ID: 1102150470

View in Genome Browser
Species Human (GRCh38)
Location 12:110686371-110686393
Sequence AGTTACATGCTGAGGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102150470 Original CRISPR AGTTACATGCTGAGGGTGCA AGG Intronic
900466886 1:2830103-2830125 AGTTACTTGATGAGTGAGCAGGG - Intergenic
901754582 1:11433872-11433894 AGGTAAGTTCTGAGGGTGCAGGG - Intergenic
903227318 1:21901332-21901354 AGTATCATGCAGAGGGTGCATGG + Intronic
904300009 1:29548164-29548186 GATTACATGCTGAGGGTGGAGGG + Intergenic
906123254 1:43409324-43409346 AGTTATCTGCTGAGGGTAAAGGG + Intronic
910122255 1:83803130-83803152 TGCTACATGCTGAAGATGCATGG + Intergenic
910203740 1:84726304-84726326 AGCCACATGCTGAGGGTGGTAGG + Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
911063787 1:93769897-93769919 AGTTACTTGATGAGGGTGTTGGG + Intronic
912042334 1:105408208-105408230 GGTTACATTCTGAGGTTGTAGGG - Intergenic
916433915 1:164759295-164759317 AGTAACATGCTGTGACTGCAGGG + Intronic
918286474 1:183060143-183060165 AGCTACATGATGAGGGGCCAAGG - Intronic
919664204 1:200276651-200276673 GGTCACCTGCTGGGGGTGCAGGG - Intergenic
919723633 1:200866909-200866931 CCTTAGATGTTGAGGGTGCAGGG + Intergenic
920849099 1:209616548-209616570 AGTTCCATGCTGGGTGAGCAGGG - Exonic
1063380654 10:5583532-5583554 AGGCACATGCTGGTGGTGCATGG + Intergenic
1065011864 10:21428137-21428159 AGTTACATGGGAAGGGAGCATGG + Intergenic
1065225087 10:23535444-23535466 AGTTAAATGCTGGTGGGGCATGG - Intergenic
1065944100 10:30591522-30591544 ACTTTCATTCTGAGGTTGCAAGG + Intergenic
1067547384 10:47203598-47203620 ACTTACATGCTGTTGGTGCAAGG - Intergenic
1072450394 10:95534900-95534922 AGTTATATGCCGAGGGTGTTGGG - Intronic
1074356590 10:112791042-112791064 AGTTACACCCTGATGGTGGAAGG - Intronic
1074940604 10:118232943-118232965 AGTAGCATGGTGAGGGTTCAGGG + Intergenic
1075013408 10:118893578-118893600 ACTAACATGCTAAGGGTGGAGGG + Intergenic
1075526581 10:123192055-123192077 AGTTAAATGCTGAGGGTATAAGG + Intergenic
1077881366 11:6353313-6353335 AGTTAGGTGCTGAGGATACAAGG - Intergenic
1083780157 11:64913580-64913602 AGTTAGATGCTGAGGGTCTGAGG - Intronic
1084447673 11:69213111-69213133 GGTTACATTCTGAGGTTCCAGGG - Intergenic
1085646982 11:78230735-78230757 AGTTACATACTCAGAGGGCAGGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088581185 11:111318383-111318405 ATTTACATGTTCAGTGTGCAGGG - Intergenic
1089605502 11:119638984-119639006 GGTTACAGGCTGAGAGTGCCCGG + Intronic
1090721888 11:129482859-129482881 AGTTACACACTCAGTGTGCATGG + Intergenic
1091091413 11:132774702-132774724 AGGAACATGGTGAGGTTGCAAGG - Intronic
1091291553 11:134443129-134443151 AGTTGAAGGCTGAGGGGGCAAGG - Intergenic
1092047671 12:5443484-5443506 AGTGGCATGCAGAGGTTGCATGG - Intronic
1093219945 12:16408150-16408172 AGCTAAATGATGAGGATGCATGG + Intronic
1094639765 12:32262534-32262556 AGTCACATTCTGAGGGACCAAGG - Intronic
1097193918 12:57233476-57233498 AGAGCTATGCTGAGGGTGCAGGG + Intronic
1100164703 12:91903200-91903222 AGTCACATTCTGAGGGTACTGGG - Intergenic
1102150470 12:110686371-110686393 AGTTACATGCTGAGGGTGCAAGG + Intronic
1103019994 12:117526236-117526258 AGTTAAATGCTCAAGGTGTAGGG + Intronic
1108049156 13:46413093-46413115 AGTTTCATCCCTAGGGTGCAAGG + Intronic
1108632059 13:52294007-52294029 AGTTACATGCAGAGTTTGCAGGG + Intergenic
1108654639 13:52518587-52518609 AGTTACATGCAGAGTTTGCAGGG - Intergenic
1109541675 13:63786366-63786388 AGTTTCATCCCTAGGGTGCAAGG + Intergenic
1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG + Intergenic
1111692660 13:91583945-91583967 AGTCACATTCTGAGGTAGCAGGG - Intronic
1112043924 13:95576196-95576218 AGTTCCTTCCTCAGGGTGCAGGG - Intronic
1114725160 14:24928780-24928802 ATTTATATTCTGAGGGTGCATGG - Intronic
1117194404 14:53325215-53325237 AATTTCATCCTGAGGGTGGAGGG - Intergenic
1117604904 14:57418475-57418497 AGTTACATGGTGGGGGTGGGGGG + Intergenic
1120480285 14:85040885-85040907 AGTTGCATGCTGAGGATGGCAGG - Intergenic
1121201710 14:92122981-92123003 AGTTTCATACTGGGGTTGCAAGG - Intronic
1123468201 15:20531393-20531415 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1123649914 15:22469671-22469693 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1123728517 15:23126603-23126625 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1123740317 15:23278490-23278512 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1123746681 15:23324068-23324090 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1124103626 15:26717497-26717519 AGTAACATGCTGTGGGTTCCAGG + Intronic
1124278949 15:28347384-28347406 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1124303750 15:28564224-28564246 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1124333430 15:28840075-28840097 AGTCACATGTGGAGAGTGCAGGG + Intergenic
1124532643 15:30520701-30520723 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1124766010 15:32486943-32486965 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1125450953 15:39806760-39806782 AGTTCCATGGTGAGGATGCTGGG - Intronic
1126946689 15:53829495-53829517 AGTTACATGCTAAATGTCCATGG + Intergenic
1128796447 15:70469993-70470015 AGCCAGATGCAGAGGGTGCACGG + Intergenic
1129076722 15:73003218-73003240 ATTTCCATTCTGAGAGTGCAGGG - Intergenic
1129243002 15:74262544-74262566 AGATCCAAGCTGAGGATGCAGGG + Exonic
1130892991 15:88149299-88149321 AGCCTCATGCTGGGGGTGCAGGG + Intronic
1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG + Intronic
1135289578 16:21223820-21223842 AGTTACAGGCTGCTGGTGGATGG - Intergenic
1137333735 16:47527664-47527686 AGTCACATTCTGAGGTAGCAGGG - Intronic
1138243162 16:55445410-55445432 AGATGCATGCTGTGGGTGCCAGG + Intronic
1138512836 16:57518552-57518574 AGTGACCTGCTGATGGAGCAGGG + Intronic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1141449245 16:84086383-84086405 AGGAACATGCTGAGGGAGCGTGG + Intronic
1143050788 17:4124019-4124041 AGTTTGATGCTGAGGGTGATGGG - Exonic
1144347115 17:14359395-14359417 TGAGAGATGCTGAGGGTGCATGG - Intergenic
1144596272 17:16572761-16572783 AGGTAGATCCTGAGGGGGCACGG - Intergenic
1151660978 17:75517741-75517763 TGTCACATGCTGGGGCTGCAGGG + Intronic
1156013263 18:32518237-32518259 ATTTTCATGCTGAGGATCCAAGG + Intergenic
1157553075 18:48594678-48594700 AGTTATCTGCTGTGGGTGCATGG - Intronic
1157790397 18:50525912-50525934 AGTTCGAGGCTGAGGCTGCAGGG + Intergenic
1162532989 19:11246587-11246609 AGTTACTTACTGAGGGTGTAGGG - Intronic
1163172008 19:15537840-15537862 AGATACATGGTGACTGTGCATGG - Intronic
1166043402 19:40216109-40216131 AGTTACATGGTGAGGTGGGAGGG + Exonic
1167062866 19:47161468-47161490 ACTTACCTGGTGAGGGTACAGGG - Intronic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
1168640715 19:58029537-58029559 AGTTCCAGGCGGAGGGTGGAGGG + Intergenic
925110610 2:1332622-1332644 GGTTTCATACTGAGGATGCAGGG + Intronic
925621518 2:5798204-5798226 AGTCCCATGATGAGGCTGCATGG - Intergenic
926273449 2:11385593-11385615 AGTCACATTCTGAGAGTGCTGGG + Intergenic
926736555 2:16077859-16077881 AGTTACATTCTGAGGCACCAGGG - Intergenic
929091698 2:38223792-38223814 AATTATATGCTGAGGTTGCTAGG - Intergenic
929837503 2:45419395-45419417 AGATAAATTCTGAGGGTTCAAGG - Intronic
936279537 2:111125269-111125291 AGTCACATGCTGTAGGTTCAAGG - Intronic
936520009 2:113205933-113205955 AGTTAGCTGGTGAGGGGGCATGG - Intronic
938223162 2:129589559-129589581 AGTTACATCCTGTGGGTTGATGG - Intergenic
939410198 2:141814943-141814965 AGATACAGGATGAGGATGCAAGG + Intronic
939872920 2:147544947-147544969 AATTACATGCTGAGTGTGATGGG + Intergenic
940663173 2:156573025-156573047 TGATACATGCTGACAGTGCAAGG + Intronic
941249446 2:163144225-163144247 AGTTACCTGCTGATGTTGTAGGG - Intergenic
941374139 2:164706644-164706666 AGATACAAGATGAGGGTGAATGG - Intronic
943150899 2:184111330-184111352 TGTTCCATTCTGAGGGTGAAAGG + Intergenic
943597535 2:189876201-189876223 AGTTACCTGCTGAGAGTGGAGGG + Intronic
946725410 2:222656800-222656822 AGTTACATTTAGAGGTTGCAGGG - Intergenic
1169196484 20:3685632-3685654 ATTTACATTTTGAGGTTGCAGGG + Intergenic
1170118897 20:12891511-12891533 AGTTACAAGCTGAGGCTCTAAGG - Intergenic
1173020183 20:39260515-39260537 AGTTACCTGGGGAGGCTGCAGGG - Intergenic
1173524838 20:43723960-43723982 AGGTTCATGCTGAGGGTTCCTGG - Intergenic
1174710227 20:52696786-52696808 AGTTAAATGATGAGAATGCACGG + Intergenic
1177447523 21:21217078-21217100 GGATAAATGCTGAGGGTGCCAGG + Intronic
1177815705 21:25974272-25974294 ACTTACATGATGAGGGGGCTGGG + Intronic
1179040611 21:37799123-37799145 AGTTACATGAAGAGAATGCATGG - Intronic
1180176881 21:46095117-46095139 AATTACATACTCAGGGGGCAGGG + Intergenic
1181475839 22:23167318-23167340 ACTCACATTGTGAGGGTGCAGGG - Intergenic
1182007580 22:26973891-26973913 TGTTTCATGATGAGGGTGCTGGG - Intergenic
1182823672 22:33243092-33243114 AGTCACATTCTGAGGTAGCAAGG + Intronic
1182896137 22:33860942-33860964 AGGACCTTGCTGAGGGTGCATGG - Intronic
1184486788 22:44784720-44784742 AGTCACATGCACAGGGTCCAGGG + Intronic
1184488979 22:44798498-44798520 TGTCACATTCTGAGGGTCCAGGG + Intronic
1185044004 22:48519911-48519933 AGTCACATTCTGAGGTTCCAGGG - Intronic
949528240 3:4927680-4927702 AGTAACATGGTGGGGGTGAATGG - Intergenic
950025232 3:9815667-9815689 AGATAGCTGCTGAGGGGGCAGGG - Intronic
950434967 3:12974042-12974064 ACTCACCTGCTGAGGATGCATGG + Intronic
955583324 3:60448686-60448708 AGTTACATTCTTAAAGTGCAGGG - Intronic
955881075 3:63546479-63546501 AGCTACATGCTGGGGGTGAGGGG + Intronic
956161847 3:66363233-66363255 AGAGACTTGCTGTGGGTGCAGGG + Intronic
967578790 3:191127136-191127158 AATTAGATACTGAGGGTGCTGGG - Intergenic
972742623 4:41902935-41902957 AGCTTCATCCTGAGGATGCAAGG - Intergenic
973362969 4:49182002-49182024 AGTTACATGCTGAGGGACTGTGG - Intergenic
975842143 4:78486470-78486492 GGTTACCTGCTGATGGCGCATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
982226274 4:153170409-153170431 AGCTTCAGGCTGATGGTGCAGGG + Intronic
983973678 4:173905245-173905267 ACTTACTTGCTGAGGGGCCATGG - Intergenic
985349990 4:189049847-189049869 AGTCACATGCTGAGGGTTGAGGG - Intergenic
985813171 5:2105485-2105507 AGTTACATCCTGAGTGTAAAAGG + Intergenic
986392208 5:7297607-7297629 AGTCACATGTGGAGAGTGCAGGG + Intergenic
988349660 5:30085842-30085864 AGATACATGTTGAGTGTGGATGG + Intergenic
989158973 5:38371935-38371957 AGTTCCATGGGGAGGGTGGATGG - Intronic
994443718 5:99844335-99844357 AGTTATATTCTGAGGTGGCATGG + Intergenic
994750296 5:103728872-103728894 AGTTTCTTGCTGAGGGTCCAAGG - Intergenic
998106315 5:139471421-139471443 AGGGCCATGCTGAGAGTGCAGGG + Intergenic
998948969 5:147372506-147372528 AATTACACCCTGAGGTTGCATGG + Intronic
999172411 5:149606593-149606615 AGTTACCTACAGAGGGTGGACGG - Intronic
1002551379 5:179995341-179995363 AGTCCCATGATGGGGGTGCAGGG + Intronic
1002573284 5:180156223-180156245 AGGTGCATGCTGATGGTGCAAGG + Intronic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1004131114 6:12921144-12921166 AGTGACAAGCTTAGGGTGCTTGG - Intronic
1010749301 6:79600319-79600341 AGTTAAATGTTGTGGGTGAATGG - Intergenic
1015138969 6:129908527-129908549 AGGTCCTTGCTGAGGGTGAAGGG - Intergenic
1015787328 6:136931286-136931308 AATCTCATTCTGAGGGTGCAGGG - Intergenic
1017085001 6:150705567-150705589 AGTAACATGCTTAGTTTGCAAGG - Intronic
1017343485 6:153353551-153353573 AGTTACCTGCTGATGGGGTAAGG - Intergenic
1017400272 6:154053336-154053358 GGTCACATGCAGTGGGTGCAGGG - Intronic
1017636690 6:156450911-156450933 AGTTAGATGCTTAGGGGCCAGGG - Intergenic
1019140003 6:169937058-169937080 AGTGACATCCTGAGGCTCCAGGG + Intergenic
1021345546 7:19523468-19523490 AGATACCTGCTGAGAGTGAAGGG + Intergenic
1021465559 7:20938993-20939015 AATGACATCCTGAGGGTACACGG + Intergenic
1022226252 7:28366946-28366968 AGGTACATTCTGAGGCTGAAAGG + Intronic
1023351396 7:39323498-39323520 AGGTAGAAGCTGATGGTGCATGG - Intronic
1026376461 7:69755948-69755970 AGTTAAATCATGATGGTGCATGG - Intronic
1026614092 7:71886379-71886401 AGTGACATGCTAAGGGGGCGTGG - Intronic
1028584633 7:92440467-92440489 AGATACCAGCTGAGGGGGCAGGG + Intergenic
1034418518 7:150977560-150977582 TGTGACACGCTGAGTGTGCAGGG - Intronic
1038484852 8:27927251-27927273 AGTTTCCTGCTCAGGGAGCAGGG - Intronic
1038765564 8:30424507-30424529 AGTTAGTTACTAAGGGTGCATGG + Intronic
1039191257 8:34978437-34978459 AGTCAGTTGCTGAGGATGCAAGG - Intergenic
1039284099 8:36021598-36021620 AGTAACATGCAGAGGGTGAGAGG - Intergenic
1043672042 8:82898583-82898605 AGTTCCATACTAAGGATGCAGGG - Intergenic
1044607256 8:94058156-94058178 AGCTCCATGCCGAGGCTGCAAGG - Intergenic
1045660529 8:104432913-104432935 AGTTACATTCTGAGGTACCAGGG - Intronic
1046329984 8:112701646-112701668 AGTTACCTTCAGAGTGTGCAGGG - Intronic
1046546004 8:115650922-115650944 GCTTGCATGCTGAGGGGGCAAGG - Intronic
1046648690 8:116813341-116813363 TGTCACATGCTGATGCTGCAGGG + Intronic
1047891912 8:129321981-129322003 AGTTACATGCTGAGGCTACAGGG - Intergenic
1048294175 8:133202526-133202548 CTTTACATGATGAGGGTACAAGG - Intronic
1048605710 8:135966611-135966633 GGTTGCATGCTGTGGGTACAGGG + Intergenic
1048919579 8:139215707-139215729 AGACACATGCTGTGTGTGCAGGG + Intergenic
1049071169 8:140357229-140357251 AGTCACATGGTGAAGGGGCAGGG + Intronic
1049322232 8:142002671-142002693 AGTGAGAAGCCGAGGGTGCAGGG + Intergenic
1049945109 9:586859-586881 ACTTTCCTGCTGGGGGTGCAGGG - Intronic
1050032349 9:1399816-1399838 TGATACATGCTGAGTGTACAGGG + Intergenic
1051850515 9:21501589-21501611 AGTTACATACTGATGGTGAAAGG + Intergenic
1052336634 9:27326811-27326833 AATTTCATGGTGATGGTGCAAGG - Exonic
1052462373 9:28782403-28782425 TGTTATGTGCTGAGGATGCAAGG + Intergenic
1053227149 9:36369788-36369810 AGATACATTCGGAGGGTGGAAGG + Exonic
1056639016 9:88354411-88354433 AGTTACATTCAGAGAGTGAAGGG + Intergenic
1058910522 9:109516503-109516525 AGATCCATGGTGAGGGTGTAAGG + Intergenic
1061801853 9:133117066-133117088 AGTGCCATGCTGAAGGTGCCAGG + Intronic
1062068528 9:134541849-134541871 ATTCTAATGCTGAGGGTGCAGGG + Intergenic
1062488443 9:136792474-136792496 AGTCACATGCTGAGGAGGCCGGG - Intronic
1187252557 X:17612044-17612066 AATAACATGCTGGGGGTGTAGGG - Intronic
1190308410 X:49100058-49100080 AGTCACATGCTGAAGGGACAGGG - Intronic
1192773531 X:74217990-74218012 AGCTACTTGCTGATGTTGCATGG - Intergenic
1193024972 X:76837066-76837088 AGCTACATGATGAGAATGCATGG + Intergenic
1196529123 X:116762874-116762896 AGTTAGATGCTGTTGGTTCATGG - Intergenic
1196977953 X:121180583-121180605 AGTTTCATGCATAGGCTGCATGG - Intergenic
1197935013 X:131731141-131731163 AGATGCTTGATGAGGGTGCATGG - Intergenic
1199801928 X:151260216-151260238 AGTTACATTCTGAGGTACCAGGG + Intergenic