ID: 1102126842

View in Genome Browser
Species Human (GRCh38)
Location 12:110489672-110489694
Sequence TCTCTTCTATTGGGGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102126842 Original CRISPR TCTCTTCTATTGGGGACCAC AGG (reversed) Intronic