ID: 1102157480

View in Genome Browser
Species Human (GRCh38)
Location 12:110742728-110742750
Sequence TCCCGCAGCGGCGCCGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102157473_1102157480 -9 Left 1102157473 12:110742714-110742736 CCCACCGCCGACCCTCCCGCAGC 0: 1
1: 0
2: 0
3: 22
4: 232
Right 1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 23
4: 240
1102157472_1102157480 -5 Left 1102157472 12:110742710-110742732 CCTTCCCACCGCCGACCCTCCCG 0: 1
1: 0
2: 1
3: 35
4: 409
Right 1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 23
4: 240
1102157474_1102157480 -10 Left 1102157474 12:110742715-110742737 CCACCGCCGACCCTCCCGCAGCG 0: 1
1: 0
2: 4
3: 16
4: 280
Right 1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 23
4: 240
1102157471_1102157480 1 Left 1102157471 12:110742704-110742726 CCATCGCCTTCCCACCGCCGACC 0: 1
1: 0
2: 0
3: 21
4: 224
Right 1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 23
4: 240
1102157470_1102157480 4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1102157470 12:110742701-110742723 CCGCCATCGCCTTCCCACCGCCG 0: 1
1: 0
2: 0
3: 13
4: 223
Right 1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 23
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102157480 Original CRISPR TCCCGCAGCGGCGCCGCCGC CGG Exonic
900494079 1:2968497-2968519 TCCCGCAGCCGCGCACCCGCCGG - Intergenic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
902823224 1:18956190-18956212 TCCCGCAGCGCCGCCGTCACCGG + Exonic
903832900 1:26185119-26185141 GCCCGCGCTGGCGCCGCCGCTGG + Exonic
905414327 1:37794188-37794210 TGCAGGCGCGGCGCCGCCGCCGG - Exonic
905803869 1:40862192-40862214 TCCCGCCGCAGAGCAGCCGCTGG - Exonic
913131172 1:115839223-115839245 TCCCTCAGCGGCCCGGCTGCCGG - Exonic
913469073 1:119171918-119171940 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
913959329 1:143327046-143327068 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
913959339 1:143327090-143327112 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053648 1:144152426-144152448 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053658 1:144152470-144152492 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914125539 1:144814071-144814093 TCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125549 1:144814115-144814137 TCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914170066 1:145215288-145215310 TCCAGCAGCGGCGGCACAGCGGG - Intergenic
917737241 1:177932520-177932542 GCCCGCAGCTGCTCCCCCGCTGG + Exonic
918015953 1:180632458-180632480 CCCCGCAGCCCCGCTGCCGCCGG + Intronic
919820549 1:201469267-201469289 CCCCGCTGCGGCCCCGCCCCCGG - Intergenic
920878384 1:209858596-209858618 TACCGCAGCGGGGCCGCAGGTGG + Intergenic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
921909166 1:220528601-220528623 TACCCCGGCGGCGCCGCCGCGGG + Exonic
922250742 1:223846365-223846387 TGGCCCAGCGGCGCGGCCGCCGG - Intergenic
922481181 1:225940931-225940953 TCCTGCTGCGGCGCAGCCACGGG - Exonic
922586386 1:226737492-226737514 TCCCGCTCCTGCTCCGCCGCCGG + Exonic
1064202952 10:13299911-13299933 TCAGGCGGCGGCGCCGGCGCCGG + Intronic
1064461103 10:15535350-15535372 TCCCGCACCGGCGCCGCAGGTGG - Intronic
1064712433 10:18140766-18140788 TCCCACAGCGGCGGCGGCGGTGG + Exonic
1065844630 10:29735225-29735247 TCCCAGACCGGCGCCTCCGCAGG - Intronic
1065993127 10:31031940-31031962 CCCCGCCCCGGCGCCGCGGCGGG + Intergenic
1065993128 10:31031941-31031963 TCCCGCCGCGGCGCCGGGGCGGG - Intergenic
1067140017 10:43648840-43648862 GCCCGCAGCAGCGCCAGCGCCGG + Intronic
1069695527 10:70382692-70382714 TCCCGCCGCGGCGCCGGTCCTGG - Intergenic
1070328274 10:75401600-75401622 GCCCGCAGCGGAGCCGTGGCCGG + Exonic
1070564018 10:77590228-77590250 TCCCGCACCGGGGCCGCAGGTGG + Intronic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1071532353 10:86400197-86400219 TCCCGCAGGGCCGCAGCCGCGGG - Intergenic
1072654297 10:97319649-97319671 GCCCGCAGCGGCGCCCCCGGGGG - Exonic
1072656589 10:97334355-97334377 GCCCGCAGCGGCACCCCCGGGGG + Exonic
1075207099 10:120457235-120457257 TCCCGCAGCTCGGCCGGCGCCGG - Exonic
1076554254 10:131311692-131311714 CTCCGGAGCCGCGCCGCCGCCGG - Exonic
1076650332 10:131982551-131982573 TCACGCAGGGGCGCCCCGGCGGG - Intergenic
1076721658 10:132395955-132395977 TCCCACTGCCGCGCGGCCGCCGG + Intergenic
1077898785 11:6473906-6473928 CCCCGCGCCGGCGCCGCCGCCGG + Intronic
1077898786 11:6473907-6473929 TCCGGCGGCGGCGCCGGCGCGGG - Intronic
1078057341 11:8019074-8019096 TGCCGCAGCCGCGCCCCCGCGGG + Intergenic
1080107427 11:28525744-28525766 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1081574154 11:44309089-44309111 TCCTCGGGCGGCGCCGCCGCAGG - Intronic
1083807529 11:65084000-65084022 TCCTCCAGCGCCGCCGCCCCGGG + Exonic
1083997116 11:66278148-66278170 TCGCGCGGCGGCCCCGCCCCCGG + Intergenic
1084522852 11:69675125-69675147 TCTCCCAGCGGCTTCGCCGCCGG - Intronic
1086397674 11:86433470-86433492 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1088481084 11:110296746-110296768 TCCCGCAGGCTCGCAGCCGCAGG + Intergenic
1088585090 11:111354536-111354558 GCCCGCAGTGGGGCCCCCGCTGG - Exonic
1091028399 11:132161751-132161773 TCCCGCAGCTGCGCCATCCCCGG + Intronic
1091335335 11:134762204-134762226 TCCAGCAGCGCAGACGCCGCCGG + Intergenic
1092239562 12:6828603-6828625 TCCCGCAGCAGCGCCACGGCCGG - Exonic
1092385300 12:8032470-8032492 TCCCGGAGCCACGCGGCCGCAGG + Intergenic
1094025809 12:25958860-25958882 TCCCGCGGCGTCTCTGCCGCTGG + Intergenic
1095271474 12:40224690-40224712 CACCGCAGCGGCGGCGCGGCCGG - Intronic
1100444817 12:94650581-94650603 CCCCGCGGCGGCGGCGGCGCAGG - Intergenic
1101466921 12:104958359-104958381 AAGCGCAGCCGCGCCGCCGCCGG + Intronic
1102136918 12:110583110-110583132 AGCCGCAGTCGCGCCGCCGCTGG + Exonic
1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG + Exonic
1102157481 12:110742729-110742751 GCCGGCGGCGGCGCCGCTGCGGG - Exonic
1106187806 13:27424566-27424588 CGCAGCAGCGGCGCCGACGCGGG + Exonic
1106340281 13:28820390-28820412 TCCACCTGCGCCGCCGCCGCCGG + Exonic
1106422481 13:29595420-29595442 TGCCGGAGCCCCGCCGCCGCCGG - Exonic
1106512417 13:30422470-30422492 TCCCTGAGCTGCGCGGCCGCCGG - Intergenic
1107695102 13:42992184-42992206 TCCCGCAGCGACGGCGGCCCGGG - Exonic
1107951355 13:45465064-45465086 TCCCGCTCCGCCGCCGCCTCAGG - Exonic
1112652757 13:101416504-101416526 TCACTGAGCGCCGCCGCCGCCGG + Intergenic
1113656101 13:112068503-112068525 GCCCGCAGCGGCGGCGGCGGCGG - Exonic
1114957839 14:27845786-27845808 TCCCCCAGCGGCCCCAGCGCGGG + Intergenic
1115235834 14:31207807-31207829 TCCCCCGGCGGCGACCCCGCCGG + Intergenic
1117803096 14:59464934-59464956 GACAGCAGCGGCGCCGCCTCCGG + Exonic
1117913872 14:60657347-60657369 TCCTCCGGCCGCGCCGCCGCCGG - Intronic
1121074972 14:91060397-91060419 GGCAGCAGCGGCGGCGCCGCGGG - Exonic
1122993170 14:105248539-105248561 TGACGCACCGGCGCCGCGGCGGG + Intronic
1127994874 15:64147547-64147569 TACCGCAGCAGCCCCGCCGGGGG - Intergenic
1128028702 15:64460930-64460952 TCAGGCAGCGCCGCCGCCCCCGG - Intronic
1128119234 15:65133549-65133571 TCCCGCGGCGGAGGCGGCGCTGG - Exonic
1129189029 15:73927031-73927053 CCCAGCAGCGGCGCAGCCACGGG + Exonic
1129189030 15:73927032-73927054 TCCCGTGGCTGCGCCGCTGCTGG - Exonic
1129199875 15:73992335-73992357 ACCCGCGGCGGCGCGGGCGCAGG + Exonic
1129199876 15:73992336-73992358 TCCTGCGCCCGCGCCGCCGCGGG - Exonic
1129322291 15:74782053-74782075 TCGCGCAGGCGCGCTGCCGCGGG + Exonic
1129764072 15:78149811-78149833 TCCCGCAGCAGGGCCGCAGCCGG - Intronic
1129856940 15:78831243-78831265 CCCAGCAGTGGCGCCGCCACTGG + Intronic
1130030375 15:80308391-80308413 TCCCCCAGGGGCTCCGCCCCAGG + Intergenic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1131012631 15:89031646-89031668 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1131112972 15:89776864-89776886 CCCCGCAGAGGCGCAGACGCAGG + Exonic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132794199 16:1711013-1711035 TCCCGCAGCGGAGCGGCAGAGGG - Intronic
1132826159 16:1906700-1906722 TCCTGCAGGGGCGCTGGCGCTGG + Intergenic
1133006247 16:2883320-2883342 ACCCGCCGCGGCGCTGTCGCCGG + Exonic
1137442585 16:48509101-48509123 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
1138179753 16:54933253-54933275 TCCGCCAGCCGCGCCGCCGCTGG - Exonic
1140188715 16:72796507-72796529 TCCGGCAGCGCCGCCTCAGCCGG - Exonic
1141608619 16:85169352-85169374 CCTCGCAGCGGCGCCCCCCCGGG - Intergenic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142896575 17:2983041-2983063 TCGGGCAGCAGCGCCGTCGCTGG + Intronic
1144656930 17:17042731-17042753 TCCCTCGCCGGCCCCGCCGCAGG - Intronic
1145782417 17:27571808-27571830 TACAGCAGCGGTGCCGCCCCTGG + Intronic
1146054046 17:29572501-29572523 TCGCGCAGCAGCGCCTCCACGGG + Exonic
1147710322 17:42458839-42458861 CCCCGCCCCTGCGCCGCCGCCGG - Intronic
1147971444 17:44220598-44220620 TCCCACAGCGGCCCCTCCGCCGG - Intronic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148755770 17:49972247-49972269 TCGCGCTGCGGTGCCGCCGCGGG - Intronic
1149916477 17:60614052-60614074 TCCCGCACCGGGGCCGCAGGTGG - Intronic
1150804536 17:68308859-68308881 TCCCGCACCGGCGCTGCAGGTGG + Intronic
1151854339 17:76710634-76710656 TCCCGCGGCGGCGCCAGCGGAGG - Exonic
1155053823 18:22169042-22169064 TCCCGCCGCGGCGGCGGCGCGGG + Intergenic
1155053824 18:22169043-22169065 TCCCGCGCCGCCGCCGCGGCGGG - Intergenic
1156213837 18:34976941-34976963 TCCCGGAGCGGCGGCGGCGGCGG + Intronic
1157298050 18:46459936-46459958 TGCAGCAGCTGTGCCGCCGCGGG + Exonic
1157856834 18:51111790-51111812 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1160702526 19:514850-514872 TCCTGCAGCGGCCCCCACGCTGG + Intronic
1161473439 19:4472577-4472599 ACCCGCAGCGGCCCCGCCCTGGG + Intronic
1162577107 19:11505552-11505574 TCCAGCCGCTGCGGCGCCGCAGG + Exonic
1162772363 19:12956962-12956984 TCCCGCAGCTGCTCCGGCGACGG + Exonic
1162923772 19:13919257-13919279 GCCCCCAGAGGCCCCGCCGCTGG + Intronic
1162959476 19:14117572-14117594 TCCCGGAGCTGCGGCGCGGCGGG + Exonic
1165049867 19:33134580-33134602 TCCCGCACCGCCCCCGCCTCTGG - Intronic
1165454028 19:35900512-35900534 TTCCCCCGCGGAGCCGCCGCCGG + Exonic
1166078102 19:40425623-40425645 TCCCGAAGCGGCGGCGGCGGGGG + Intronic
1166984149 19:46649583-46649605 TCCTGCGCAGGCGCCGCCGCCGG - Exonic
1167418809 19:49390853-49390875 GCCAGCAGCTGCGCCGCGGCAGG + Exonic
1167595980 19:50428352-50428374 TCCCCCAGCGGCTCCGCAGGTGG - Exonic
1202693041 1_KI270712v1_random:104849-104871 TCTCTCCGCCGCGCCGCCGCTGG - Intergenic
926077156 2:9951163-9951185 ACCGGCAGAGGCGCCCCCGCCGG + Intergenic
927751316 2:25673250-25673272 TCCTGCAGCGCCGCACCCGCAGG + Intronic
928904505 2:36355871-36355893 CCCCGCAGCGGCGCAGCCTCCGG - Intergenic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
932599378 2:73113126-73113148 TCCCGCGGTGGCCCCGCCCCTGG + Intronic
933506385 2:83181413-83181435 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
933666862 2:84971285-84971307 TCCCGCGGCGGCGGCGGCGGCGG - Exonic
934479464 2:94622148-94622170 TCCCCCAGCGGCCCCAGCGCGGG - Intergenic
940300987 2:152176044-152176066 GCCCCCTGCCGCGCCGCCGCTGG - Intergenic
941104847 2:161341014-161341036 TCCCGCGGCGGCGCCAGCGGAGG - Intronic
943790103 2:191922001-191922023 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
944048204 2:195437805-195437827 TCCCGCATCTGCACCTCCGCTGG - Intergenic
944563352 2:200963543-200963565 CCCCGCTGAGTCGCCGCCGCAGG + Exonic
946394255 2:219435253-219435275 CCCCGCAGCGCCGCAGCCACAGG - Exonic
947418480 2:229921700-229921722 TTCCGCGGCCCCGCCGCCGCCGG + Intronic
948207045 2:236168008-236168030 TCCCCGCGCCGCGCCGCCGCCGG + Exonic
948487189 2:238288535-238288557 TCGGGCAGCGGAGGCGCCGCCGG - Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1168802632 20:653182-653204 TCCCGCGGCGGCGGCGACGATGG - Exonic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1172367909 20:34363724-34363746 GCCCGCGCCGGCCCCGCCGCCGG - Intronic
1172409342 20:34710113-34710135 TCCAGCAGCGCCGCCCGCGCTGG - Exonic
1172654365 20:36527998-36528020 CCACCCAGCGCCGCCGCCGCTGG + Exonic
1174287769 20:49484196-49484218 TCCCGCGGCGGCGGCGGCGGCGG + Intergenic
1175399480 20:58692597-58692619 GCCTCCAGCGGCGCCGCCCCTGG - Exonic
1175517228 20:59577416-59577438 TCGCGTGGCGGCGCCGCCCCCGG + Intergenic
1175911405 20:62407015-62407037 ACCGCCAGCGCCGCCGCCGCCGG - Exonic
1176548359 21:8211520-8211542 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176567290 21:8394555-8394577 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1181077602 22:20392357-20392379 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1181725137 22:24806241-24806263 TGCAGCAGCAGCGCCGCGGCCGG + Intronic
1183683773 22:39350211-39350233 GCCCGCCGCCGCGCCGCCGCCGG - Intronic
1184620322 22:45671884-45671906 CCCTGAAGCTGCGCCGCCGCCGG - Exonic
1185055243 22:48575803-48575825 TGCCGCACCATCGCCGCCGCCGG - Intronic
1185342914 22:50299649-50299671 TCCCGCAGCGCCGCGCCCGTGGG + Intronic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
950018429 3:9769831-9769853 CCCCGCGGCGGGGCAGCCGCAGG - Exonic
951217759 3:20040595-20040617 TCCCCCTGCGCCGCTGCCGCCGG + Exonic
953002962 3:38951565-38951587 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
953027530 3:39153563-39153585 TCCGGCAGCGGCGGCGGCGGCGG + Exonic
953246448 3:41198923-41198945 CCCCGCAGCTGCCCCGTCGCTGG - Intronic
955210358 3:56934879-56934901 TCCCGCAGCGGGGCTGCAGGTGG - Intronic
955911575 3:63863960-63863982 TCCCGCGGCGGCGGCGGCGGCGG - Intergenic
956632671 3:71331511-71331533 TCCCGCACCGGGGCCGCAGGTGG - Intronic
956677939 3:71753430-71753452 TCCGGCGGCGGCGCCCGCGCTGG - Intronic
959984949 3:112561924-112561946 TGCCGTAGCTGCGCCGCCACCGG + Exonic
961674401 3:128555842-128555864 GCCCGCAGCGGCTGCGGCGCTGG + Intergenic
964720621 3:159764764-159764786 ACCCGCAGCGGCGGCGGCGGGGG + Exonic
965590440 3:170356992-170357014 TCCCCCTGCGGGGCCGCAGCTGG - Intergenic
966860844 3:184230227-184230249 TCCCGCCGCGGCTCCCCCGGGGG - Intronic
968225556 3:196969918-196969940 GCCCGCAGCGGCGAGGCCACCGG - Intergenic
968512685 4:1002542-1002564 CCCCGCAGCGGGGCCTTCGCAGG - Intronic
968923062 4:3532526-3532548 GCCGGCAGCGGCGAGGCCGCCGG + Exonic
969357751 4:6640545-6640567 TGCGGCCGCGACGCCGCCGCCGG + Exonic
974047268 4:56908349-56908371 TCCGGCGGCGGCGGCCCCGCCGG + Intronic
974549289 4:63349847-63349869 TCCCGCAGCAGCGGCGGCACTGG - Intergenic
976389365 4:84493329-84493351 TCCAGCAGCGGCGGCGGCGGCGG - Exonic
979290743 4:118976996-118977018 TCCCGCACCGGGGCTGCAGCTGG + Intronic
980051857 4:128047505-128047527 TCCCGCAGCGGGGCTGCAGGTGG + Intergenic
980130064 4:128809969-128809991 TCCCGCGGCGGCGACGGCGGCGG + Intronic
981093459 4:140756281-140756303 TCGCGGGGCGGCGACGCCGCGGG - Intergenic
981146649 4:141332964-141332986 TCCCGCAGCGGGGCTGCAGATGG + Intergenic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
984888843 4:184473817-184473839 GCCTGGAGAGGCGCCGCCGCGGG + Intronic
986813658 5:11385159-11385181 TCCCGCGGCGGCGGCGGCGGCGG + Exonic
987132480 5:14872046-14872068 GCCCTCAGCGCCGCCGCCCCCGG - Intergenic
990955105 5:61332658-61332680 GCCGCCCGCGGCGCCGCCGCCGG - Exonic
995571698 5:113488356-113488378 TCCAGCAGCGGCGGCGGCGGCGG - Exonic
996234294 5:121107591-121107613 TCCCGCAGCGGGGCTGCAGGTGG - Intergenic
997643681 5:135466331-135466353 TCCCGCACCGGCGCAGACGGCGG - Intergenic
997990806 5:138543135-138543157 CGCCGCCGCGGAGCCGCCGCCGG - Exonic
1000082265 5:157859107-157859129 TGCCACAGCAGCGGCGCCGCCGG + Exonic
1002895556 6:1378279-1378301 TCAGGCAGCGCAGCCGCCGCCGG - Intergenic
1004442009 6:15662862-15662884 TCCAGCATTGCCGCCGCCGCCGG + Exonic
1005522774 6:26614562-26614584 TCCAAGAGGGGCGCCGCCGCAGG - Intergenic
1006302354 6:33200323-33200345 TCCCGCAGCGGCGGCGGCGGCGG - Exonic
1007571054 6:42891073-42891095 GCCCGCAGCGGCGCGTCCGCAGG - Intergenic
1007785296 6:44276284-44276306 TCCCGCTGCGGCTGCGCCACAGG - Exonic
1008027290 6:46652879-46652901 TCCCTCTGCGGCTCCGCCCCCGG - Intergenic
1011044371 6:83065808-83065830 CGCCGCAGCGGGGCTGCCGCTGG - Exonic
1011128738 6:84033709-84033731 ACCCGCAGCGGAGGCGGCGCGGG - Intergenic
1011974833 6:93283020-93283042 TCCCGCACCGGGGCCGCAGGTGG - Intronic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1019471992 7:1226004-1226026 GGCTGCAGCGGCGCCGGCGCCGG - Intergenic
1020136863 7:5592613-5592635 CCCCGCAGCGCCGCCGCCTGAGG - Intergenic
1022427949 7:30285539-30285561 GGCCGCCGCGGCGCCGCCGGAGG - Exonic
1024025595 7:45407785-45407807 TTCAGCAGGGGCGCCGCCGATGG + Intergenic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1026805098 7:73424364-73424386 TTCAGCAGCGGCGGCGCCTCCGG + Intergenic
1027674551 7:81142153-81142175 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
1028621430 7:92833339-92833361 CGCCCCAGCGGCGCCGCGGCGGG - Exonic
1028922341 7:96322038-96322060 GCCCCCACCGCCGCCGCCGCCGG - Exonic
1029123117 7:98281516-98281538 TCCCGAAGCCGCCCCGCCGGCGG - Intronic
1032130714 7:129225238-129225260 TCCCGCCGCGGAGCGGCCCCCGG + Exonic
1033866574 7:145697358-145697380 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1034182159 7:149147474-149147496 ACCCGCAGCGGCCCCTCAGCTGG - Exonic
1036578849 8:10054452-10054474 TCCGGCTGCGGCTCCGCTGCCGG + Exonic
1036578850 8:10054453-10054475 ACCGGCAGCGGAGCCGCAGCCGG - Exonic
1036723732 8:11201071-11201093 CGCCGCAGCGCCGCCGCCGACGG - Exonic
1038575506 8:28701149-28701171 TTCCGCAGGGGCGCCGGCCCCGG - Intronic
1042236025 8:66613583-66613605 TCCGGAAGCGGCGCCGGAGCGGG + Intronic
1043073270 8:75665411-75665433 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1049535895 8:143181599-143181621 TCCCGCAGCCGTGCCTGCGCGGG + Intergenic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049612118 8:143560632-143560654 TGCAGCAGCTGCGCAGCCGCGGG + Exonic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1050160989 9:2718458-2718480 GCCCGCAGCGGCGCCGCCTCTGG + Exonic
1050160990 9:2718459-2718481 TCCAGAGGCGGCGCCGCTGCGGG - Exonic
1052837746 9:33264478-33264500 CCCACCAGGGGCGCCGCCGCCGG - Exonic
1053678365 9:40461432-40461454 TCCCCCAGCGGCCCCAGCGCAGG + Intergenic
1053928348 9:43089776-43089798 TCCCCCAGCGGCCCCAGCGCGGG + Intergenic
1054285359 9:63163515-63163537 TCCCCCAGCGGCCCCAGCGCGGG - Intergenic
1054291443 9:63296969-63296991 TCCCCCAGCGGCCCCAGCGCGGG + Intergenic
1054389461 9:64601508-64601530 TCCCCCAGCGGCCCCAGCGCGGG + Intergenic
1054506255 9:65914863-65914885 TCCCCCAGCGGCCCCAGCGCCGG - Intergenic
1055513808 9:77018424-77018446 TCCCGCAGCTGCGCCCCACCCGG - Intergenic
1055530355 9:77177575-77177597 TTCAGCTGCGGCGCCCCCGCTGG - Exonic
1058866651 9:109167172-109167194 GGCCGCAGCGGGGGCGCCGCGGG + Exonic
1060305309 9:122406145-122406167 TCCCGCAGCGGGGCCGCAGGTGG + Intergenic
1062341409 9:136095304-136095326 CCCCGCCGCGGTGCGGCCGCCGG - Intergenic
1062676752 9:137750758-137750780 TCCGGCAGCCGCGCCCCCTCCGG - Intronic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1185432967 X:19963-19985 TCCCGCAGCGGCCCAGCCCCGGG + Intergenic
1186496502 X:10015715-10015737 TCCTTCCGCGCCGCCGCCGCGGG + Exonic
1187900940 X:24025859-24025881 TTCCCCCGCGGCGCCGCCGTCGG + Intronic
1190220366 X:48508940-48508962 TCCCGGGGCGGCCCGGCCGCCGG - Intronic
1194977595 X:100409722-100409744 TCCCGCGGCGGCGGCGGCGGCGG - Exonic
1200292489 X:154886333-154886355 TCCCGACGCGCCGCCGCAGCTGG - Exonic
1200339333 X:155382073-155382095 TCCCGACGCGCCGCCGCAGCTGG - Intergenic
1200347137 X:155458620-155458642 TCCCGACGCGCCGCCGCAGCTGG + Exonic
1201904751 Y:19077127-19077149 TCCCGCTGCGGTAGCGCCGCCGG - Intergenic