGTGAAGATGGAAGAGAATGG + Intergenic
1007687136 6:43673654-43673676 CAGGAGAGGTAGGAAGGGGCTGG - Intronic
1007794081 6:44333506-44333528 CTGCAGAAGACTGAAGAGGAAGG + Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008042466 6:46816563-46816585 GAGGAGAAGGAGGAAGAAGAAGG + Intronic
1008653064 6:53583253-53583275 ATGGAGAAATAGTAAGAGTAAGG - Intronic
1009022602 6:57960930-57960952 CTGGAGAGAGAGGAAGAGAAAGG - Intergenic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011484727 6:87829897-87829919 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1011968526 6:93191745-93191767 GTGGAGAGGAAGGAAGAGAAGGG + Intergenic
1012107203 6:95178122-95178144 GAGGAGGAGGAGGAAGAGGATGG + Intergenic
1012736775 6:102957564-102957586 TTAAAGAAGTAGGAAAAGGACGG - Intergenic
1012939007 6:105398000-105398022 ATGGAGAAATAGGAAAGGGATGG + Intronic
1012981969 6:105840660-105840682 CTGTAGAAGGAGGGAGATGAGGG - Intergenic
1012982620 6:105846251-105846273 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1013059524 6:106619505-106619527 GAGGAGGAGTAGGAAGAAGAAGG - Intronic
1013249563 6:108320783-108320805 CTGGGGTGGTAGGATGAGGAAGG + Intronic
1013545421 6:111152132-111152154 ATGGATAAGTATGAACAGGAAGG - Intronic
1014153705 6:118087624-118087646 TTGGAGAGGTAGGCAGAGGAGGG - Intronic
1014422217 6:121260499-121260521 ATGGAGAGGAAGGAAGAGCAGGG + Intronic
1014730095 6:125022426-125022448 CTGGGGAAGTTGGACTAGGAAGG + Intronic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015376322 6:132514054-132514076 CTTGAGAATTAGGAAGTGGCTGG + Intergenic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015517225 6:134095025-134095047 AATAAGAAGTAGGAAGAGGATGG + Intergenic
1015521885 6:134139899-134139921 GAAGAGAAGGAGGAAGAGGAAGG - Intergenic
1015630888 6:135230822-135230844 CTAGAGGAATGGGAAGAGGATGG - Intergenic
1015699469 6:136019899-136019921 GAGGAGAGGGAGGAAGAGGAAGG + Intronic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016801484 6:148173538-148173560 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1017179759 6:151540332-151540354 GAGGAGGAGGAGGAAGAGGAAGG - Intronic
1017530740 6:155289901-155289923 CTGGAGCAGTAGGAAGAGAGTGG - Intronic
1017551988 6:155518793-155518815 AAGGAGAAGTGGTAAGAGGAAGG - Intergenic
1018038080 6:159898665-159898687 AGGGAGGAGGAGGAAGAGGAAGG - Intergenic
1018414721 6:163591087-163591109 CTGGAGAAGTCGGAATAGAGGGG - Intergenic
1018459393 6:163983414-163983436 CTGGAGAAGTGGGAAAGGGGAGG + Intergenic
1018694331 6:166379731-166379753 CTGATGAAGTAAAAAGAGGAAGG + Intronic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1018945398 6:168344394-168344416 TTGGAGACGGAGGAAGAAGATGG - Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019327636 7:446116-446138 ATGGAGAGGGAGGAAGAAGAGGG + Intergenic
1019810073 7:3158775-3158797 CTGGAGAAAAAGGAAGTCGATGG + Intronic
1019812070 7:3172110-3172132 AGGGAGAAGTGGGGAGAGGAGGG + Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020044813 7:5032909-5032931 ATGCAGAAGTTGGAAGATGAGGG + Intronic
1020048015 7:5057992-5058014 CTGGAGAAAGAGGAAGTGAATGG - Intronic
1020290211 7:6717247-6717269 GTGCAGAAGTTGGAAGATGAGGG + Intergenic
1021201593 7:17733737-17733759 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1021295093 7:18894649-18894671 ATGGAGCAGTAGGTAGAGGGAGG + Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021628876 7:22623914-22623936 CAGCAGAAGTAGGAAGGGGCAGG + Intronic
1021775929 7:24055580-24055602 GTGGAGAAGTACGACCAGGAAGG + Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1022113276 7:27244079-27244101 GTGGAGAAGTGGGACTAGGAAGG - Intronic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022478760 7:30729303-30729325 CTACAGGAGGAGGAAGAGGAGGG + Intronic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022994075 7:35736390-35736412 CTGGAGATGTGGGAAGAGACAGG - Intergenic
1023043312 7:36191382-36191404 CTGGAGAGGTGGGAAGAGGGAGG + Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023491839 7:40751285-40751307 CTGGAGAGGTAGGGAGAGCCTGG + Intronic
1023669580 7:42561568-42561590 CTGGAGATGTAGGGAGAGTAGGG + Intergenic
1023825523 7:44006302-44006324 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1024724773 7:52180130-52180152 CTGGAGCAGTAGGTGGAGGGCGG + Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026089073 7:67285074-67285096 ATGCAGAAGTTGGAAGATGAGGG - Intergenic
1026108008 7:67436359-67436381 CAGGAGAGGTAGGAAGTGGTTGG + Intergenic
1026159053 7:67852801-67852823 CAGGAAAAGAAGGAAGAAGAGGG + Intergenic
1026613240 7:71879548-71879570 CTGGGGAAGTAACAACAGGAGGG - Intronic
1026646541 7:72175665-72175687 ATGGAGAAGTAGGCAGACCAGGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026725178 7:72865276-72865298 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1026747116 7:73022276-73022298 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026747313 7:73023484-73023506 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026750766 7:73050419-73050441 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026750963 7:73051627-73051649 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026754415 7:73078529-73078551 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026754612 7:73079737-73079759 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026758067 7:73106562-73106584 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026758264 7:73107771-73107793 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1026775189 7:73226788-73226810 CTCCAGAAGGAGGAAGAGGCCGG + Intergenic
1026905076 7:74058169-74058191 CAGGAGGAGGAGGAAGAGGGAGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027016046 7:74780159-74780181 CTCCAGAAGGAGGAAGAGGCCGG + Intronic
1027033219 7:74906847-74906869 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1027033416 7:74908069-74908091 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027071983 7:75165778-75165800 CTCCAGAAGGAGGAAGAGGCCGG - Intergenic
1027089141 7:75285715-75285737 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027089338 7:75286922-75286944 CTGGAGGAGTTGGAAGAGGTGGG + Intergenic
1027092784 7:75313643-75313665 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027092981 7:75314850-75314872 CTGGAGGAGTTGGAAGAGGTGGG + Intergenic
1027096427 7:75341610-75341632 ATGCAGAAGTTGGAAGACGAGGG - Intergenic
1027096624 7:75342817-75342839 CTGGAGGAGTTGGAAGAGGTGGG + Intergenic
1027118661 7:75500392-75500414 ATGCAGAAGTTGGAAGATGAGGG - Intergenic
1027273135 7:76535067-76535089 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027322723 7:77024863-77024885 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1027322918 7:77026077-77026099 ATGCAGAAGTTGGAAGACGAGGG + Intergenic
1027326582 7:77054147-77054169 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027595659 7:80170640-80170662 CTGGAGTAGGAGGAAGAGAGAGG + Intronic
1027717740 7:81694328-81694350 CTGGAAATTTAGGCAGAGGAGGG + Intergenic
1027815454 7:82964081-82964103 CTGGAGAAGGGAGAAAAGGAAGG + Intronic
1028232916 7:88327039-88327061 TTAGAAAAGTAAGAAGAGGAAGG - Intergenic
1029283739 7:99452535-99452557 CTGGACAACTTGGGAGAGGAGGG + Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029397535 7:100318567-100318589 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029718826 7:102349620-102349642 ATGCAGAAGTTGGAAGATGAGGG + Intergenic
1029753789 7:102559637-102559659 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1029771738 7:102658724-102658746 ATGCAGAAGTTGGAAGATGAGGG - Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030052011 7:105546322-105546344 CAGGAGGAGTAGGAAGGGAAAGG + Intronic
1030301840 7:107982087-107982109 CTGCAGACCTAGGAAGAAGAGGG - Intronic
1030311130 7:108070496-108070518 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1030769774 7:113459819-113459841 ATGGAGAAGTAGGAAGTAGTGGG - Intergenic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1031146546 7:118003291-118003313 CTGGGGAAGTAAGAAGATCAGGG + Intergenic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031813460 7:126401992-126402014 CTAGAGAAGGATGAAGAAGAGGG - Intergenic
1031854629 7:126907299-126907321 AGGGAGGAGGAGGAAGAGGAAGG + Intronic
1031965770 7:128027288-128027310 CAGGAGAAGGTGGAAGAGAAAGG - Exonic
1032062347 7:128735631-128735653 CTGGAGCAGGAGGAAGGGGCGGG + Intergenic
1032119457 7:129145450-129145472 CTGGCAAAGAAAGAAGAGGAAGG + Intronic
1032128596 7:129211850-129211872 TCGGAGGAGGAGGAAGAGGAAGG + Intronic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1033243993 7:139703579-139703601 CATGAGAATTAGGACGAGGAAGG + Intronic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033755535 7:144396161-144396183 GTTGAGATGTAGGAAGAGGAGGG - Intergenic
1033832641 7:145271817-145271839 GGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1034021631 7:147650457-147650479 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1034111811 7:148544481-148544503 CTGGAGAAATAAGGGGAGGAAGG + Intergenic
1034114834 7:148575544-148575566 ATGGAGAATTAGGGATAGGAAGG + Intergenic
1034183113 7:149153986-149154008 CTGGGGGTGTAGGAAGAGGAAGG - Exonic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034257193 7:149731133-149731155 CTGGAGGACGAGGACGAGGAGGG + Intronic
1034411709 7:150945552-150945574 ATGGAGGAGGAGGAAGGGGAGGG + Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034720758 7:153290146-153290168 GAGGAGGAGTGGGAAGAGGAGGG + Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035811240 8:2493049-2493071 GTGGAGAAGAAGGGAGATGAAGG + Intergenic
1035831115 8:2695304-2695326 CTGAAGAAGAAGGCAGAGGTTGG - Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036158057 8:6360947-6360969 CTGGAAGAGTATGAAGAGGGGGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037046579 8:14312704-14312726 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1037316996 8:17608497-17608519 CTGGGGAAGGAGGCAGAGGGAGG + Intronic
1037541757 8:19878858-19878880 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1037691214 8:21183206-21183228 GGGGAGGAGGAGGAAGAGGAGGG - Intergenic
1038151356 8:24944036-24944058 GGGGAGCAGTAGGCAGAGGAGGG + Intergenic
1038713136 8:29967183-29967205 CTGGAGCAGGAGGAAGAGCTGGG + Intergenic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1039096424 8:33891573-33891595 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039326876 8:36495359-36495381 CTGCAGAAAAAGGAAGATGATGG - Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1039608891 8:38903551-38903573 CTGCAGAAGTGGGAAGGGGAAGG + Intronic
1039769509 8:40669514-40669536 GTGGAGTAGGATGAAGAGGAGGG - Intronic
1040533054 8:48281794-48281816 CAGAAGGAGTAGGAAGAGAATGG + Intergenic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041614954 8:59895631-59895653 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1041746177 8:61211413-61211435 CAGGAGGAGAAGGAAGAGTAGGG - Intronic
1041788285 8:61660288-61660310 GGGGAGAAGTAGGAATGGGATGG + Intronic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042680984 8:71383739-71383761 CTGGAGAAGTAAGGAGAGTAAGG + Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042966677 8:74361086-74361108 GTGGAGAAAAAGGAAGAGAAGGG - Intronic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043003740 8:74792171-74792193 CTGGGGAAGGAGGGAGAGTACGG + Intronic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043224451 8:77706429-77706451 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043358342 8:79440278-79440300 CTGGGGAAGTAGGAAGGGGGTGG + Intergenic
1043499488 8:80838618-80838640 CTGGAGGAGGAGGAAGAGTTAGG + Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043506086 8:80904519-80904541 TGGGAGAAGTGGGAAGAGAAGGG - Intergenic
1044106112 8:88209261-88209283 GTGGAGGAGGAGGAAGAGAAGGG - Intronic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045054087 8:98354373-98354395 CTGGTGAAGGAAGGAGAGGAGGG - Intergenic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1045769790 8:105722703-105722725 GAGGAGAAGGAGGAAGATGAGGG + Intronic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1045865174 8:106857217-106857239 CAGAAGGAGTAGGAAGAGGTGGG - Intergenic
1046296778 8:112229921-112229943 CTAGAGAAATAGGAAGTGCATGG + Intronic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1046789578 8:118306632-118306654 TTGCAGAGGTAGGAAGAGCAGGG - Intronic
1046819523 8:118620807-118620829 GTACTGAAGTAGGAAGAGGAGGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046991281 8:120458455-120458477 CTGCAGAAGTAGTAATAGTAAGG - Intronic
1047299860 8:123604415-123604437 GAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1047503425 8:125460061-125460083 CTGGAGAAATAGCAACAGCAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048049673 8:130805537-130805559 TTGGAGAAGTGGGAATAGGGTGG + Intronic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1048543537 8:135365036-135365058 CTTGAGAATTGGGAAGAGGACGG - Intergenic
1048820565 8:138376562-138376584 CTGGAGAAGTAAGAAGTTGATGG - Intronic
1049121954 8:140747457-140747479 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1049121992 8:140747559-140747581 CGGGAGGAGGAGGAAGGGGAGGG + Intronic
1049310634 8:141931942-141931964 CTGGAGAGGTTGGCAGGGGAGGG - Intergenic
1049655153 8:143793963-143793985 CTGGAGGAGTAGGCAGTGGGTGG + Intronic
1050014129 9:1215449-1215471 CAGGAGGAGGAGGAAAAGGAAGG + Intergenic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1050667692 9:7959776-7959798 TTGGAATTGTAGGAAGAGGAAGG - Intergenic
1050847275 9:10237652-10237674 TTGCAGACCTAGGAAGAGGAGGG - Intronic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1050964848 9:11786628-11786650 CTGGAGAAGTAGAAATAATATGG - Intergenic
1051318093 9:15865506-15865528 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052442040 9:28510499-28510521 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1052820169 9:33132213-33132235 GTTGTGAAGTGGGAAGAGGAGGG + Intronic
1052999216 9:34568302-34568324 CTGGAGAAATAGGTAAAGGGAGG + Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053169123 9:35865981-35866003 TAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1053658852 9:40249227-40249249 CTGTAGAAGAAGGAAGAACATGG + Intronic
1053909221 9:42878499-42878521 CTGTAGAAGAAGGAAGAACATGG + Intergenic
1054359515 9:64100194-64100216 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1054370972 9:64395517-64395539 CTGTAGAAGAAGGAAGAACATGG + Intronic
1054525746 9:66126995-66127017 CTGTAGAAGAAGGAAGAACATGG - Intronic
1054678603 9:67885246-67885268 CTGTAGAAGAAGGAAGAACATGG + Intronic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054870329 9:70043243-70043265 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055238306 9:74151601-74151623 CTAGAGAAGTTGGAGGAGGAGGG + Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056464689 9:86842252-86842274 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1057003461 9:91534191-91534213 CTGGGGAAGAAGGCAGAGTAGGG + Intergenic
1057014060 9:91635022-91635044 GCGGAGGAGGAGGAAGAGGAGGG + Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057226652 9:93296425-93296447 ATGGAGAAGGAGGAAGGTGAGGG - Intronic
1057318801 9:93992644-93992666 CTGGAGGAGAAGGGACAGGAGGG - Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057791849 9:98129896-98129918 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1057896456 9:98912781-98912803 GAGGAGAAGAAGGTAGAGGAGGG + Intergenic
1058182076 9:101810306-101810328 CTGGAGAAGAAGGAAGAGAGAGG - Intergenic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058580196 9:106447534-106447556 GTGGAGAAGGTGGAAGGGGAGGG - Intergenic
1058653026 9:107194888-107194910 CTAGAGGAGTGGGAGGAGGATGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058747056 9:108001946-108001968 CTTGAGAGGTAGAAAGAGCAAGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1059072427 9:111152831-111152853 AGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059458800 9:114416534-114416556 CTGGAGGAGGAGGAAGAGAAGGG - Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059747266 9:117215002-117215024 CTTGTGAAGAAGGAAGAGCAGGG - Intronic
1060301047 9:122374841-122374863 CTCCAGGAGTAGGAGGAGGAGGG + Intronic
1060376378 9:123118268-123118290 CTGAAGGAGTAGGAAGGGAAGGG - Intronic
1060943875 9:127558511-127558533 CTCCAGAACTAGGACGAGGAAGG + Intronic
1061348573 9:130045504-130045526 GAGGAGAAAGAGGAAGAGGAAGG + Intergenic
1061601461 9:131673000-131673022 CTGAAGCAGAAGGAAGAGCAGGG - Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061832028 9:133302303-133302325 CTGGAGAGGTTGGGAGGGGAAGG - Intergenic
1061854809 9:133436264-133436286 TTGGAGAAGGAGGAAAGGGAGGG - Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062450324 9:136612755-136612777 GGGGAGGAGAAGGAAGAGGAGGG - Intergenic
1062456268 9:136640688-136640710 CTGGAGTATTTGGAAGAGCATGG - Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1203694730 Un_GL000214v1:87440-87462 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203559184 Un_KI270744v1:35819-35841 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203641543 Un_KI270751v1:16623-16645 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185688335 X:1948467-1948489 GGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1185688613 X:2133989-2134011 GGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186268008 X:7852456-7852478 CTGGAGGAGGAAGAAGATGAAGG + Intergenic
1186321383 X:8429303-8429325 GAGGAGCAGGAGGAAGAGGAGGG + Intergenic
1186788036 X:12971588-12971610 GAAGAGAAGAAGGAAGAGGAGGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187620089 X:21042959-21042981 GCTGAGGAGTAGGAAGAGGAGGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188660947 X:32757950-32757972 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189364739 X:40379946-40379968 CTGCAGGAGGAGGAAGAGGGAGG - Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189602195 X:42639191-42639213 GAGGAGAAAGAGGAAGAGGAAGG - Intergenic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1190407865 X:50105465-50105487 CTGGTGTAGTAGAAAGAGCATGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1190598051 X:52066147-52066169 CTGGAGAAGGAGGAACATGCGGG + Intronic
1190610773 X:52187926-52187948 CTGGAGAAGGAGGAACATGCGGG - Intronic
1190827011 X:54026898-54026920 GTGTAGAAGTAGGAAGTGGCTGG - Intronic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192980067 X:76330075-76330097 CTGGAGAAGTGGGACCATGATGG + Intergenic
1193216476 X:78870340-78870362 CTTGTGAGGTAGGAAGATGAAGG + Intergenic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194312594 X:92331349-92331371 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1195298559 X:103504177-103504199 CTGGAGGAGTGGGGAGAGGTGGG + Intronic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1195741424 X:108068555-108068577 CTGGAACAGGAGGAAGGGGAGGG + Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1197049807 X:122044902-122044924 CTGGAGAAGGAGGTAGAGAGAGG - Intergenic
1197457601 X:126697206-126697228 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198311813 X:135432493-135432515 GGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198931978 X:141871854-141871876 GTGGAGAAGTAGGAGGGGCAAGG + Intronic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199117251 X:144007724-144007746 CTGGAACAGGAGGAAGAGAAAGG + Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199818891 X:151424732-151424754 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic
1200103674 X:153700935-153700957 ATGGACAAGAAGGAAGAGTAAGG - Exonic
1200231602 X:154446488-154446510 CTGGAGGAGGAAGAAGAGGGAGG + Exonic
1200620857 Y:5445495-5445517 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1200737840 Y:6819380-6819402 GTGGAGAAATAGGAACAGGGAGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1201939708 Y:19446799-19446821 CTAGAGAAATAGGAAAAGGAAGG - Intergenic