ID: 1102142617

View in Genome Browser
Species Human (GRCh38)
Location 12:110628022-110628044
Sequence CAGAAGAGAGAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2056
Summary {0: 1, 1: 1, 2: 24, 3: 222, 4: 1808}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102142617_1102142619 0 Left 1102142617 12:110628022-110628044 CCTGCTTCCTTCTCTCTCTTCTG 0: 1
1: 1
2: 24
3: 222
4: 1808
Right 1102142619 12:110628045-110628067 TACACAGCACATTTTACTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 139
1102142617_1102142620 10 Left 1102142617 12:110628022-110628044 CCTGCTTCCTTCTCTCTCTTCTG 0: 1
1: 1
2: 24
3: 222
4: 1808
Right 1102142620 12:110628055-110628077 ATTTTACTCCAGGACTTTCACGG 0: 1
1: 0
2: 1
3: 18
4: 274
1102142617_1102142621 13 Left 1102142617 12:110628022-110628044 CCTGCTTCCTTCTCTCTCTTCTG 0: 1
1: 1
2: 24
3: 222
4: 1808
Right 1102142621 12:110628058-110628080 TTACTCCAGGACTTTCACGGTGG 0: 1
1: 0
2: 0
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102142617 Original CRISPR CAGAAGAGAGAGAAGGAAGC AGG (reversed) Intronic
Too many off-targets to display for this crispr